ID: 902181182

View in Genome Browser
Species Human (GRCh38)
Location 1:14689749-14689771
Sequence GGGGCTGCTTAGACCCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902181170_902181182 25 Left 902181170 1:14689701-14689723 CCTGCCCAGATGGCAAGGGGCTG 0: 1
1: 0
2: 2
3: 16
4: 231
Right 902181182 1:14689749-14689771 GGGGCTGCTTAGACCCTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 200
902181171_902181182 21 Left 902181171 1:14689705-14689727 CCCAGATGGCAAGGGGCTGCGAA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 902181182 1:14689749-14689771 GGGGCTGCTTAGACCCTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 200
902181172_902181182 20 Left 902181172 1:14689706-14689728 CCAGATGGCAAGGGGCTGCGAAG 0: 1
1: 0
2: 0
3: 13
4: 101
Right 902181182 1:14689749-14689771 GGGGCTGCTTAGACCCTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902181182 Original CRISPR GGGGCTGCTTAGACCCTGGC AGG Intronic
900580256 1:3405200-3405222 TGTGGTGCTGAGACCCTGGCGGG - Intronic
901241346 1:7695571-7695593 GGTGCTTCTTAGGCCCTGGGGGG + Intronic
901837820 1:11935443-11935465 TGGTCTGCTTAGCCCCTGCCAGG + Intronic
902181182 1:14689749-14689771 GGGGCTGCTTAGACCCTGGCAGG + Intronic
904437737 1:30509661-30509683 GGGGCTGCTTCATCCCAGGCTGG + Intergenic
904837651 1:33349622-33349644 GGGGCTGCGTAGGCCCCGCCCGG - Intronic
905173801 1:36124468-36124490 GGGGATGCTGAGCCCCTGACAGG + Intronic
905621818 1:39454911-39454933 GGTGCTGCTTAGCCCATGTCAGG - Exonic
905919050 1:41707175-41707197 GGGGCTTCTTAGAGCCCAGCTGG + Intronic
907188378 1:52629446-52629468 GGGGCTGCTTTCACTCTGCCAGG + Intergenic
908612815 1:65881344-65881366 TGGTTTGCTTGGACCCTGGCTGG + Intronic
910773784 1:90854701-90854723 GGGGATGATTAGGCCCTGTCAGG + Intergenic
913552156 1:119926159-119926181 GGGGCTTCTTGGCCCCAGGCTGG - Intronic
915722438 1:157994473-157994495 GGGGCTTATTTGACACTGGCAGG + Intronic
920054560 1:203182801-203182823 GGAGCTGCTTTTTCCCTGGCTGG + Exonic
920825494 1:209421118-209421140 GGGGCTGCTGAGGCACCGGCGGG - Intergenic
921738536 1:218656634-218656656 GGGTCTGCTCAGACTCTGGCTGG + Intergenic
924325762 1:242892576-242892598 GGGGATGGTTTGACCCTGGAAGG + Intergenic
1066101430 10:32121878-32121900 GGAGCTGCTTGCCCCCTGGCTGG - Intergenic
1067317426 10:45181258-45181280 AGGCCTGCTGAGATCCTGGCAGG + Intergenic
1067847848 10:49737540-49737562 GGGCCCCCTTAGACCCTAGCAGG - Intronic
1073424097 10:103445898-103445920 GGTCCTGCTTTGTCCCTGGCAGG + Exonic
1074457924 10:113611682-113611704 GAGGCTGCTCAGAACCTGTCAGG - Intronic
1076402833 10:130194791-130194813 GGGGCTGGCTAGACACAGGCAGG + Intergenic
1076864691 10:133160866-133160888 GGGTCTGCTTACTCCCTGCCGGG + Intronic
