ID: 902189111

View in Genome Browser
Species Human (GRCh38)
Location 1:14748738-14748760
Sequence GGCAATGTATGTGAAGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902189108_902189111 -1 Left 902189108 1:14748716-14748738 CCCTGTGCTGAAGACTAAATGAG 0: 1
1: 0
2: 2
3: 28
4: 206
Right 902189111 1:14748738-14748760 GGCAATGTATGTGAAGCTCTTGG 0: 1
1: 0
2: 3
3: 22
4: 260
902189109_902189111 -2 Left 902189109 1:14748717-14748739 CCTGTGCTGAAGACTAAATGAGG 0: 1
1: 0
2: 4
3: 14
4: 129
Right 902189111 1:14748738-14748760 GGCAATGTATGTGAAGCTCTTGG 0: 1
1: 0
2: 3
3: 22
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902189111 Original CRISPR GGCAATGTATGTGAAGCTCT TGG Intronic
900710454 1:4109928-4109950 GGCCATGAGTGTGATGCTCTGGG - Intergenic
901081267 1:6585571-6585593 GGCCATGGGTTTGAAGCTCTGGG + Intronic
901284650 1:8067482-8067504 ATCAATATATGTAAAGCTCTCGG + Intergenic
902066993 1:13696669-13696691 GGCAATGTACGGTAAACTCTTGG + Intergenic
902189111 1:14748738-14748760 GGCAATGTATGTGAAGCTCTTGG + Intronic
903551372 1:24159246-24159268 GGTCATGTATGTGAAGCACTCGG - Intronic
903623396 1:24714449-24714471 GATAAGGTATGTGAAGTTCTGGG + Intergenic
903827101 1:26154352-26154374 GGCACTGAGTGTGAAGCACTTGG + Intergenic
904437860 1:30510902-30510924 GGCAATGTATGTGATGCTGAAGG + Intergenic
906503220 1:46357500-46357522 GGCAATATATCTGAATATCTTGG - Intronic
908036567 1:60060819-60060841 TGCACTGTCTGTAAAGCTCTTGG - Intronic
910035683 1:82784628-82784650 TGTAATGTATGTGAAGGTCTTGG + Intergenic
910821995 1:91361009-91361031 GACAATGTACCTGAATCTCTGGG + Intronic
911229846 1:95349259-95349281 GAAAATGGATGTGGAGCTCTTGG + Intergenic
911413265 1:97538116-97538138 AGCAATGGATGTGCACCTCTTGG + Intronic
911674749 1:100646886-100646908 GCCAAAGTATGTAAAGCTCCTGG - Intergenic
913459952 1:119074185-119074207 GGCAATGGATGTGAAGCTCCAGG + Intronic
915639535 1:157213270-157213292 GACAATGTATCAGAATCTCTGGG - Intergenic
915846513 1:159271508-159271530 GACAATGTATTAGAATCTCTGGG + Intergenic
916947241 1:169741233-169741255 AGCAATGTATGTGAAGTGCCAGG - Intronic
920333034 1:205225862-205225884 GGTAATATATGTAAAGCACTTGG - Intergenic
921158541 1:212456513-212456535 AACAATGTATGTGAAGCTCTTGG - Intergenic
921260941 1:213384627-213384649 GGGCATCTGTGTGAAGCTCTAGG - Intergenic
923925584 1:238623670-238623692 GGGAGTGTATGTGAAGGCCTAGG - Intergenic
1063642909 10:7849109-7849131 GTTAATGTGTGTGAAGCACTTGG - Intronic
1063971707 10:11385705-11385727 GGCAAAGTATGGGATGCTGTTGG - Intergenic
1066615191 10:37286460-37286482 CACAATGTATCTGAACCTCTGGG - Intronic
1067118872 10:43456949-43456971 GGCATAGTATGGGAAGCTCTCGG - Intronic
1068380890 10:56252641-56252663 GACAATGTATCAGAATCTCTGGG - Intergenic
1068598776 10:58933833-58933855 GGCTGTGTATGTCATGCTCTGGG + Intergenic
1069895091 10:71675529-71675551 GACAATGCCTGTGAAGCCCTTGG - Intronic
1070376825 10:75840496-75840518 GGCACTAAATGTGAAGCTCTAGG - Intronic
1070603607 10:77882937-77882959 AGAAATGGAGGTGAAGCTCTTGG - Intronic
