ID: 902185856

View in Genome Browser
Species Human (GRCh38)
Location 1:14724846-14724868
Sequence TTGATGAACCAGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902185856_902185858 1 Left 902185856 1:14724846-14724868 CCTTCCTCACTCTGGTTCATCAA 0: 1
1: 0
2: 1
3: 25
4: 320
Right 902185858 1:14724870-14724892 TTTCACTTCCCCTGTCAAGTCGG 0: 1
1: 0
2: 0
3: 18
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902185856 Original CRISPR TTGATGAACCAGAGTGAGGA AGG (reversed) Intronic
900432460 1:2609329-2609351 TGCATGAACCAGAGTGAGTGGGG - Exonic
900920920 1:5669885-5669907 TTGATGAAGACGAGTGAAGACGG + Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902185899 1:14725240-14725262 TAGATGAAGGTGAGTGAGGAGGG - Intronic
902206408 1:14871319-14871341 TTGAGGAACAAGAGTCAAGAGGG + Intronic
903257605 1:22113457-22113479 GTGAGGAACCAAATTGAGGATGG + Intergenic
903466173 1:23554147-23554169 TTGACAAACCAGATTAAGGAGGG - Intergenic
904526887 1:31140504-31140526 TGGATGAACAAGACTGAAGAGGG + Intergenic
905217514 1:36419700-36419722 TTAAGAAACCAGAGTGAGGTTGG - Intronic
906362691 1:45177075-45177097 TTCAGGAACTAGAGAGAGGAGGG + Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
908221489 1:62011267-62011289 ATGATGAAACTTAGTGAGGAAGG - Intronic
910732705 1:90415503-90415525 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
912902496 1:113667720-113667742 TTGATTAAGCTTAGTGAGGAAGG - Intronic
915115318 1:153594915-153594937 CTGATGGACCAGAGAGAGGAAGG - Intergenic
917842991 1:178997494-178997516 ATGATTAAGCATAGTGAGGAAGG - Intergenic
918344921 1:183598750-183598772 TTGAAGACCCAGATAGAGGATGG + Intergenic
919211160 1:194488766-194488788 ATGATTAACCATTGTGAGGAAGG + Intergenic
919427417 1:197449935-197449957 TTGAAGAACCAGAGAAAAGAGGG - Intronic
920955546 1:210617383-210617405 TTGATGAAGTAGAGAGAGGAAGG + Intronic
922818312 1:228467048-228467070 TTGTTAAACCATGGTGAGGAAGG - Intergenic
924258918 1:242210125-242210147 ATGATGAACCTCAGTGAGAAAGG + Intronic
1063614843 10:7592736-7592758 AGGATGAACCAGGGTGAGAAGGG - Intronic
1063913402 10:10855070-10855092 TTCAGGAACCAGAGAGAGGCTGG - Intergenic
1064002031 10:11671767-11671789 ATGATGAAGCGTAGTGAGGAAGG - Intergenic
1064065840 10:12180861-12180883 TTGGTGAACTAGAGGGAGGAAGG - Intronic
1066379896 10:34892328-34892350 TCGAGGAAACAGAATGAGGAGGG + Intergenic
1067283222 10:44888707-44888729 TTGTGGAACCAGAGTGCAGATGG - Intergenic
1069736401 10:70657853-70657875 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070629340 10:78073646-78073668 TTGAAGACCCTGAGAGAGGAAGG - Intergenic
1071587021 10:86833497-86833519 TAGATGAAGCAGAGGGAGGTGGG + Intronic
1071957977 10:90779752-90779774 TTGATGAACCACAAGGAGGCAGG + Intronic
1072329932 10:94337460-94337482 TTGTTGAACCTGAGTGATGGGGG + Intronic
1072535698 10:96360931-96360953 TTGATTGATCAGAGTGAGGCAGG + Intergenic
1073085135 10:100883402-100883424 TGGATGACCCAGAGTTTGGACGG - Intergenic
1075031529 10:119027869-119027891 TGCATGGTCCAGAGTGAGGAAGG + Intergenic
1075076123 10:119351617-119351639 TTTATCAAGCAGAGTGAGGATGG + Intronic
1077772309 11:5233446-5233468 TTGATTAATCAGTGTGATGATGG + Intronic
1078525149 11:12095046-12095068 TTGATGAAAGGGAGGGAGGAAGG + Intronic
1078646225 11:13143248-13143270 GTGATGAAGCAGAATGATGAAGG + Intergenic
