ID: 902185668

View in Genome Browser
Species Human (GRCh38)
Location 1:14723408-14723430
Sequence GTCCCACTCATTGCTGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902185668_902185675 6 Left 902185668 1:14723408-14723430 CCCGGGGCAGCAATGAGTGGGAC 0: 1
1: 0
2: 0
3: 20
4: 215
Right 902185675 1:14723437-14723459 TGGCCTGAGCTTGCTCATCACGG 0: 1
1: 0
2: 0
3: 12
4: 163
902185668_902185677 13 Left 902185668 1:14723408-14723430 CCCGGGGCAGCAATGAGTGGGAC 0: 1
1: 0
2: 0
3: 20
4: 215
Right 902185677 1:14723444-14723466 AGCTTGCTCATCACGGCCTGTGG 0: 1
1: 0
2: 2
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902185668 Original CRISPR GTCCCACTCATTGCTGCCCC GGG (reversed) Intronic
900794305 1:4698838-4698860 GCCCCTCTCAGTGGTGCCCCTGG + Intronic
902185668 1:14723408-14723430 GTCCCACTCATTGCTGCCCCGGG - Intronic
902249123 1:15141769-15141791 GTCCAGCCGATTGCTGCCCCAGG + Intergenic
903327586 1:22579872-22579894 GTCCCTCTCACTGTGGCCCCAGG - Intronic
903742975 1:25568988-25569010 CCCCCACTCAGTGCTGCCCCTGG - Intergenic
904365734 1:30010010-30010032 GGCCCACCCATGGCTGCCCATGG - Intergenic
904813875 1:33181437-33181459 GCCCCCCTCTCTGCTGCCCCTGG - Exonic
905253944 1:36668005-36668027 CTCCCGCTCCTTTCTGCCCCAGG + Intergenic
906314534 1:44777744-44777766 GTCCCACTATGCGCTGCCCCTGG + Exonic
907469820 1:54666027-54666049 GCCAAACTCATTCCTGCCCCAGG + Intronic
912447707 1:109750545-109750567 GCCACACTCAGTTCTGCCCCAGG + Intronic
915097914 1:153476754-153476776 GTTCCACTCACTGCTGCCCTGGG - Intergenic
915185098 1:154098695-154098717 GACCCACCCATGGCTGCCCATGG - Intronic
915929036 1:160047067-160047089 CTCCCACTTACTGCTACCCCCGG + Intronic
917755632 1:178094564-178094586 GTCCGACTCGCCGCTGCCCCCGG + Exonic
918937431 1:190941057-190941079 TTCCCACTCCTTACTGCCACTGG - Intergenic
919612209 1:199759404-199759426 CCCCCTCTCATTGCTGCCCTGGG - Intergenic
920893381 1:210017298-210017320 GTCCCACTAAGTATTGCCCCTGG + Intronic
921796034 1:219345970-219345992 GTTCCAAACATTGCTGACCCTGG - Intergenic
922807656 1:228398950-228398972 GTTCAAGTCAATGCTGCCCCTGG - Intronic
1066291093 10:34015152-34015174 GTTCCCCTCTTTGCAGCCCCGGG + Intergenic
1066687501 10:37994595-37994617 GCCCCATTCATTGCTGCACAGGG - Intergenic
1067258691 10:44667158-44667180 GGCCCACCCATGGCTGCCCATGG - Intergenic
1067367032 10:45641934-45641956 CTACTACTCATTGCTTCCCCAGG + Intronic
1068287661 10:54961532-54961554 GGCCCACCCATGGCTGCCCATGG + Intronic
1068748778 10:60566846-60566868 GTCTCACTCTTTGTTGCCCAAGG - Intronic
1069421801 10:68253194-68253216 TTCTTACTCATTGCTGTCCCGGG - Intergenic
1070232620 10:74585824-74585846 GTCCCCATCTGTGCTGCCCCAGG - Intronic
1070307199 10:75246643-75246665 CTCCCTGGCATTGCTGCCCCAGG + Intergenic
1071166785 10:82816531-82816553 GGCCCACCCATGGCTGCCCATGG - Intronic
1073630100 10:105139739-105139761 GTTCCTTTCATTACTGCCCCTGG - Intronic