1077077123 11:706861-706883 GGGGCTGCAGAGGCCCTGCCAGG + Intronic
1077095411 11:797047-797069 GGGGTTGCTCAGTCCCTGGAGGG - Intronic
1077364636 11:2156552-2156574 GCAGCTGCTCAGACCCTGGGTGG + Intronic
1077703918 11:4466244-4466266 GGGGCTGCTTGGGCCATAGCTGG - Intergenic
1078100231 11:8326075-8326097 GGGCCTGCTTAGACTCTGAAGGG - Intergenic
1078849577 11:15151540-15151562 GTGGCTGCTATGTCCCTGGCTGG + Intronic
1081991680 11:47341309-47341331 GGGCCTCCTGGGACCCTGGCTGG - Intronic
1082124846 11:48420389-48420411 GGGGGAGCTAAGAGCCTGGCTGG - Intergenic
1082251204 11:49982334-49982356 GGGGGAGCTCAGAGCCTGGCTGG + Exonic
1083259048 11:61513382-61513404 AGAGCTGCTTGGTCCCTGGCTGG + Intergenic
1084273043 11:68039129-68039151 GGGGCTCCGCAGACCCCGGCAGG - Intronic
1084960611 11:72714248-72714270 GGGGCTCCTCAGACTGTGGCTGG + Exonic
1088826154 11:113496150-113496172 AGGGCTGCTGAGACCCAGGATGG + Intergenic
1090076233 11:123581556-123581578 GGGGCTGCTTTGGACGTGGCTGG + Intronic
1090258454 11:125302325-125302347 GGGGCTGGTCAGATCATGGCTGG - Intronic
1094313526 12:29112948-29112970 GGAGTTGCTTAGAACCTGGAAGG + Intergenic
1094433396 12:30395347-30395369 GGGACTTATTAGGCCCTGGCCGG - Intergenic
1095139631 12:38645636-38645658 GGGGCTGCACAGAGCCAGGCAGG + Intergenic
1095960838 12:47833335-47833357 GGGGCTGCTGGGAGCCTGGCTGG + Intergenic
1096019099 12:48307387-48307409 ATGGCTCCTTAGACCCTTGCTGG - Intergenic
1097136508 12:56861424-56861446 GGGGTTGCTTTGTCCCTGGCTGG - Intergenic
1102865948 12:116374053-116374075 CGGGCTGCCTACACCCTAGCTGG - Intergenic
1103556199 12:121768090-121768112 GGGGCTTCTTAGACTCTGACAGG + Intronic
1105242615 13:18621274-18621296 GGGGGTGCATAGCCCCTGCCAGG - Intergenic
1106481057 13:30137036-30137058 GGGGAAGCAGAGACCCTGGCTGG + Intergenic
1106499055 13:30309562-30309584 GGGGCTTCTTACACAGTGGCAGG - Intergenic
1108620044 13:52173164-52173186 AGGACTGCTTGGACCCTGGGAGG + Intergenic
1113523366 13:110955711-110955733 GGGGTGGCTGAGACACTGGCTGG + Intergenic
1113701940 13:112394785-112394807 GGGGTGGCTGAGACACTGGCTGG - Intronic
1114216640 14:20662192-20662214 GGGGCTGTTGGGTCCCTGGCAGG - Intergenic
1116716279 14:48430938-48430960 AGGGCTGCTTAGGTGCTGGCAGG + Intergenic
1118254903 14:64197017-64197039 GGGGCTGCCTCGGCCCTGGGAGG + Intronic
1119671194 14:76519411-76519433 GGGGCTGGGAAGACCTTGGCTGG + Intergenic
1121674698 14:95742695-95742717 GGGGAAGCTAAGACCCTGGGAGG - Intergenic
1122161360 14:99786561-99786583 GGGGCAGCTCCTACCCTGGCGGG + Intronic
1122413302 14:101536947-101536969 GGGGCTCCTCAGCCCCTGGTGGG - Intergenic
1122823588 14:104359158-104359180 GAGGCTGCTTAGACGAGGGCAGG - Intergenic
1122995462 14:105261483-105261505 GAGGCTGCCCACACCCTGGCTGG + Intronic