1079979390 11:27132771-27132793 TTGATGAACCACAGTAATGGAGG + Intergenic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1082650845 11:55790701-55790723 TTAGTGCACTAGAGTGAGGAAGG - Intergenic
1082971657 11:59029187-59029209 ATGATTAAGCATAGTGAGGAAGG - Intronic
1084415366 11:69029264-69029286 TTTAGGAAACAGAGGGAGGAGGG - Intergenic
1084714198 11:70863358-70863380 TGGATGAACCAGGATGAGGTCGG - Intronic
1085535783 11:77216502-77216524 GTGATCAACCAGGGTGATGAAGG - Intergenic
1087334232 11:96823069-96823091 TTTATGAATCAGAGGGAGCAAGG + Intergenic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1090869853 11:130734491-130734513 TTGAAGAGACAGAGTGGGGAGGG + Intergenic
1091104602 11:132906845-132906867 TTTAGCAACCAGAGTGAGGCTGG + Intronic
1093602199 12:21041434-21041456 TTGATGAAAGAAATTGAGGAGGG - Intronic
1094205369 12:27834026-27834048 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1095657846 12:44691566-44691588 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1096431956 12:51552219-51552241 TTGATGAATCAGTGTGTTGAAGG + Intergenic
1100763704 12:97839071-97839093 TTGTTAAACCACAGTAAGGAAGG + Intergenic
1100912822 12:99384664-99384686 TTGATGGAACATGGTGAGGAAGG - Intronic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101649172 12:106659249-106659271 TTGGGGACCCACAGTGAGGAAGG + Intronic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1103007954 12:117436769-117436791 TGGATGAGGCAGCGTGAGGAAGG - Intronic
1103038190 12:117673282-117673304 TTGATGAAGGACAGAGAGGATGG + Intronic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103891436 12:124241866-124241888 TTGATGGACCAGAGTGGCAAAGG + Intronic
1104228076 12:126856607-126856629 TCGATGAGCCAGAGTGAAAAGGG - Intergenic
1104642045 12:130473572-130473594 TAGATGGAGCAGAGTGAGGGAGG + Intronic
1105438200 13:20395035-20395057 TGGATGAACCACAGTGAGAACGG - Intergenic
1105660616 13:22490196-22490218 TTAATGCACCAGATAGAGGATGG - Intergenic
1106865069 13:33955171-33955193 TTAATGAACAAGAGTGAAGAAGG + Intronic
1107355562 13:39561828-39561850 TTGTTGAATCAGAGTGAATATGG + Intronic
1107455323 13:40549654-40549676 TTGATGACCCAAAGTCAGGCAGG + Intergenic
1109418445 13:62075990-62076012 TTGATGAAGCAAAGTGTAGAAGG - Intergenic
1110382496 13:74869884-74869906 TTGATTAAGCTTAGTGAGGAAGG - Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1113110650 13:106819683-106819705 TTCAAGGATCAGAGTGAGGAAGG + Intergenic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1113672552 13:112184878-112184900 GTGATGAACCAGAGCCACGAGGG + Intergenic
1113862096 13:113493210-113493232 TTTAGGAACCTGATTGAGGAAGG + Intronic
1115888711 14:38003635-38003657 CTGATGACCCAGATTGTGGAAGG - Intronic
1116032642 14:39591240-39591262 CTGATGTACCACAGTTAGGAAGG + Intergenic
1116986734 14:51227854-51227876 TGGATGGAGCAGAGTGAGGAAGG + Intergenic
1117313083 14:54547884-54547906 TTAAAGAACCAGGCTGAGGAAGG - Intergenic
1119062848 14:71493509-71493531 TTGATTAACCAGAGTGACTGAGG + Intronic
1119939924 14:78629418-78629440 TGGTTGAAGCAGAGTTAGGAGGG + Intronic
1121568224 14:94926411-94926433 TTGACGAGCCAGGGAGAGGAGGG - Intergenic
1124096326 15:26651756-26651778 ATGCTGTACCAGAGTGAGGTTGG - Intronic