1071197838 10:83182053-83182075 GGCAATGTATTTAAAGCCATTGG - Intergenic
1072267768 10:93746893-93746915 GACAATGTATGGGAAGCACCTGG + Intergenic
1072341162 10:94451852-94451874 GGCATTATATGTGTAGCTTTTGG + Intronic
1074323899 10:112429542-112429564 GGCAGGGAATGTGAAGCTTTGGG - Intergenic
1075635897 10:124030037-124030059 GGAAATGTTTGTGAAGTCCTTGG - Intronic
1076304296 10:129453204-129453226 GTGAATGAATGTGAAGGTCTAGG - Intergenic
1079257093 11:18840578-18840600 GGCAATGTACCAGAATCTCTGGG + Intergenic
1079425380 11:20336764-20336786 GACAATTTATGGTAAGCTCTTGG - Intergenic
1080133269 11:28821462-28821484 GACAATGTATATAAAGTTCTTGG - Intergenic
1080151082 11:29052768-29052790 GGCTATGAAAGTGAACCTCTGGG - Intergenic
1080191731 11:29558368-29558390 GGAAACGTGTGTGAAGCTGTGGG + Intergenic
1080480454 11:32643738-32643760 GTCAGTGAATGTGAAGGTCTAGG + Intronic
1080699686 11:34634083-34634105 GGGAATGTATTTGATTCTCTTGG - Intronic
1080867686 11:36210106-36210128 GGGAATGGATGGGGAGCTCTGGG - Intronic
1081454674 11:43209879-43209901 GACAATGTACCTGAATCTCTGGG - Intergenic
1081555913 11:44160895-44160917 GCCAATCTATGGAAAGCTCTTGG + Intronic
1081827077 11:46065750-46065772 GCCACTGTGTGTGAAGCACTAGG + Intronic
1081908262 11:46682876-46682898 GCTAATGTATGTGAAGTGCTTGG - Intronic
1082204105 11:49410560-49410582 GACAATGTATGTATAGCCCTTGG + Intergenic
1082661947 11:55922626-55922648 AACAATGTTTGTAAAGCTCTTGG - Intergenic
1084178286 11:67434577-67434599 CGCCACGTATGTGAAGCCCTGGG - Exonic
1086235405 11:84624604-84624626 GGGAATGATAGTGAAGCTCTTGG - Intronic
1086650985 11:89289967-89289989 GACAATGTATGTATAGCCCTTGG - Intronic
1087068826 11:94054687-94054709 GGCAATGTGTGTGATGGACTGGG - Intronic
1087540509 11:99512088-99512110 GGGAGTGAATGTGAAGCCCTAGG - Intronic
1088226936 11:107630901-107630923 GCCACTGTATGTGAATTTCTAGG + Intronic
1088773580 11:113059853-113059875 GGTCATGTATGTAAAGCACTTGG + Intronic
1089948454 11:122502275-122502297 GCCAATGTTTGTGCAGCTTTAGG + Intergenic
1090774241 11:129949094-129949116 GGCAATGGATGCAAAGCTGTGGG - Intronic
1091765299 12:3116433-3116455 GGCAATGCTTGTGAAGTGCTGGG + Intronic
1093244809 12:16723069-16723091 AGCAATGTATGTGAAGAGCTGGG + Intergenic
1093554980 12:20461634-20461656 GGTAATGTATATTAAGCTTTGGG + Intronic
1095973498 12:47922719-47922741 GGCCAGTTATGTGAAGATCTGGG - Intronic
1096421184 12:51459300-51459322 AGAAATGTTTCTGAAGCTCTGGG - Intronic
1097598275 12:61661498-61661520 GGCAATGTATCAGAATCTCTGGG - Intergenic
1097727650 12:63093264-63093286 CTCAATCTATGTGAAGCTCTAGG + Intergenic
1099214795 12:79840250-79840272 AGAAATGCATGTGAAGCTCTTGG + Intronic
1101412727 12:104482665-104482687 GGCAATGTGTGTGAAGCTCCGGG - Intronic
1101950277 12:109169286-109169308 GGCCATGTCTGTGAAGAGCTTGG - Intronic
1103286394 12:119804802-119804824 CTCAATGTACCTGAAGCTCTGGG - Intronic
1103754057 12:123189094-123189116 GGCAATGTAAATGTAGCTGTTGG + Intronic
1105585838 13:21741964-21741986 GGCAATGGATGTGATGACCTTGG - Intergenic