1074438517 10:113454821-113454843 CACCCACTCACTGCTACCCCAGG + Intergenic
1075021545 10:118956227-118956249 CTCCCACTCCTTTCTTCCCCAGG + Intergenic
1075117453 10:119638797-119638819 GTCCCACTATGCGCTGCCCCTGG + Intergenic
1076839629 10:133039642-133039664 GTCCGCCTCCGTGCTGCCCCCGG + Intergenic
1080703421 11:34665707-34665729 GTCAAACTCATTTCTGCCTCAGG + Intergenic
1081010985 11:37812261-37812283 GGCCCACTCAAGGCTGCCCATGG - Intergenic
1083830056 11:65225816-65225838 GACCCGCTCAAAGCTGCCCCGGG + Intergenic
1084432247 11:69117591-69117613 GTCACAGGCATGGCTGCCCCGGG + Intergenic
1085476725 11:76793849-76793871 GTCCCACTTTTCCCTGCCCCTGG + Intronic
1087422301 11:97945138-97945160 GTCACACTCATTTGTGCCTCAGG - Intergenic
1088626795 11:111735503-111735525 CTCCCACACCTTGCTGCCGCGGG - Intronic
1089713907 11:120337232-120337254 GTGCCACTCATTGGGGCCCTTGG - Exonic
1091000344 11:131905760-131905782 CTCCCATTCATTGCTTTCCCTGG + Intronic
1092502983 12:9065755-9065777 GGCCCACTCATGGCTGCCCATGG + Intergenic
1093490598 12:19700426-19700448 GTTCAACTCATTCCTTCCCCAGG - Intronic
1095983354 12:47984878-47984900 GCCCCACTCATCACTGTCCCTGG + Intronic
1096501116 12:52064291-52064313 GTCCCACTCATTGTTGTTGCTGG + Intergenic
1097158997 12:57032472-57032494 CTGCCACTCATTCCTGCCTCAGG - Intronic
1097919064 12:65052367-65052389 CTCCAACTCATTGCTGGCTCAGG - Intronic
1104956074 12:132466467-132466489 GTCCCAGTCACAGCTGTCCCCGG - Intergenic
1106197321 13:27504924-27504946 GGCGCTCTCATTGTTGCCCCTGG + Intergenic
1107634694 13:42380554-42380576 GTCCCACTCACTGCCAGCCCTGG + Intergenic
1109470651 13:62799561-62799583 GGCCCACCCATGGCTGCCCATGG + Intergenic
1109542600 13:63799801-63799823 GTCCCACTCTGTCCTGCCCAGGG + Intergenic
1110233424 13:73191147-73191169 GGCCATCTCATTGCTGTCCCTGG + Intergenic
1110380411 13:74843996-74844018 TTCCCACAATTTGCTGCCCCTGG + Intergenic
1113339152 13:109404818-109404840 GCCCCACCCATGGCTGCCCATGG + Intergenic
1113561825 13:111287370-111287392 GCCCAGCTCAGTGCTGCCCCTGG - Intronic
1116174350 14:41448189-41448211 TTCCCACTCATTCCCACCCCAGG + Intergenic
1117514587 14:56488180-56488202 GTCCCACTCTTTGTATCCCCAGG + Intergenic
1118461415 14:65990571-65990593 GACCCAATCATGGCAGCCCCAGG + Intronic
1119055127 14:71411631-71411653 CTCCCACTCATTGCAACCTCTGG - Intronic
1121536607 14:94695377-94695399 TTCCCAGGCATTGCTGCCCAAGG + Intergenic
1121603998 14:95227127-95227149 GTTCCACTGTTTCCTGCCCCTGG - Intronic
1121695345 14:95907981-95908003 GGCCCACCCATGGCTGCCCATGG - Intergenic
1122132006 14:99609662-99609684 AGCCCTCTCACTGCTGCCCCTGG - Intergenic
1122373265 14:101241216-101241238 GTCCCACTCAGAGATGCCTCTGG + Intergenic
1122775258 14:104114119-104114141 ACCCCACTCAGTGCTGCTCCGGG + Exonic
1124341606 15:28893491-28893513 GACCCACTCAGTCCTGCCTCAGG - Intronic
1124965567 15:34430478-34430500 GACCCACTCAGTCCTGCCTCAGG + Intronic