1125870593 15:43098002-43098024 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1126589312 15:50323465-50323487 CTGAGGACCCAGAGTGAGGCAGG + Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1127869609 15:63060347-63060369 TGGAAGAACCAGAGAGAGGAAGG - Intronic
1128072169 15:64804559-64804581 TGGATGAAGGAGAGTGAGGTGGG + Intergenic
1129203139 15:74017819-74017841 TTGAGGAATCAGTGTAAGGAAGG - Intronic
1129684172 15:77675883-77675905 TTGGGGAGCCAGAGTGGGGATGG - Intronic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131359514 15:91777891-91777913 TTAATGAACCAGTGAGAAGATGG + Intergenic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1132005194 15:98220175-98220197 TTGATGAACTAAGTTGAGGATGG - Intergenic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1134288656 16:12884803-12884825 TTGATGAAACAAATTAAGGAAGG - Intergenic
1134334668 16:13287224-13287246 TTGATGGAGAAGAGTGTGGATGG + Intergenic
1139186367 16:64810484-64810506 TTGATGATACTGAGTGAGAATGG - Intergenic
1139313794 16:66050502-66050524 TTGTAGAACCAGAGAAAGGATGG + Intergenic
1141412127 16:83842560-83842582 TTGCTGAAACAAAGTAAGGAGGG - Intergenic
1141919861 16:87128448-87128470 TTGGTGAAGCAGGGTGTGGAAGG - Intronic
1142653379 17:1372496-1372518 ATGATGAAGCTGAGTCAGGAAGG - Intronic
1143555021 17:7654613-7654635 TTGATGACCTGGAGTGAGGGTGG - Exonic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1146272453 17:31493309-31493331 TTGAGGTACCAGAAAGAGGAAGG + Intronic
1147584694 17:41647587-41647609 TGGATGAGGCAGGGTGAGGAAGG + Intergenic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1148653914 17:49269190-49269212 TAGATGGACCAGAGTAATGAGGG - Intergenic
1148842991 17:50511038-50511060 AACATGCACCAGAGTGAGGAGGG + Intronic
1150022932 17:61638723-61638745 TTGATGAAAGAAATTGAGGAGGG + Intergenic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1151949330 17:77341199-77341221 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1151985957 17:77543918-77543940 TTGTTGAAACAGAGTCAGGGTGG + Intergenic
1153144143 18:2010083-2010105 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1155511911 18:26586547-26586569 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1155529992 18:26757379-26757401 TTGTTGAACCAGGAAGAGGAAGG + Intergenic
1155638125 18:27979367-27979389 TTCATGTACCACAGTGGGGAAGG + Intronic
1156333166 18:36144632-36144654 TTGTTAAACCACAATGAGGAAGG - Intronic
1157319991 18:46626813-46626835 TAGATGAAGGAGACTGAGGAAGG - Intronic
1158278470 18:55794499-55794521 TTGATGAGGGAGAGTGAGCAGGG + Intergenic
1158730872 18:60020957-60020979 TTGAAGAACGAGAGTGGAGAGGG + Intergenic
1159388838 18:67761605-67761627 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1159880881 18:73857462-73857484 TTGATGGACCAGAGTTGGGGTGG - Intergenic
1160104894 18:75964855-75964877 ATCCTGAACCAGAGTGAGCAGGG + Intergenic
1160149534 18:76388565-76388587 TTGATGACCCAGATGGAGAAAGG + Intronic
1160988422 19:1850863-1850885 TGGCTGGACCAGGGTGAGGAGGG + Intergenic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161883456 19:6974334-6974356 TTGCTTCACCACAGTGAGGATGG - Intergenic
1162688803 19:12412004-12412026 TGGATCAACCACATTGAGGAAGG - Intronic
1162768240 19:12933235-12933257 TTCAAGAACCAGAGTGATGGGGG - Intronic
1162843769 19:13375463-13375485 ATGATTAAACACAGTGAGGAAGG + Intronic
1165961186 19:39535753-39535775 GCGAGGAACCAGAGTGATGAAGG + Intergenic