1106387820 13:29305100-29305122 GGCAATGTACCAGAATCTCTGGG + Intronic
1107551186 13:41477509-41477531 CACAATGTATGAGAATCTCTGGG - Intergenic
1108049089 13:46412243-46412265 GACAATGTATCAGAATCTCTGGG + Intronic
1108387134 13:49909580-49909602 GGGAGTGAATGTGAAGATCTAGG - Intergenic
1109096964 13:58131278-58131300 GACAATGTATCAGAATCTCTGGG - Intergenic
1109109539 13:58298856-58298878 GGCAATGTATGTGAATGACAAGG + Intergenic
1112375718 13:98838318-98838340 GTTAATATTTGTGAAGCTCTTGG + Intronic
1113073750 13:106448141-106448163 AACAGTGTATGTGAAGCTGTCGG + Intergenic
1114971415 14:28034192-28034214 GACAATGTATCAGAATCTCTGGG - Intergenic
1115102328 14:29717567-29717589 GTTAATATATGTGAAGCACTTGG + Intronic
1115940621 14:38604630-38604652 GGCAATGTTTGTGGAGATTTTGG + Intergenic
1116055623 14:39860938-39860960 GGTCATGTATGTAAAGCTCCTGG + Intergenic
1116692684 14:48130672-48130694 GTCAATGTATGTGTATTTCTAGG - Intergenic
1116842255 14:49830983-49831005 AGCAATGTTTGAGAAGCTTTGGG + Intronic
1117070580 14:52052399-52052421 GACAGCGTATGTGAAGTTCTTGG - Intronic
1117830692 14:59746694-59746716 GGCAGTTTATGTGAGCCTCTGGG - Intronic
1118353858 14:64994729-64994751 GTGAATGAATGTGAAGCCCTAGG + Intronic
1125054272 15:35339242-35339264 GACAATGTATCAGAATCTCTGGG - Intronic
1129054673 15:72810565-72810587 GGGAATGTATGTGAGTCTGTTGG + Intergenic
1131795597 15:96012902-96012924 TGCAATGTCTGTTAAGATCTTGG + Intergenic
1133421086 16:5647496-5647518 GGCAAGTTATCTGAAGCTCAGGG + Intergenic
1134742509 16:16560359-16560381 GTCAATGTACATTAAGCTCTTGG - Intergenic
1134925050 16:18152100-18152122 GTCAATGTACATTAAGCTCTTGG + Intergenic
1135383025 16:22009097-22009119 GGCAATGTTTGAGAAGCTTGTGG + Intronic
1138538076 16:57670346-57670368 AGGCATGTAAGTGAAGCTCTTGG - Intronic
1138557762 16:57782594-57782616 GGGGATGTATCTGAAGCTCCAGG - Intronic
1139385895 16:66570624-66570646 GGCAAAGAATGTGAAAGTCTGGG - Intronic
1140789814 16:78380685-78380707 GGCAATGTATCTAAAGCAGTTGG - Intronic
1140925304 16:79576797-79576819 GGTAATGTATGTAAAGCACCTGG - Intergenic
1144251629 17:13422383-13422405 GGCACTGTATGTGAAATCCTTGG - Intergenic
1144368816 17:14570490-14570512 GAAAATGTATGTGAAAGTCTGGG - Intergenic
1144753130 17:17663742-17663764 GAAAATGTGTGTGAAGCTCTGGG - Intergenic
1147701206 17:42396426-42396448 GGCAATGAATGTGAAGTGATGGG - Intergenic
1148622827 17:49047219-49047241 GGCTATGTATGTGAAGTTTGAGG - Intronic
1149322417 17:55494978-55495000 GGCAATGTATGCAAAGCGCTTGG + Intergenic
1149377664 17:56061909-56061931 GGCAATGTACCAGAACCTCTGGG - Intergenic
1150190195 17:63230459-63230481 GGCAATGTACCAGAATCTCTGGG - Intronic
1150418920 17:65012511-65012533 GGCTACGTATGTGTAGCTCATGG + Exonic
1150877089 17:68982379-68982401 GGCAATGTCTGGGAAGATTTGGG - Intronic
1151020744 17:70614553-70614575 GGTAGTGAATGTGAAGGTCTAGG - Intergenic
1151235006 17:72713512-72713534 GGCAATGTATGAGAACCCTTCGG - Intronic