1125718118 15:41831089-41831111 GGCCCACCCATGGCTGCCCATGG + Intronic
1126170355 15:45690470-45690492 TTCCTACCCCTTGCTGCCCCAGG + Intronic
1126814595 15:52442273-52442295 GTCCCCCTCCTTGCTGCTCCAGG - Intronic
1128523547 15:68391269-68391291 GTCCCACCCATTGCAGCCACTGG - Intronic
1128593097 15:68920079-68920101 TTCCCTCTCATTGCATCCCCTGG - Intronic
1128767357 15:70259284-70259306 GTCCCGCCCACAGCTGCCCCTGG - Intergenic
1130401452 15:83558652-83558674 GTCCTATCCATTCCTGCCCCTGG + Intronic
1137899874 16:52255833-52255855 GCCCAAATCATTTCTGCCCCTGG - Intergenic
1139138536 16:64233704-64233726 GGCCCACCCATGGCTGCCCGTGG + Intergenic
1140103506 16:71938587-71938609 GGCCCACCCATGGCTGCCCATGG + Intronic
1140401469 16:74675268-74675290 TTCCCCATCAGTGCTGCCCCTGG - Intronic
1151598380 17:75091491-75091513 GTCCCATTCATCGCAGCCTCAGG - Intronic
1152272061 17:79330593-79330615 GTCCCACTCCTGTCTCCCCCAGG + Intronic
1157933149 18:51845265-51845287 GTCCCACTATGCGCTGCCCCTGG - Intergenic
1158198074 18:54910466-54910488 GGCCCATTCATGGCTGCCCATGG - Intronic
1158773848 18:60553290-60553312 GACCCACTTATGGCTGCCCATGG + Intergenic
1159094124 18:63882989-63883011 CTCACACTCATAGCTGGCCCAGG + Intronic
1160571199 18:79818742-79818764 CTCCCAGTCATTTCTGCCTCAGG - Intergenic
1161161237 19:2762809-2762831 GTCTCCCTCAGTCCTGCCCCTGG - Intronic
1161934956 19:7365842-7365864 GTCCCCGTCATGGCTCCCCCAGG + Intronic
1162231616 19:9271158-9271180 GGCCCACCCATGGCTGCCCGTGG + Intergenic
1163211763 19:15845990-15846012 TCCCCACTCCTTGCTGCCCAAGG - Intergenic
1163608165 19:18287117-18287139 GTCCAACTGGTTCCTGCCCCGGG - Intergenic
1163898487 19:20080177-20080199 GTCCCATTATGTGCTGCCCCTGG - Intronic
1166746700 19:45145209-45145231 GAACCACTCACTGCTGCGCCTGG + Exonic
1166750874 19:45163479-45163501 GGCCCACTCATGGGGGCCCCCGG - Intronic
1167190847 19:47988492-47988514 GTCCCACTCAACTCTGCTCCTGG - Intronic
1168076125 19:53981808-53981830 GGCCCACTCTTAGCTGGCCCAGG - Intronic
925919866 2:8631335-8631357 GTACCTCTCATTGCAGACCCCGG + Intergenic
926140824 2:10366877-10366899 GACACACTCAGAGCTGCCCCCGG - Intronic
927135386 2:20092982-20093004 GGCCCACACATGCCTGCCCCAGG + Intergenic
927520764 2:23696669-23696691 ATCCCACACCCTGCTGCCCCCGG - Intronic
927958649 2:27225689-27225711 CTTCCACTCATTGCAGGCCCAGG + Exonic
928202634 2:29259311-29259333 GTACTACACATAGCTGCCCCGGG + Intronic
928723618 2:34147594-34147616 GCCCCACCCATGGCTGCCCATGG - Intergenic
930946643 2:57084229-57084251 GGCCCACCCATGGCTGCCCATGG - Intergenic
931300492 2:60973799-60973821 GGCCCACCCATGGCTGCCCATGG + Intronic
931366846 2:61626701-61626723 GTCCAGCTCTTTGCTGCCCCAGG + Intergenic
934153258 2:89170677-89170699 GTATGACTCATGGCTGCCCCAGG - Intergenic
934213978 2:90011254-90011276 GTATGACTCATGGCTGCCCCAGG + Intergenic
937871002 2:126786181-126786203 GTCTCACTCACTGCTAACCCTGG + Intergenic
940184115 2:150963442-150963464 GTACCTCTCACTCCTGCCCCTGG + Intergenic