1166687253 19:44802784-44802806 GTGATGACCCAGAGTGGGCATGG + Intergenic
1166735612 19:45082437-45082459 GTGATGACCCAAAGTGAGTAGGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166918021 19:46209047-46209069 GTGATGACCCAGGGTGAGCAAGG - Intergenic
1168161525 19:54513313-54513335 TTGAGGGAGCAGAGAGAGGAAGG + Intergenic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG + Exonic
925026047 2:608125-608147 TTGAGGAGCCAGAGAGGGGAAGG - Intergenic
925326445 2:3025660-3025682 ATTCTGAACCAGAGTGAGGTTGG - Intergenic
926969254 2:18450684-18450706 CTGATGACCAAGGGTGAGGATGG - Intergenic
927362138 2:22248461-22248483 TTTATGAGCCGGAGGGAGGAAGG + Intergenic
927817547 2:26232675-26232697 TTGATTAACCAGAATATGGAGGG - Intronic
928631240 2:33194315-33194337 ATGATTAACCTTAGTGAGGAGGG + Intronic
929866812 2:45724518-45724540 ATGATGAAGCTTAGTGAGGAAGG + Intronic
930807078 2:55501770-55501792 TTTATCAATCAGAGTGAGGGTGG + Intergenic
931655771 2:64510232-64510254 TTTGTGAACCACAGTGAGGAGGG + Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
933082891 2:78015576-78015598 ATGATTAAGCATAGTGAGGAAGG - Intergenic
933196222 2:79393181-79393203 TTGATGCACATGAGTAAGGATGG - Intronic
933823651 2:86138836-86138858 CTGATGAACTAGAGACAGGAAGG - Exonic
935944898 2:108276922-108276944 TTCATGAGCCAGACAGAGGATGG + Intergenic
937437907 2:121894527-121894549 TTTAAGGACCTGAGTGAGGAAGG + Intergenic
938227298 2:129626987-129627009 TTGATGAACAAGTGCGACGATGG + Intergenic
939186015 2:138861590-138861612 GTGATGAAGCTTAGTGAGGAAGG - Intergenic
939888821 2:147711266-147711288 TAGATGAACCAGAGTGGGTCAGG + Intergenic
939985176 2:148822988-148823010 TTTATGGCCCAGAGTTAGGAGGG - Intergenic
940410472 2:153357700-153357722 GTAATAAACCTGAGTGAGGATGG - Intergenic
942539929 2:177005374-177005396 ATGATTAAGCATAGTGAGGAAGG + Intergenic
942799907 2:179862519-179862541 TTGAGGTACCAGCGTGAGAAAGG + Intergenic
944302616 2:198141658-198141680 TTGATGGACCATACTGTGGAGGG - Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945575119 2:211521128-211521150 ATGATTAAGCATAGTGAGGAAGG + Intronic
946713580 2:222530835-222530857 ATGATTAACCTTAGTGAGGAAGG - Intronic
947045269 2:225975368-225975390 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
947701636 2:232239419-232239441 TTCATGAACCACAGTGTGGAGGG - Intronic
947754165 2:232549794-232549816 ATGATTAAACTGAGTGAGGAAGG - Exonic
1168857705 20:1020353-1020375 TGGATGAAGCAGAATGAGGGAGG + Intergenic
1169756709 20:9050643-9050665 ATGATGAAGCTGAGTGAGGTAGG - Intergenic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1171773758 20:29347294-29347316 TTGATGAAGATGAGTGAAGATGG - Intergenic
1171815770 20:29784843-29784865 TTGATGAAGATGAGTGAAGACGG - Intergenic
1171902596 20:30871194-30871216 TTGATGAAGATGAGTGAAGATGG + Intergenic
1172192856 20:33072453-33072475 TAGATGACCCAGAGTGTGTAAGG + Intronic
1172359742 20:34303562-34303584 TGGCTGAACCAGCGAGAGGACGG - Intronic
1172698002 20:36835550-36835572 TTGATGGACCCGAGTGGGGAGGG - Intronic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1173707350 20:45121586-45121608 ATGATTAACCTTAGTGAGGAAGG - Intergenic
1177461438 21:21416055-21416077 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1178054224 21:28781035-28781057 TTTAGGAACCAGAGAGAGAAAGG - Intergenic
1180089872 21:45528450-45528472 TTCCTTAACCAGAGTGAGGCCGG - Intronic