1151858434 17:76739264-76739286 GACAATGCATGTAAAGCACTTGG + Intronic
1153125682 18:1787469-1787491 GACAATGTATCAGAATCTCTGGG + Intergenic
1153592025 18:6683834-6683856 GGCACTGGATTTGAAGCTCAGGG + Intergenic
1154218054 18:12429922-12429944 GGGAATGTTCGTGAAGCTCAAGG - Intronic
1156488503 18:37481971-37481993 GGCAATGTAGGTAAAGTGCTTGG + Intronic
1156626607 18:38917467-38917489 CACAATGTATGAGAATCTCTGGG - Intergenic
1156695137 18:39756594-39756616 GACAATGTATTAGAATCTCTGGG + Intergenic
1156955251 18:42954985-42955007 GACAAGCTATGTGAAGCTTTGGG + Intronic
1157308568 18:46534918-46534940 GGCAAGGAATGTGGAGTTCTAGG - Intronic
1159232240 18:65623905-65623927 GACACTGTGTGTGATGCTCTTGG + Intergenic
1160253706 18:77228094-77228116 GCCAGTGCATGTGAGGCTCTAGG + Intergenic
1162871848 19:13592361-13592383 GTCAATGCATGTAAAGGTCTTGG + Intronic
1167707619 19:51090873-51090895 GAGGATGTATGTGAAGCCCTTGG - Intergenic
1168568809 19:57446979-57447001 GTGAGTGAATGTGAAGCTCTAGG + Intronic
925559200 2:5169962-5169984 CGCCTTGTATGTGCAGCTCTAGG - Intergenic
926048270 2:9726334-9726356 GGCAATGCATGTAAAGTGCTTGG - Intergenic
926861969 2:17319299-17319321 ATCAATATATGTAAAGCTCTTGG + Intergenic
926965970 2:18411200-18411222 GGCAATGAGTGAGAGGCTCTTGG + Intergenic
927424000 2:22960841-22960863 GACAATGTATGCAAAGCACTTGG + Intergenic
927443670 2:23139095-23139117 GGCAAGGGAAGTGAGGCTCTGGG - Intergenic
928590600 2:32810689-32810711 AGCAATATATATGAAGCTATAGG + Intronic
928678792 2:33677590-33677612 GAGAATGAATGTGAAGCGCTAGG - Intergenic
933058713 2:77707465-77707487 GGTACTGTTTGGGAAGCTCTGGG + Intergenic
933210288 2:79559278-79559300 GGCAGTTTATGTGAATCACTTGG + Intronic
934615560 2:95768480-95768502 GGCAGTGTATGAGAATATCTGGG + Intergenic
934645340 2:96056078-96056100 GGCAGTGTATGAGAATATCTGGG - Intergenic
934838745 2:97612167-97612189 GGCAGTGTATGAGAATATCTGGG - Intergenic
935398247 2:102633138-102633160 GACAATGAATGTAAAGCGCTTGG - Intronic
935489104 2:103695476-103695498 GACAATGTATCAGAATCTCTGGG - Intergenic
937970532 2:127545756-127545778 GGCATTGTATGTGGAGCTGTTGG + Intronic
938567839 2:132536248-132536270 GACAATGTATCAGAATCTCTGGG - Intronic
938717352 2:134032970-134032992 GGCAATGAATTTGAAGCTTATGG + Intergenic
939173705 2:138725354-138725376 TGCAATGTAAGGGAAGATCTGGG - Intronic
939434696 2:142160162-142160184 TACAATGTATGAGAATCTCTGGG + Intergenic
939568393 2:143812039-143812061 GTAAATGTATGTGTAGCCCTTGG + Intergenic
942527016 2:176864022-176864044 GGCAACGTGTGTGAACCTGTTGG - Intergenic
942970689 2:181954334-181954356 GGGAATGTATGTGGAGGTCGGGG - Intronic
945164592 2:206929349-206929371 GACAATGTATCAGAATCTCTGGG + Intergenic
945311470 2:208318447-208318469 GGCAATGTAGATGAAGCTGGAGG + Intronic
945388316 2:209231101-209231123 GACAATGTATCAGAATCTCTGGG - Intergenic
945532213 2:210969832-210969854 TGCAATGTCTGCAAAGCTCTGGG - Intergenic
948249786 2:236517412-236517434 AACAATGTATGTAAAGCACTTGG + Intergenic
949050299 2:241894361-241894383 GGCATTGTGAGTCAAGCTCTCGG + Intronic