1123488683 15:20763333-20763355 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1123545179 15:21332406-21332428 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1124115839 15:26842611-26842633 GGGGCTGCTGAGCACCTAGCTGG + Intronic
1124115926 15:26842875-26842897 GGGGCTGCTGAGCACCTAGCTGG + Intronic
1124248939 15:28095106-28095128 GGGGCTGCCTGGACCTGGGCAGG - Intronic
1125725205 15:41864746-41864768 GGTGCTGCTTGGACACTGGATGG + Intronic
1131076240 15:89496602-89496624 GGGGCTTTTGAGACCCGGGCAGG + Exonic
1202953525 15_KI270727v1_random:59677-59699 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1132676464 16:1123243-1123265 GGGGCTGCTCAGAACTTGGGGGG - Intergenic
1133033053 16:3020812-3020834 GGGGCTAGTTAGACCCTGTACGG - Intronic
1133287522 16:4697532-4697554 GAGGTTGCTTAGACACTGTCAGG - Intronic
1137253639 16:46757987-46758009 GGGGCTGCTTGTACCCTGGCCGG + Intronic
1137613670 16:49835012-49835034 GGGGCTGCTGAGGCCTTGGGGGG + Intronic
1137916673 16:52439284-52439306 GGTGCTGCTGAGAGGCTGGCTGG + Exonic
1141170328 16:81686903-81686925 GGGGGTGCTCAGACCCGGGCTGG - Intronic
1141505024 16:84471345-84471367 GGTGCTGCTGAGCCCCAGGCTGG - Intergenic
1141686394 16:85572642-85572664 TGGGCTGCTTAGAACCCAGCAGG + Intergenic
1142265269 16:89061553-89061575 GGGGCAGCTGAGACCAGGGCGGG - Intergenic
1142304538 16:89278169-89278191 GGGGCTGGATGGACCCTGGGGGG + Intronic
1142716501 17:1749845-1749867 GGGGCTGCAGAGACCCTGAGTGG - Intronic
1142866903 17:2796685-2796707 GGGTCTGCTGACGCCCTGGCAGG + Intronic
1143543454 17:7582875-7582897 GGGGCTGCTGGGGCCCTGCCAGG - Intergenic
1146160074 17:30554966-30554988 CAGGCTCCCTAGACCCTGGCGGG + Intergenic
1146892068 17:36512657-36512679 GGGGCTGCTCAGACACTGCCAGG - Intronic
1147896045 17:43752052-43752074 TGAGCTGCTTAGAACCTGGTGGG - Intergenic
1148464632 17:47857589-47857611 GGGTGTGTTTAGACCCTGCCTGG + Intergenic
1149856060 17:60083886-60083908 TGGACTGCTTAGGGCCTGGCTGG - Intergenic
1151759699 17:76093582-76093604 GGGGCTGCTCCCACCCAGGCTGG - Intronic
1151888582 17:76938658-76938680 GGGGGTGCCTAGAAGCTGGCTGG - Intronic
1151977145 17:77489407-77489429 GAGGCTGCATGTACCCTGGCAGG + Intronic
1152011866 17:77723858-77723880 GTGGCTGCGATGACCCTGGCTGG - Intergenic
1152538702 17:80964144-80964166 GGGGTTCCTGAGACCCCGGCAGG + Intronic
1152906750 17:82974634-82974656 TGTGCTGATTAGACCCTGGGTGG - Intronic
1154446325 18:14438603-14438625 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1155145397 18:23079030-23079052 GGGGCTGCAGAGAGCCAGGCTGG + Intergenic
1159022336 18:63154107-63154129 GGGGCTGATTAGACCCTTAGAGG - Intronic
1159037659 18:63293132-63293154 GGGGCCACTGAGAACCTGGCTGG - Intronic