1180319221 22:11305410-11305432 TTGATGAAGATGAGTGAAGACGG - Intergenic
1180335986 22:11577162-11577184 TTGATGAAGATGAGTGAAGATGG + Intergenic
1182412344 22:30197851-30197873 TTGATGAAGCTGTGTGTGGAAGG - Intergenic
1182471638 22:30552327-30552349 TTGATTAATAAAAGTGAGGAAGG + Intergenic
1183945428 22:41323219-41323241 CTGATGAACAAGTCTGAGGAGGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1185178021 22:49341406-49341428 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
950246322 3:11422711-11422733 ATGATTAAGCATAGTGAGGAAGG - Intronic
950700312 3:14740147-14740169 ATGATTAACCTTAGTGAGGAAGG - Intronic
950928127 3:16763635-16763657 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
951530056 3:23690371-23690393 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
952048029 3:29347655-29347677 TTCATGAACCATAGTCTGGAGGG + Intronic
953435561 3:42874731-42874753 TTCATGAACCAACCTGAGGAGGG + Exonic
954961783 3:54571913-54571935 TTGATGCACCAGAGTCAAGCTGG + Intronic
955123716 3:56088180-56088202 TTGAGGATCCAGACTTAGGAAGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
957863711 3:85994577-85994599 ATGATGAAGCTTAGTGAGGAAGG - Intronic
959873540 3:111355664-111355686 ATGATGAAGCTTAGTGAGGAAGG + Intronic
961092165 3:124122877-124122899 ATGATGAAGCTTAGTGAGGAAGG + Intronic
961166817 3:124769383-124769405 TAGATGGACCAGAGTGCAGATGG - Intronic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
962206517 3:133439515-133439537 TTGATATACCACAGTGAGTATGG + Intronic
963001545 3:140686351-140686373 TTTCTGAGCCAGTGTGAGGAAGG + Intronic
964535024 3:157711412-157711434 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
964737252 3:159929583-159929605 TTGAGGAAGAAGTGTGAGGAGGG + Intergenic
964900045 3:161647580-161647602 TTTATGAACCAAAGAGGGGAAGG + Intergenic
965232013 3:166066236-166066258 TTTGTGAACCAGAGTGAAGAAGG + Intergenic
965653233 3:170955402-170955424 TTCAGGAACAAGAGAGAGGACGG - Intergenic
966108467 3:176365291-176365313 TTGCTGAACCAGACTAAGCAGGG + Intergenic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
967329349 3:188275153-188275175 GTGATGACCCAAAGTCAGGATGG - Intronic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
968793675 4:2687701-2687723 TGGATGAACCAGAAGGCGGAAGG - Intronic
969217901 4:5736938-5736960 ATTATGAAGCATAGTGAGGAAGG + Intronic
970457347 4:16238285-16238307 TGGATGGGCCAGATTGAGGATGG - Intergenic
972099418 4:35394306-35394328 ATGATTAAACATAGTGAGGAAGG + Intergenic
972189332 4:36571015-36571037 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
972202729 4:36734661-36734683 TAGTTGAAACAGAGTGCGGAGGG - Intergenic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
978705449 4:111703889-111703911 TTCTTGAACCAGTGTGAGCAAGG - Intergenic
982413496 4:155105837-155105859 TGGATGAAGCAGAGTGAAGCGGG + Intergenic
983670203 4:170228286-170228308 TTGATAAACTATAGTGTGGAGGG - Intergenic
983803623 4:171966366-171966388 TTGGTGAATGAGAGTGGGGATGG + Intronic
985328340 4:188797762-188797784 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
985699636 5:1362791-1362813 TTGCTGAACTAGAAAGAGGATGG - Intergenic
985718261 5:1475120-1475142 AGGATGAAGCAGAGTGAGGCGGG + Intronic
985821266 5:2161516-2161538 TGGATGAATCAGAGGGTGGATGG - Intergenic