942996159 2:182263155-182263177 TTCCCACTCACTGCTGCTTCTGG + Intronic
943023472 2:182601898-182601920 GGCCCACCCATGGCTGCCCATGG - Intergenic
943064116 2:183069274-183069296 GTCCCACCCATGGCTGCCCATGG + Intergenic
947833938 2:233161921-233161943 GTCCCCTTCCTTCCTGCCCCAGG + Intronic
948067682 2:235093368-235093390 ATCCCCATCAGTGCTGCCCCAGG - Intergenic
948692101 2:239712466-239712488 GACCCACTCATGGTTGCCTCTGG - Intergenic
948712474 2:239833651-239833673 GCCCCACCCATGGCTGTCCCTGG + Intergenic
1168806578 20:675458-675480 GTCCCACTCACCGTTGTCCCCGG + Exonic
1169309361 20:4521877-4521899 GGCCCACCCATGGCTGCCCATGG + Intergenic
1171079291 20:22161853-22161875 GTCCCAAGGATTGCTGCCTCAGG + Intergenic
1172557757 20:35857204-35857226 GCCCCACCCATTTTTGCCCCAGG - Intronic
1172820939 20:37733566-37733588 TTTCCACTCATTCCTGCCTCTGG + Intronic
1172827805 20:37805276-37805298 GCCCAGCTCATTCCTGCCCCCGG + Intronic
1174480284 20:50826370-50826392 GTCCCAGCCTTTGCTGCCCGGGG + Intronic
1178508313 21:33180833-33180855 GTCCCGCTCAATCCTACCCCAGG - Intergenic
1179239358 21:39575308-39575330 GTTCCACTCATGGCTACACCTGG - Intronic
1184393899 22:44221390-44221412 TTGGCACTCATGGCTGCCCCTGG + Intergenic
1184721756 22:46318701-46318723 GTCCCACGCCTTCCTGCCCCAGG - Intronic
1185069747 22:48649454-48649476 GGCCCACTCCTCCCTGCCCCAGG - Intronic
949857428 3:8474720-8474742 TTCCCTCTCCCTGCTGCCCCTGG - Intergenic
950422554 3:12907412-12907434 GTCCCACGCAGGTCTGCCCCAGG - Intronic
951264703 3:20552415-20552437 GGCCCACCCATGGCTGCCCATGG - Intergenic
951562454 3:23982159-23982181 GGCCCACCCATGGCTGCCCGTGG - Intergenic
953766570 3:45747514-45747536 GTCCCACCTATGGCTGCCCACGG + Intergenic
954130195 3:48556778-48556800 GTCCGACTCATCCCGGCCCCGGG - Exonic
954650886 3:52162193-52162215 GGCCCACCCATGGCTGCCCATGG - Intergenic
954936742 3:54333619-54333641 CTCCCCCTGAGTGCTGCCCCGGG - Intronic
957646683 3:82939445-82939467 GTCCCGCCCATTGCTGCCCGTGG + Intergenic
958498397 3:94874772-94874794 GGCCCACCCATGGCTGCCCATGG - Intergenic
958675576 3:97265158-97265180 GGCCCACTCATGGCTGCCCATGG - Intronic
961215101 3:125153565-125153587 GTCGCACTAAGTTCTGCCCCTGG + Intronic
962916724 3:139911286-139911308 GTCCCACTTATGGCTGCCTGTGG - Intergenic
963461467 3:145619197-145619219 GTCCCAGTGATGGCTGCCCTAGG - Intergenic
965229228 3:166029328-166029350 GGCCCACCCATGGCTGCCCATGG - Intergenic
965542064 3:169880347-169880369 GACCCACCCATGGCTGCCCATGG + Intergenic
965793082 3:172410863-172410885 GGCCCACTCATGGCTGCCCATGG - Intergenic
966654662 3:182342218-182342240 TGCTCACTCATTGCTGCCTCTGG + Intergenic
968501783 4:953494-953516 GTGCCACTCACTGCAGCCCTGGG - Intronic
968516261 4:1016907-1016929 TTCCCACTCACTCCTGCCCTGGG + Intronic
968569356 4:1331395-1331417 CCCCCACTCCCTGCTGCCCCGGG + Intronic
968980762 4:3848295-3848317 GGCCCACCCATGGCTGCCCATGG - Intergenic