1159439849 18:68464201-68464223 GGTGCTGTTGAGACCCTAGCAGG + Intergenic
1160127107 18:76185749-76185771 GGGGCTGTTTGGCTCCTGGCTGG - Intergenic
1160515768 18:79478459-79478481 GGGGCTGCATAGACCCGGCTGGG + Intronic
1160810893 19:1012482-1012504 GGGGATGCTCAGGCGCTGGCGGG + Exonic
1160834074 19:1116449-1116471 GGGGCTGCTGTGACCCTCCCGGG + Intronic
1161504374 19:4636101-4636123 GGGGATGATGAGACCCTGGTTGG - Intergenic
1161793565 19:6374405-6374427 GGGCCTGCCTACCCCCTGGCTGG - Intronic
1162800020 19:13105109-13105131 GGGGCTGCTGAGCTCCGGGCAGG - Intronic
1163085890 19:14979618-14979640 GGTGCTGCACAGTCCCTGGCGGG - Intronic
1163193587 19:15697515-15697537 GGTGCAGCTTATACCCTGGCAGG + Intergenic
1163220159 19:15913283-15913305 GGTGCAGCTTCCACCCTGGCAGG - Exonic
1163692924 19:18746871-18746893 GGGGCTGCTTGTAGCCAGGCAGG + Intronic
1163787133 19:19280507-19280529 GGTGGTGCGTAGAGCCTGGCTGG - Intronic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1165838791 19:38774611-38774633 GGGGCTGTTTCGGGCCTGGCGGG - Intergenic
1165862191 19:38915155-38915177 GTGGCTGCAAAGACCATGGCTGG - Intergenic
1167752019 19:51387237-51387259 GGCGCGGCCTGGACCCTGGCCGG + Exonic
925478775 2:4247572-4247594 GGGGCAGCTCAGACCTGGGCCGG + Intergenic
934078493 2:88448279-88448301 GGGGCTGCTTTGCCCCCCGCTGG + Exonic
934502201 2:94870232-94870254 GGGGCTGGAGAGACCCTGGGCGG + Intergenic
934663059 2:96153455-96153477 GGGGCCGCTGGGACCATGGCAGG - Intergenic
936267198 2:111019745-111019767 GAGGCTGCAGAGATCCTGGCAGG + Intronic
938602475 2:132856152-132856174 AGGACTGCTGAGGCCCTGGCTGG + Intronic
945489672 2:210440620-210440642 GGGGCTGCTCATGGCCTGGCTGG - Exonic
946163032 2:217847636-217847658 GGGGTTGCTGAGGCCCTGGAGGG + Exonic
947582573 2:231330678-231330700 GGGGCTCCTGAGGCCCTTGCTGG + Intronic
948830208 2:240594926-240594948 GCTGCTGCTTAGACCCTGCCAGG + Intronic
948855162 2:240726980-240727002 GGGGCTGCTTTCAGCCAGGCCGG + Intronic
1169345351 20:4824038-4824060 GGGCCTGTTTAGCCCCTGTCCGG - Intergenic
1172034240 20:32000413-32000435 TGGGCTGCAAGGACCCTGGCAGG - Exonic
1172114173 20:32563835-32563857 GGGGCTGCTGCCACCTTGGCCGG - Intronic
1172181739 20:33007902-33007924 GGGTCTGCTGAGACCCAGGATGG - Intronic
1172186661 20:33035182-33035204 GGGACTGCTTAGGCCAGGGCTGG + Intronic
1175199315 20:57266813-57266835 CGGGGTGCCTAGAGCCTGGCGGG + Intergenic
1175673977 20:60931415-60931437 GGGGCTGGTGAGACAGTGGCTGG + Intergenic
1176084366 20:63289368-63289390 AGGGCTGCTTGGACCCTGGTGGG + Intronic
1176512579 21:7759786-7759808 GGGCCTCCTTGCACCCTGGCAGG + Intronic
1178646692 21:34390310-34390332 GGGCCTCCTTGCACCCTGGCAGG + Intronic
1180140281 21:45889338-45889360 GGGCCTGCTTAGAAGCTGTCAGG + Intronic