1170730272 20:18968417-18968439 GGCAATGTACTAGAATCTCTGGG + Intergenic
1172330381 20:34071853-34071875 GGGAATGTATGTAAAGCACCTGG + Intronic
1172681287 20:36717657-36717679 GAGAATGTATGTAAAGCACTTGG + Intronic
1173127885 20:40356976-40356998 AGCAATGTATGTAAAGCATTTGG + Intergenic
1173549333 20:43921503-43921525 GACCATGTATGTGTAGCACTTGG + Intronic
1173679205 20:44864748-44864770 GGAAATCTATGTAAAGTTCTTGG - Intergenic
1177373524 21:20238076-20238098 GACAATGTATCAGAATCTCTGGG + Intergenic
1177719709 21:24890083-24890105 TGAAATGTATGTGATGCTTTAGG - Intergenic
1178535550 21:33407454-33407476 GGTAATGTATATAAAGCACTTGG - Intronic
1184534983 22:45080567-45080589 GCAAATGTATGTAAAGCACTTGG - Intergenic
1185166163 22:49263567-49263589 GGGAGTGTAAGTGAAGCTCAGGG + Intergenic
949917821 3:8978151-8978173 GGCAAGGCATGTGAAGTGCTTGG + Intergenic
950637755 3:14327382-14327404 GTCCATTTACGTGAAGCTCTGGG + Intergenic
950684496 3:14606815-14606837 GTCAATACATGTAAAGCTCTTGG + Intergenic
952679226 3:36072197-36072219 GACAATGTATGAGAATCTCTGGG - Intergenic
955755947 3:62225200-62225222 GGCAGGGGATGCGAAGCTCTTGG - Intronic
955831846 3:63013234-63013256 GGCAATGTACCAGAATCTCTGGG - Intergenic
956055999 3:65299728-65299750 GGAAATGGATGTGAAGTTCTGGG - Intergenic
956724082 3:72142727-72142749 GGCCATGCTTGGGAAGCTCTTGG - Intergenic
957211519 3:77265115-77265137 GGCAATGTAAATGAAGCCCTTGG - Intronic
958759700 3:98292293-98292315 GCCATTGTATGTAAAGCTCCTGG + Intergenic
959639401 3:108615378-108615400 TGGAATGTAGGTGAAGTTCTTGG + Intronic
960377866 3:116925500-116925522 CACAATGTATGAGAATCTCTGGG - Intronic
960884718 3:122382927-122382949 GGCCTTGTCTGGGAAGCTCTGGG - Intronic
961116102 3:124331484-124331506 GGTAATGTATGTAATGCACTTGG + Intronic
962812960 3:138974599-138974621 GGAAATGTGTGTGAAGGGCTTGG - Intergenic
963274469 3:143316410-143316432 GGGACTGGATGGGAAGCTCTGGG + Intronic
967081375 3:186052815-186052837 GGCAATATAATTGGAGCTCTGGG + Intronic
967891317 3:194366292-194366314 GTTAATGCATGTGAAGCACTTGG + Intronic
968573080 4:1352589-1352611 GGCAATCTCTGTGTACCTCTGGG - Intronic
969808446 4:9628759-9628781 GGCTAAGCTTGTGAAGCTCTAGG + Intergenic
970412379 4:15821153-15821175 GACAATGTATCAGAATCTCTGGG + Intronic
971116547 4:23653343-23653365 GTGAATGAATGTGAAGGTCTAGG + Intergenic
971918997 4:32911877-32911899 GACAATGTATCAGAAACTCTGGG + Intergenic
972994329 4:44861457-44861479 GGCAATACATGTGACTCTCTTGG + Intergenic
974378083 4:61103682-61103704 GGCAATGTAGGGGAAGTTGTAGG - Intergenic
974814358 4:66986353-66986375 GACAATGTATCAGAATCTCTGGG - Intergenic
977741568 4:100490450-100490472 GCCAGTGAATGTGAAGGTCTAGG - Intronic
979250208 4:118559644-118559666 GTCAATTTATGTGAAATTCTAGG + Intergenic
983369427 4:166840042-166840064 GTCAATGGAGCTGAAGCTCTGGG - Intronic
983779930 4:171656083-171656105 GTGAGTGAATGTGAAGCTCTAGG + Intergenic
985187154 4:187330127-187330149 TGAAATGTAAGTGAAGATCTTGG - Intergenic
