ID: 902180969

View in Genome Browser
Species Human (GRCh38)
Location 1:14688078-14688100
Sequence GCCCTAGACGTCTCTACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 56}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902180962_902180969 8 Left 902180962 1:14688047-14688069 CCAGTCATAGTTTGGCTCTACCC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 902180969 1:14688078-14688100 GCCCTAGACGTCTCTACTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902180969 Original CRISPR GCCCTAGACGTCTCTACTCC TGG Intronic
900788833 1:4666377-4666399 GCCCTAGATGGCTCCAGTCCTGG - Intronic
902180969 1:14688078-14688100 GCCCTAGACGTCTCTACTCCTGG + Intronic
906077883 1:43065389-43065411 GCCCTTGACGTCTGTAGCCCTGG - Intergenic
912877468 1:113375724-113375746 TCCATAGACCTCTCTGCTCCAGG + Intergenic
915263108 1:154693819-154693841 GCCCTATATGCCTCTTCTCCTGG - Intergenic
918357301 1:183717297-183717319 GCCCTAGAGGTTTCTACACTTGG - Intronic
921654792 1:217721925-217721947 GCCCTGGACCTGTCAACTCCAGG - Intronic
1064090570 10:12379826-12379848 GCCAGATACGACTCTACTCCTGG + Intronic
1076981654 11:207990-208012 GCCGTAGACGCCTTTGCTCCCGG + Intronic
1077021321 11:418368-418390 GCCCTACACGTCTGTGCTCCTGG + Exonic
1084310711 11:68314649-68314671 GCCCTAGTCCTCTCTCCTCGGGG + Intronic
1085049493 11:73372895-73372917 CCCCTAGATTTCTCTTCTCCAGG + Intergenic
1087023986 11:93631874-93631896 GCCCTAGAGGACTTTTCTCCAGG + Intergenic
1096243143 12:49970072-49970094 GCCCAGGACTTGTCTACTCCTGG - Intronic
1118886491 14:69871083-69871105 GCCCTAGATGACTGTAATCCTGG + Intronic
1121432590 14:93898430-93898452 GCCCTGGACGTCCATCCTCCAGG + Intergenic
1121525494 14:94616322-94616344 GCCCTGCAGGTCTCCACTCCAGG - Intronic
1126883912 15:53129408-53129430 GCCATAGACGTAACTGCTCCTGG - Intergenic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1132643903 16:990079-990101 GCCCTACACTGCTCTGCTCCAGG - Intergenic
1132940592 16:2505781-2505803 GTCCTGGACGCCTCTTCTCCAGG + Intronic
1140890436 16:79280269-79280291 GCCCCAGACCTCTCTTCTCCCGG - Intergenic
1145963017 17:28898286-28898308 GCCCTGGACATCTCTTTTCCTGG - Exonic
1147783895 17:42964282-42964304 GCCCTAGCCCTCTCCACACCAGG + Intronic
1151258869 17:72901234-72901256 GTGATGGACGTCTCTACTCCAGG + Intronic
1158351824 18:56572038-56572060 TCCCTAGAGCTCTCTTCTCCAGG - Intergenic
1160549566 18:79684938-79684960 GACCTCGTGGTCTCTACTCCCGG + Intronic
1163338569 19:16689441-16689463 GCCCTAGACGTGTCTACTGAGGG - Exonic
926896781 2:17699908-17699930 GTACGAGACGTCTCTGCTCCTGG + Intronic
945322488 2:208441256-208441278 GCCCTATATGTCTCTTCACCTGG - Intronic
1171970300 20:31560584-31560606 GTGCCAGCCGTCTCTACTCCTGG + Intronic
1174541279 20:51291627-51291649 GCCCCAGGGGGCTCTACTCCAGG + Intergenic
1181810903 22:25403391-25403413 GCCCTAGGCCTCTCTCCTCGGGG - Intronic
950184720 3:10938021-10938043 ACCGTAGAGGTCCCTACTCCTGG - Intronic
951266024 3:20568172-20568194 GCCCTATACATCTCTTCACCTGG - Intergenic
967286670 3:187878134-187878156 GCCATAGCCATCCCTACTCCAGG - Intergenic
969526076 4:7704744-7704766 GTCCTAAGCGTCTCTGCTCCTGG - Intronic
974587102 4:63893732-63893754 GCACTAGATGTCTCTATTCCAGG + Intergenic
982049038 4:151480933-151480955 GCCCTAGAAGTCTCTACAAAAGG - Intronic
984840125 4:184060400-184060422 GCCCTGGGGGTCTCTTCTCCTGG + Intergenic
986442930 5:7797419-7797441 GCCCCAGACGCCTCCACACCTGG + Intronic
989539627 5:42604070-42604092 ACCCTAGACATCTCTTCTTCTGG - Intronic
1002918112 6:1545229-1545251 GCCCTGGACATCTCTAGTTCCGG + Intergenic
1003891099 6:10564449-10564471 GCCCTTGACTTCTACACTCCAGG - Intronic
1005842432 6:29752506-29752528 GCCTTAGACCTCTGAACTCCGGG + Intergenic
1009930008 6:70165891-70165913 GGCGTAGACGTTTCTACCCCAGG - Intronic
1019716413 7:2541442-2541464 GCCCCAGGCGTCTCTACTGGGGG - Exonic
1028317313 7:89419539-89419561 GCCCCAGAGGCTTCTACTCCAGG + Intergenic
1029737588 7:102473233-102473255 GCTCTAGAAGCCTCAACTCCTGG - Exonic
1030330113 7:108261780-108261802 GCCCTAGCCATCTCTAATCTTGG + Intronic
1033593373 7:142834088-142834110 TCCCTACACGTCTCCACTCCAGG - Intergenic
1036539388 8:9689635-9689657 GAACTAGACGTCTCTGCTCCTGG + Intronic
1038201955 8:25421209-25421231 CCCCTAGACTACTCCACTCCAGG - Intronic
1038415829 8:27395196-27395218 GTGCTAGACTTCTCTATTCCTGG + Intronic
1045799040 8:106080256-106080278 GGCCTGGCCTTCTCTACTCCTGG + Intergenic
1049241617 8:141540277-141540299 GACCTGGGCGTCTCTGCTCCAGG - Intergenic
1049411177 8:142474653-142474675 GCCCCAGGAGTCTCTGCTCCCGG - Intronic
1055630597 9:78219775-78219797 TCCCTTGAGGTCTCTAGTCCTGG + Intergenic
1058706947 9:107645332-107645354 GCCCAAGACTGCTCTTCTCCAGG - Intergenic
1060650952 9:125326518-125326540 TCCCAAGACGTCTGTACTCCAGG - Exonic
1061715618 9:132517084-132517106 TCCCTAGACGGCTCCACTTCTGG + Intronic
1186363150 X:8863584-8863606 GCCCTAGTGATCTCTGCTCCTGG - Intergenic
1199816055 X:151397509-151397531 GCCTGAGACGTCTAAACTCCCGG + Intronic
1200175600 X:154113742-154113764 GACCTAGAATTCTGTACTCCCGG - Intergenic