986361345 5:6981171-6981193 TGGATGGACTAGAGTGGGGATGG - Intergenic
988648079 5:33118005-33118027 TTCATGAACAAGTGCGAGGATGG - Intergenic
989203882 5:38792594-38792616 GTGAGGAAAGAGAGTGAGGATGG - Intergenic
990526344 5:56631576-56631598 TTTATGACCCAGATTGAGGAAGG - Intergenic
993860714 5:93133535-93133557 TTGAAGAACCAGATTTAGGAAGG - Intergenic
995296172 5:110525183-110525205 TTGATTAAAAATAGTGAGGATGG - Intronic
997139646 5:131364924-131364946 TTGAGGAAACGGAGTGGGGATGG + Intronic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
998784654 5:145695769-145695791 TGAATGACCCAGAGTGAGCAAGG + Intronic
1000234823 5:159347617-159347639 TTGATAAACAAGTATGAGGAAGG + Intergenic
1001479770 5:172080398-172080420 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1006707669 6:36035553-36035575 ATGATTAAGCATAGTGAGGAAGG + Intronic
1007753101 6:44081842-44081864 ATGATGAGTCAGAGTGAGGCTGG - Intergenic
1008955060 6:57206543-57206565 TTGATGGACCAGAGCAAGCAGGG + Intronic
1011821626 6:91259985-91260007 TTGAAGGACCAGAGTAATGATGG + Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1014599490 6:123392076-123392098 TTGATGAAGCACAGTGAACAAGG - Intronic
1015103087 6:129504325-129504347 TTGTTGAACCACAATGAGGCTGG + Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015555755 6:134459752-134459774 TTCTTTAATCAGAGTGAGGAGGG - Intergenic
1015914948 6:138206584-138206606 TTGATGAGACAGAGTGCTGATGG + Intronic
1016850768 6:148616535-148616557 GTGATGAAGCAGAGAGGGGAAGG + Intergenic
1017385003 6:153873217-153873239 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1017539771 6:155388747-155388769 TTGATGAAGCATGGTGAGCAGGG + Intergenic
1018138951 6:160807532-160807554 TGGATGAATCAGATTGTGGATGG + Intergenic
1018881393 6:167885358-167885380 TTGATTAAACATAGTGAGAAAGG - Intronic
1020939397 7:14511701-14511723 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1021052734 7:16009003-16009025 TGGCTGAACCATAGTGAGCAGGG + Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021572596 7:22081530-22081552 TCTGTGAACCAGAGTGGGGAGGG + Intergenic
1023193517 7:37609473-37609495 ATGATTAAGCATAGTGAGGAAGG + Intergenic
1024094254 7:45971807-45971829 CTGATGATTCAGAGTGAGGAGGG - Intergenic
1024295603 7:47839582-47839604 CTGATGAACCAGCCTGGGGAAGG + Exonic
1026256103 7:68713213-68713235 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1026642137 7:72136657-72136679 ATGATTAAGCATAGTGAGGAAGG - Intronic
1027006055 7:74693951-74693973 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1027998542 7:85460669-85460691 TAGATGAGCCAGAGTCTGGAGGG - Intergenic
1028105566 7:86873736-86873758 TTGATGAAAAAAATTGAGGATGG + Intergenic
1028661542 7:93283042-93283064 TTGATGATCCAGAGAGAAAATGG - Intronic
1029271528 7:99379948-99379970 TTAAGAAACCAGAGAGAGGAGGG - Intronic
1030172912 7:106622663-106622685 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1030450239 7:109700042-109700064 GTGATAACCCAGATTGAGGATGG - Intergenic
1031886107 7:127247585-127247607 TTGGTGGGGCAGAGTGAGGATGG + Intronic
1032361400 7:131258779-131258801 TTCATGAAAAAGAGTAAGGATGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034316805 7:150140784-150140806 TTGATTATGCTGAGTGAGGAAGG + Intergenic
1035815615 8:2536913-2536935 TTGATGAAAGAAATTGAGGAGGG - Intergenic