986116539 5:4780804-4780826 GGCACTGTATGTGGAGATCATGG - Intergenic
987255005 5:16141854-16141876 GGCAATGAATGTGAAGTACTTGG - Intronic
987865784 5:23535763-23535785 TGCAATGTATGCCATGCTCTAGG + Intergenic
989811399 5:45681014-45681036 GGCAATGTATCTGAAGAGCCTGG - Intronic
992192111 5:74303367-74303389 GACAATGTATGTGAAGTGCTAGG - Intergenic
995113975 5:108458364-108458386 TGCAATGGATGTGATGTTCTGGG + Intergenic
996299201 5:121961235-121961257 GCTAATTTATGTAAAGCTCTTGG + Intergenic
996474399 5:123899934-123899956 GGCAATGTTGGTGAAGCTGGTGG + Intergenic
997598744 5:135125190-135125212 GACTATGTATGTAAAGCTCTTGG + Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
998545940 5:143027648-143027670 AGAAATGTTTGTGAACCTCTTGG + Intronic
998759483 5:145416612-145416634 GACAATGTACCTGAATCTCTGGG + Intergenic
999134671 5:149310621-149310643 GGTCACGTATGTAAAGCTCTTGG - Intronic
999666098 5:153915263-153915285 GGCAATGTACCAGAATCTCTGGG - Intergenic
999905654 5:156138423-156138445 GACCATGTATGTGAAGTTTTGGG - Intronic
1000447914 5:161347160-161347182 GGCAATGCATGTAAAGTACTTGG - Intronic
1001514784 5:172347775-172347797 GGAAACATCTGTGAAGCTCTTGG + Intronic
1003265059 6:4558409-4558431 GAGAATGTATGTGAAGCACCTGG - Intergenic
1003353731 6:5345150-5345172 GACAATGTATGTGAAGTGCCTGG + Intronic
1006240812 6:32677001-32677023 GACAATGTATCAGAATCTCTGGG - Intergenic
1006428012 6:33978218-33978240 GGCAATGTATGTACAGCACTCGG - Intergenic
1008507874 6:52248249-52248271 GGGAATGTCTGTGTATCTCTAGG - Intergenic
1009949789 6:70382333-70382355 GTGAATGAATGTGAAGATCTAGG - Intergenic
1010812411 6:80315185-80315207 GCCAGAGTATGTAAAGCTCTGGG + Intronic
1010842262 6:80660085-80660107 GGCATGGTGTGTGCAGCTCTTGG + Intergenic
1011411605 6:87072015-87072037 GGAAATGTACATGAACCTCTTGG + Intergenic
1011915981 6:92507929-92507951 GCCAAAGTATGTAAAGCTCCTGG - Intergenic
1013968404 6:115984362-115984384 GATAATGTGTGTGAAGGTCTTGG - Intronic
1014492421 6:122078749-122078771 GGCAATATGTGTGAATCTCATGG + Intergenic
1015977918 6:138809955-138809977 GGCAATCTATGTGATGCAGTGGG + Intronic
1017895319 6:158674492-158674514 GGCATTTTATCGGAAGCTCTTGG + Intronic
1018124014 6:160664624-160664646 GGCTATGGATGTGCAGCACTTGG - Intergenic
1018135363 6:160773554-160773576 GGCTATGGATGTGCAGCGCTTGG + Intergenic
1018173116 6:161157283-161157305 GGGAATATAAGTGAGGCTCTGGG + Intronic
1020233853 7:6340532-6340554 GGCAATGTTGGGGAAGCTGTGGG - Intronic
1020963439 7:14835349-14835371 GGAAATGTATGTGAAGTGCTTGG - Intronic
1021765293 7:23942893-23942915 GGCAGTGTGTGTGAAGCCCCAGG - Intergenic
1026362772 7:69617986-69618008 GTTAATGCATGTAAAGCTCTGGG - Intronic
1026893244 7:73995309-73995331 GGTAATCTCTGTGAAGCACTTGG + Intergenic
1028080583 7:86570153-86570175 GGCAATGTACCAGAATCTCTGGG + Intergenic
1031928456 7:127660892-127660914 GGCATTGAATTAGAAGCTCTGGG + Intronic
1032413607 7:131719206-131719228 GCCTCTGTATGGGAAGCTCTGGG - Intergenic
1035868355 8:3109636-3109658 GGAAATGCATGTGAAGGCCTTGG - Intronic