969628417 4:8320623-8320645 ATCCCCTTCCTTGCTGCCCCTGG + Intergenic
971092433 4:23360961-23360983 GGCCCACCCATGGCTGCCCATGG + Intergenic
971869381 4:32216123-32216145 GGCCCACCCATGGCTGCCCATGG - Intergenic
972788187 4:42346544-42346566 GGCCCACACATGGCTGCCCATGG + Intergenic
975040853 4:69743423-69743445 GGCCCACCCATGGCTGCCCATGG - Intronic
976679936 4:87745565-87745587 GGCCCACCCATTGCTTCCCATGG - Intergenic
977816231 4:101416798-101416820 GGCCCACCCATAGCTGCCCATGG - Intronic
978301047 4:107270081-107270103 GCCCCACCCATGGCTGCCCATGG - Intronic
979131026 4:117044746-117044768 TTCTCACACATTGCTGCACCAGG + Intergenic
980180242 4:129392818-129392840 GGCCCACTCATGGCGGCCCATGG + Intergenic
981727350 4:147861857-147861879 GGCCCACTCATGGCTGCGCATGG - Intronic
981749795 4:148082484-148082506 GTCCCCCTCATGGCTTCCCTTGG - Intronic
983069699 4:163254017-163254039 GGCCCACCCATGGCTGCCCATGG - Intergenic
984714336 4:182912841-182912863 GGCCCACTCAGTGCTCACCCAGG + Intronic
984744593 4:183202069-183202091 GCCTCACTCATTCCTTCCCCAGG - Intronic
987471022 5:18327677-18327699 TTCCTTCCCATTGCTGCCCCTGG - Intergenic
988651979 5:33162522-33162544 GTCCCACTACGTGCTGCCCCTGG + Intergenic
989730457 5:44641774-44641796 GGCCCACCCATGGCTGCCCATGG - Intergenic
989821691 5:45800618-45800640 GGCCCACTCATGGCTGCCTATGG + Intergenic
993187054 5:84635132-84635154 GGCCCACTCATGGCAGCCCATGG - Intergenic
994406552 5:99352594-99352616 GGCCCACTCATGGCTGCCCTTGG - Intergenic
994517978 5:100794337-100794359 GGCCCACACATGGCTGCCCATGG + Intergenic
995927022 5:117386505-117386527 GGCCCACCCATGGCTGCCCATGG + Intergenic
997628457 5:135347763-135347785 ATTCCACACACTGCTGCCCCTGG + Intronic
1001825762 5:174743563-174743585 ATCCCCCTCACTGCTGACCCGGG + Intergenic
1004290181 6:14359666-14359688 TTCTCACACTTTGCTGCCCCTGG + Intergenic
1005372724 6:25152712-25152734 GTCGCAGTCATTGCTGACCTGGG + Intergenic
1006143710 6:31945924-31945946 GTCCCACCCTTTGCTGCCAAAGG - Exonic
1006291948 6:33144847-33144869 GTCCCACTCCTTGCTGCTGAGGG - Intergenic
1006440382 6:34050128-34050150 GGCCTCCTCATTGCTCCCCCAGG + Intronic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1008076165 6:47148367-47148389 CTCCCCCTCACTGCTGCCTCAGG - Intergenic
1008231607 6:48990217-48990239 GGCCCACTCATGGCTGCGCATGG + Intergenic
1011610644 6:89146714-89146736 GTCCCACACACACCTGCCCCGGG - Intronic
1014992904 6:128103759-128103781 GTTTCACTGATTGCAGCCCCAGG - Intronic
1018651093 6:165991659-165991681 ATCCCACTCACTCCTGCCTCTGG - Intergenic
1018851990 6:167647317-167647339 CTCCCAGTCATTGCTAGCCCAGG + Intergenic
1020455739 7:8372067-8372089 TTCCCATTCATCCCTGCCCCTGG + Intergenic
1021677680 7:23097502-23097524 GGCCCACCCATGGCTGCCCATGG + Intergenic
1022547151 7:31200219-31200241 CTCCAACTCCTTGCTTCCCCTGG + Intergenic
1023367168 7:39475476-39475498 CTCCCAGTCATGGCTGCCCAGGG - Intronic