1035901087 8:3459254-3459276 CTCATGGACCAGAGTGAGCAGGG + Intronic
1037086488 8:14857127-14857149 ATCATGAACAAGAGAGAGGAGGG - Intronic
1037594291 8:20341835-20341857 TTGTTAAACTGGAGTGAGGAGGG - Intergenic
1038424623 8:27456652-27456674 ATGATTAAGCTGAGTGAGGAAGG + Intronic
1038976345 8:32700930-32700952 TTGAAGACCCAGAGGCAGGAGGG - Intronic
1039107896 8:34009182-34009204 TGGATGAACCACAGGAAGGAAGG - Intergenic
1039907042 8:41794281-41794303 TGGTTGAAGCAGAGTGAGGCAGG - Intronic
1042797621 8:72681853-72681875 TTGATGAACCACATAGATGATGG - Intronic
1043509258 8:80933443-80933465 TTAATTAATCAGAGTGAAGAGGG + Intergenic
1044030876 8:87235360-87235382 ATGATTAACCTGAGTAAGGAAGG - Intronic
1046316780 8:112513262-112513284 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1049652976 8:143783839-143783861 TTGATGGTGTAGAGTGAGGAGGG - Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052864480 9:33456781-33456803 TTTAGGAGGCAGAGTGAGGAGGG + Intergenic
1053303302 9:36966727-36966749 TTGATGAGCAGGAGAGAGGAAGG + Intronic
1053350407 9:37410312-37410334 TAGATGAGGCAGAGTGAGGGAGG + Intergenic
1053620637 9:39810637-39810659 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053626072 9:39873298-39873320 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1053878803 9:42569923-42569945 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053893869 9:42724448-42724470 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054217816 9:62377403-62377425 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1054232886 9:62531772-62531794 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054263526 9:62896807-62896829 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054858847 9:69929302-69929324 TTGAAGAAATAGAGTCAGGAAGG - Intergenic
1055155248 9:73054991-73055013 TTGGTGAAGCACTGTGAGGAGGG + Intronic
1055434637 9:76280417-76280439 TTGATTAAGCTTAGTGAGGAAGG + Intronic
1056138012 9:83648153-83648175 TTAATGCACCACTGTGAGGAGGG + Intergenic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1057410480 9:94812918-94812940 TTATTGAGCCAAAGTGAGGATGG + Intronic
1057445643 9:95112585-95112607 AGGCTGTACCAGAGTGAGGAGGG + Intronic
1059749406 9:117233796-117233818 TTGATAATCCACAGTGAAGATGG - Intronic
1059883838 9:118722257-118722279 TTGATGATTCAGAATCAGGAAGG + Intergenic
1061490601 9:130941905-130941927 TTGGTGAGCCAGAAAGAGGAAGG - Intergenic
1203367448 Un_KI270442v1:271159-271181 TTGATGAAGATGAGTGAAGACGG - Intergenic
1187265337 X:17726846-17726868 TGGATAAACCAGAGTGAACAAGG + Exonic
1187663983 X:21583254-21583276 TTCATGCACCAGAATGAGCAAGG + Intronic
1187992266 X:24887728-24887750 TTGATGTATTGGAGTGAGGAAGG + Intronic
1189290544 X:39882331-39882353 AGGATGAAGCAGAGTGGGGAGGG + Intergenic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1194065734 X:89259758-89259780 TACATGAACCAGAGAGGGGATGG - Intergenic
1194364727 X:93000843-93000865 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1194702691 X:97133701-97133723 TTGAAGACCAAGAGTGAGAATGG - Intronic
1194846495 X:98815740-98815762 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1197401194 X:125992991-125993013 TTGATGAGCCAAAGTGAACATGG - Intergenic
1198669496 X:139064029-139064051 TAGATGAACCAGGTTCAGGATGG + Intronic
1200719901 Y:6593884-6593906 TACATGAACCAGAGAGGGGATGG - Intergenic