1037351253 8:17960160-17960182 GGCAAGGTATGTTAAGCTTTTGG + Exonic
1037919252 8:22792599-22792621 GGCAGCGTGTGTGAAGCACTGGG - Intronic
1040392025 8:46958410-46958432 GGCAATGTCTGAGGCGCTCTTGG + Intergenic
1041120354 8:54580176-54580198 GTCAATGTATATAAAGCACTTGG + Intergenic
1041482253 8:58334571-58334593 GACAATGTATCAGAATCTCTAGG + Intergenic
1041497930 8:58507579-58507601 GACAATGTATGTGAAGACCCTGG - Intergenic
1041585392 8:59511584-59511606 GACAATGTTTGTGAACCCCTTGG - Intergenic
1044759837 8:95506591-95506613 GGGAATGGGTGTGAGGCTCTAGG + Intergenic
1047136640 8:122086423-122086445 GGGAATGAATGTGAAGACCTAGG - Intergenic
1047430629 8:124788590-124788612 GTGAATGAATGTGAAGGTCTAGG - Intergenic
1047886400 8:129254535-129254557 GACAATCTTTGTGAAGTTCTGGG + Intergenic
1049228600 8:141470401-141470423 GGTAATGTCTGTGAAGCCCCTGG + Intergenic
1049340171 8:142108047-142108069 AGGCATGTATGTGAAGCTGTGGG - Intergenic
1051210560 9:14737904-14737926 GATAATGCATGTAAAGCTCTTGG + Intronic
1057275987 9:93676214-93676236 GGGAGGGTATGTGAGGCTCTAGG - Intronic
1057621028 9:96635261-96635283 GTTAATGTATGTAAAGCACTTGG + Intergenic
1058530081 9:105897604-105897626 GACAATGTATCAGAATCTCTGGG - Intergenic
1059895407 9:118858573-118858595 GACAATGTATTAGAATCTCTGGG + Intergenic
1060978360 9:127778631-127778653 GGCAAATTGTGTGAAGCCCTTGG + Exonic
1185813390 X:3131245-3131267 TGCAATCTATGTGAGGCTTTGGG + Intergenic
1186475206 X:9851792-9851814 GGCAATGTGAGGGAACCTCTTGG - Intronic
1187272907 X:17794739-17794761 GGCAATGTTTGTAAATTTCTTGG + Intergenic
1187944392 X:24412171-24412193 AGAAATGTCTGTGAAGCTCAAGG - Intergenic
1188087252 X:25914728-25914750 GATTTTGTATGTGAAGCTCTTGG - Intergenic
1188092446 X:25979700-25979722 GACAATGTATCAGAATCTCTGGG + Intergenic
1188442236 X:30223814-30223836 GGTAATGTATGGAAAGCACTTGG - Intergenic
1190015497 X:46823474-46823496 GGAAATGTATGTCAAGCACAAGG + Intergenic
1190820895 X:53971300-53971322 GACAATGTATGAGAATCTCTGGG + Intronic
1192063999 X:67861910-67861932 GACAATGTATCAGAATCTCTGGG - Intergenic
1192407643 X:70902367-70902389 GTGAATATATGTGAAGGTCTAGG + Intronic
1192729508 X:73788727-73788749 GACAATGTACCTGAATCTCTGGG - Intergenic
1193274650 X:79571030-79571052 GGCAGAGTATGTAAAGCTCCTGG + Intergenic
1193341038 X:80349828-80349850 GACAATGTACCTGAATCTCTGGG - Intronic
1194545409 X:95227665-95227687 GACAATGTATCAGAATCTCTGGG + Intergenic
1194565254 X:95479044-95479066 GGTACTGAGTGTGAAGCTCTTGG + Intergenic
1195198526 X:102522910-102522932 GACAATGTACGAGAATCTCTGGG + Intergenic
1197902994 X:131393297-131393319 AGCTATGTAAGTGAATCTCTGGG - Intronic
1199875687 X:151926170-151926192 TGCAATGTACGTGAAGCACCTGG - Intergenic
1199892164 X:152096350-152096372 GGAAATGTATTTGATGCTCATGG + Intergenic
1199948732 X:152688446-152688468 TGCAATGTAAGTAAAGCACTTGG - Intergenic
1199960944 X:152780003-152780025 TGCAATGTAAGTAAAGCACTTGG + Intergenic
1201959961 Y:19669029-19669051 GACAATGTACTTGAATCTCTGGG + Intergenic