1026393579 7:69928225-69928247 GGCCCACCCATGGCTGCCCATGG - Intronic
1027222567 7:76223402-76223424 GTCCCTGTCATGGCTGCACCTGG + Intronic
1027687385 7:81294802-81294824 GGCCCACCCATGGCTGCGCCTGG - Intergenic
1031837026 7:126690949-126690971 GGCCCACCCATGGCTGCCCATGG - Intronic
1033586601 7:142779108-142779130 CCCCCACTCATTGCTGACCCTGG - Intergenic
1034481218 7:151321405-151321427 GGCCCACTCATGGCCGCCCATGG + Intergenic
1035162703 7:156962688-156962710 GTCCAAATCATTGCTGACCCAGG + Intronic
1035311612 7:157973159-157973181 CTCCCACCCACTGCTGCTCCAGG - Intronic
1038082077 8:24149967-24149989 CTCCAACTCTTTCCTGCCCCAGG + Intergenic
1038149335 8:24928310-24928332 GGCCCACTCGTGGCTGCCCATGG + Intergenic
1040890906 8:52314812-52314834 GTGCCAATCCCTGCTGCCCCAGG - Intronic
1041274417 8:56142554-56142576 GGCCCACCCATGGCTGCCCATGG + Intergenic
1044962351 8:97543038-97543060 GGCCCACCCATGGCTGCCCATGG + Intergenic
1048381792 8:133871834-133871856 GTCCCTCTCACTGCAGCCCATGG - Intergenic
1049309195 8:141924396-141924418 GGCCCTGTCATGGCTGCCCCAGG - Intergenic
1049611093 8:143555669-143555691 AGCCCACACACTGCTGCCCCTGG - Intronic
1051694568 9:19754226-19754248 GCCCCACTCATTGCCTCCCCAGG + Intronic
1052049617 9:23830343-23830365 ATCCCGCTCACTGCCGCCCCTGG - Intergenic
1052437154 9:28443953-28443975 GTCCCACCCATGGCTGTCCATGG + Intronic
1054809128 9:69421015-69421037 GTCCCACTCACACCTGGCCCAGG + Intergenic
1055890899 9:81122603-81122625 GTCCCACCCATGGCTGCTCATGG - Intergenic
1057542117 9:95985292-95985314 CTCCCACTCTGTGCTGCCCACGG - Intronic
1057938923 9:99263594-99263616 GTGCTTCTCATTGCTGCCTCTGG + Intergenic
1058006595 9:99922683-99922705 TGCCCACCCCTTGCTGCCCCTGG - Intronic
1058672069 9:107368052-107368074 GGCCCCCTCATTTCTGCTCCAGG + Intergenic
1061205128 9:129158565-129158587 GTCAAACTTGTTGCTGCCCCAGG + Intergenic
1061743231 9:132722465-132722487 GACCCACCCATGGCTGCCCATGG - Intergenic
1062197182 9:135280819-135280841 GTCCAGCTCCTTGCTGCCTCTGG - Intergenic
1062329132 9:136029162-136029184 GGCCCACTCATGGCTGCCCATGG + Intronic
1186583535 X:10847016-10847038 GTCCCACTCATAGCAGCCTCTGG - Intergenic
1188262792 X:28038682-28038704 TTCCCACTCATTAGTGTCCCTGG - Intergenic
1190369514 X:49727372-49727394 GGCCCACCCATGGCTGCCCATGG + Intergenic
1193638593 X:83984270-83984292 GTACCACTAATTGCTTTCCCAGG - Intergenic
1194380289 X:93181867-93181889 GGCCCACCCATGGCTGCCCATGG + Intergenic
1195800107 X:108699370-108699392 GTCACACTCATTGCTTCCAAAGG + Intergenic
1196371700 X:114986406-114986428 GTTGCACTCACTGCTGCCTCAGG + Intergenic
1196851499 X:119943209-119943231 GTCTCACTCACTTCTGCCGCAGG + Exonic
1196883656 X:120223354-120223376 GGCCCACCCATGGCTGCCCATGG - Intergenic
1199365122 X:146971711-146971733 GGCCCACTCAGGGCTGCCCCAGG + Intergenic
1199382248 X:147184060-147184082 GGCCCACTCAGGGCTGCCCCAGG - Intergenic
1200550880 Y:4577762-4577784 GGCCCACCCATGGCTGCCCATGG - Intergenic