1180733685 22:18000801-18000823 TGGGCTCCTGCGACCCTGGCAGG - Intronic
1183268594 22:36846733-36846755 GGGGCTCCGTAAACCTTGGCTGG + Intergenic
1183697995 22:39434004-39434026 GGGGCTGCTGCGTGCCTGGCTGG - Intronic
1184570098 22:45317635-45317657 GTGGCTGTTTAAACCCTGGCGGG - Intronic
1184751633 22:46489593-46489615 GGGGCAGCTCAGACTCTGCCAGG + Intronic
1185112004 22:48905392-48905414 GGGGCTGCTTAGACAGGGCCTGG - Intergenic
950740273 3:15045348-15045370 TAGGCTGCTTAGACTCAGGCTGG + Exonic
954154543 3:48678192-48678214 GAGGCTGCTTCCTCCCTGGCTGG + Intronic
954371494 3:50171572-50171594 GGGGTTATTTATACCCTGGCTGG - Intronic
957076973 3:75609885-75609907 GGGGCTCCTTAGAGCCAGGGAGG + Intergenic
960141334 3:114154442-114154464 GGGGCTCATTAAACCCAGGCGGG - Intronic
961383572 3:126511067-126511089 GGCGCTGCTTACCCCCAGGCAGG + Intronic
961665376 3:128490747-128490769 GGGGCTGCGTTGACCCTCCCCGG - Intronic
962880871 3:139575257-139575279 GAGTCTTCTTAGAGCCTGGCTGG + Intronic
964730524 3:159860070-159860092 GGGGTTGCTGAGACACTGGTTGG - Intronic
968228729 3:196991954-196991976 GTGGCTTCTTACCCCCTGGCAGG + Intronic
968618478 4:1592929-1592951 GGGGCCGCTCACACCCTGCCCGG + Intergenic
969354287 4:6616196-6616218 GGTGCTTCCTAAACCCTGGCTGG - Intronic
969683630 4:8656890-8656912 GGTGCTGCCTCGACCGTGGCAGG - Intergenic
970721527 4:18995042-18995064 GGGTCTGCTTAAGCCATGGCTGG - Intergenic
970974561 4:22028532-22028554 GAGGATGATTAGAGCCTGGCTGG - Intergenic
971871426 4:32245275-32245297 GTTGCTGCTTAGACTCTGTCAGG + Intergenic
978090205 4:104706671-104706693 GGGACTGGTTAGACAGTGGCTGG + Intergenic
980984479 4:139682471-139682493 GGGGCTGCAGGGAGCCTGGCAGG + Intronic
985695672 5:1338804-1338826 GAGGGTGCTGGGACCCTGGCTGG - Intronic
991070736 5:62477408-62477430 GGGGTTGCTTATTCCCTGGGAGG + Intronic
999125640 5:149243961-149243983 GGGGCTGCATAGCCCAGGGCTGG + Intronic
999382056 5:151128154-151128176 GTGGCTTCTTGGCCCCTGGCTGG - Intronic
1001574259 5:172751646-172751668 GGGTCTTGTCAGACCCTGGCAGG - Intergenic
1002153007 5:177251345-177251367 AGGGCTGTTTAGACCTTGGTGGG + Intronic
1002427800 5:179186190-179186212 GGGGCTGCTGAGACCTGGCCTGG - Intronic
1003167804 6:3696684-3696706 GGTGCTGCCTAAACACTGGCTGG - Intergenic
1005968323 6:30742698-30742720 GGGGGTGCTTAGTCCGTTGCGGG - Exonic
1006460041 6:34152895-34152917 GGGCCTGCAGAGACCCAGGCTGG + Intronic
1006519800 6:34564708-34564730 GGGGCTGCTGAGACTCTGAGGGG - Intergenic
1007975842 6:46100425-46100447 GGGGCTGCTTGCACCTTGGTGGG + Intergenic
1008608035 6:53159227-53159249 GGGGCTCCCCAGACCCTTGCAGG - Intergenic
1015949536 6:138537880-138537902 GGGGCTGCAGAGATCCAGGCCGG + Intronic
1018381271 6:163260199-163260221 GGGGCTGCTGAGGTGCTGGCTGG - Intronic
