ID: 902180317

View in Genome Browser
Species Human (GRCh38)
Location 1:14683390-14683412
Sequence AGCCCCCGGAGGAGAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902180317_902180325 17 Left 902180317 1:14683390-14683412 CCACCCATTCTCCTCCGGGGGCT 0: 1
1: 0
2: 1
3: 18
4: 182
Right 902180325 1:14683430-14683452 CCTCAACTCAAGATGCTATTAGG 0: 1
1: 0
2: 0
3: 21
4: 558
902180317_902180326 26 Left 902180317 1:14683390-14683412 CCACCCATTCTCCTCCGGGGGCT 0: 1
1: 0
2: 1
3: 18
4: 182
Right 902180326 1:14683439-14683461 AAGATGCTATTAGGCATTCTTGG 0: 1
1: 0
2: 2
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902180317 Original CRISPR AGCCCCCGGAGGAGAATGGG TGG (reversed) Intronic