1020181825 7:5928561-5928583 GGGGCTCAGCAGACCCTGGCTGG + Intronic
1020301110 7:6796379-6796401 GGGGCTCAGCAGACCCTGGCTGG - Intronic
1023819172 7:43970847-43970869 GGGGCTTCTTGGCCCCTGCCAGG - Intergenic
1025252814 7:57363261-57363283 GGGGCTGCTGGGGGCCTGGCTGG + Intergenic
1029156322 7:98520534-98520556 GGGGATGCACAGGCCCTGGCTGG + Intergenic
1029477607 7:100794272-100794294 GGGGCAGCTTGGAACCGGGCAGG - Intronic
1029744223 7:102507810-102507832 GGGGCTTCTTGGCCCCTGCCAGG - Intronic
1029762214 7:102606972-102606994 GGGGCTTCTTGGCCCCTGCCAGG - Intronic
1029852677 7:103481117-103481139 GGGGTTGCTTTTACACTGGCTGG + Intronic
1033496968 7:141908921-141908943 GGGGCTGCTTAGGCTCTGTAGGG + Intronic
1034327279 7:150248089-150248111 GGCCCTGCTGAAACCCTGGCAGG - Intronic
1034438535 7:151075218-151075240 GGTGCTGCTGAGGCCCAGGCTGG - Intronic
1034765930 7:153721368-153721390 GGCCCTGCTGAAACCCTGGCAGG + Intergenic
1035171973 7:157021893-157021915 GGGGCTCCCAAGACCCCGGCGGG - Intergenic
1036201764 8:6776198-6776220 CTGGGTGCTCAGACCCTGGCAGG + Intergenic
1037890210 8:22620092-22620114 GGGGCTGCTTAGCCCCAGCCAGG - Exonic
1038230542 8:25695234-25695256 GGAGGTGCTGAGATCCTGGCAGG + Intergenic
1040021843 8:42747827-42747849 GGGGTTTCCTTGACCCTGGCTGG + Intergenic
1045326843 8:101123435-101123457 GGCGCTGCTTAGCCCCAGGCTGG + Intergenic
1046668248 8:117029144-117029166 TGGGCTACTTTGACCCTGCCAGG + Intronic
1048163654 8:132042792-132042814 GGGATTGCTTAGACACTGGCTGG + Intronic
1049210815 8:141385706-141385728 GGGACCTCTTAGACCCTGGAGGG - Intergenic
1049800763 8:144516549-144516571 TGGGCTCCCTAGATCCTGGCTGG - Exonic
1053475840 9:38381654-38381676 GGGGCTGCTTACAAACTGGTAGG - Intergenic
1060231784 9:121830802-121830824 GGGGCTCTGTAGACCATGGCAGG + Intronic
1060557734 9:124517713-124517735 GGGGGTGACTAGTCCCTGGCTGG + Exonic
1060774711 9:126364515-126364537 GGGGCTGCTGAAATGCTGGCTGG + Intronic
1061578409 9:131522230-131522252 GGGGCTGCGGAGACAGTGGCTGG + Intronic
1061791898 9:133063460-133063482 AGGGCTGCTGGGACCCTGGCTGG + Intronic
1062598484 9:137309713-137309735 GGGGGTGCTGAGGCCCAGGCGGG + Intronic
1188584741 X:31759773-31759795 ATGGCTGCTTGGACCCTGGTAGG + Intronic
1189293924 X:39905433-39905455 GGTGCTGCTGACACCCGGGCCGG + Intergenic
1189421433 X:40861521-40861543 GGGGCTGCTTGAGCCATGGCTGG + Intergenic
1190474137 X:50811389-50811411 GGGGATGCCTAGACCCAGGTAGG + Intronic
1198636818 X:138710911-138710933 GGGGCTGCTGACACACTTGCAGG + Exonic
1199294186 X:146138678-146138700 GGGGCTGCATAAACCCAGGAGGG - Intergenic
1200122384 X:153797326-153797348 GGGGCTGCAGTGTCCCTGGCAGG - Intronic
1201144346 Y:11055185-11055207 GAAGCTGCTGTGACCCTGGCAGG - Intergenic