ID: 902189202

View in Genome Browser
Species Human (GRCh38)
Location 1:14749621-14749643
Sequence GAGGAGTATTCCCAGTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902189196_902189202 12 Left 902189196 1:14749586-14749608 CCTGTGGTTACAGGAGGAAGGCA 0: 1
1: 0
2: 2
3: 16
4: 244
Right 902189202 1:14749621-14749643 GAGGAGTATTCCCAGTAGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 91
902189192_902189202 24 Left 902189192 1:14749574-14749596 CCTCTGGCTCGGCCTGTGGTTAC 0: 1
1: 0
2: 1
3: 3
4: 122
Right 902189202 1:14749621-14749643 GAGGAGTATTCCCAGTAGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902189202 Original CRISPR GAGGAGTATTCCCAGTAGGT TGG Intronic
901294920 1:8153840-8153862 GAGGTGTCTTCCCAAGAGGTAGG - Intergenic
901357481 1:8663860-8663882 GAACAGTATTCCCAGCAGTTGGG - Intronic
902189202 1:14749621-14749643 GAGGAGTATTCCCAGTAGGTTGG + Intronic
904956708 1:34290526-34290548 GAGGAATATTCCAAAAAGGTGGG + Intergenic
923332605 1:232939535-232939557 GAGCAGCATTCACAGTAAGTAGG - Intergenic
923910075 1:238431479-238431501 GAGCAGCATTCACAGTAGGCTGG + Intergenic
1064020048 10:11801669-11801691 GAGCTGTATTCCCAGTACTTTGG - Intergenic
1073131181 10:101190147-101190169 GAGAAGGACTCCCAGTGGGTGGG + Intergenic
1082085775 11:48048338-48048360 GAGGAGTCTTCCCAGCAGCGGGG - Intronic
1083185170 11:61013486-61013508 GAGGAGAATTCCCAGAACGATGG - Exonic
1085286271 11:75363756-75363778 CTGGAGGATTCCCAGGAGGTGGG - Intergenic
1086813265 11:91336406-91336428 CAGCAGTATTCACAGTAGCTTGG + Intergenic
1088540578 11:110909430-110909452 GAGGCGTATTCCCAGCCAGTGGG + Intergenic
1091975131 12:4818217-4818239 TAGGACTATTCCCAGTGGGAAGG - Intronic
1093460439 12:19402835-19402857 GAGCAGTATTCACAGTAGTCTGG - Intergenic
1096183751 12:49565371-49565393 GAGGTGTGTTCCCAGGAGGGGGG + Intronic
1097289928 12:57906168-57906190 GAGGAGTTTTCCAGGTAGGTGGG + Intergenic
1103939125 12:124492472-124492494 GAGGAGCTGTCCCAGGAGGTAGG + Intronic
1107308079 13:39044522-39044544 GTGGAGTTTTCCCAGTAAGAGGG - Intronic
1108075067 13:46671096-46671118 AAGGTGCATTCCCAGAAGGTAGG - Intronic
1108266057 13:48709812-48709834 GAAGAGAATTCCCAGGATGTTGG + Exonic
1125537580 15:40451020-40451042 CAGGAGTATCCCGAGTAGCTGGG - Intronic
1128949569 15:71862541-71862563 GAACAGTATTCACAGTATGTAGG + Exonic
1131438398 15:92440713-92440735 GAGGAATAGTCCCAGTGGGGTGG - Intronic
1131753874 15:95539467-95539489 AAGGAGTATTTCCAGCAGGGTGG - Intergenic
1137346118 16:47661744-47661766 GAGCAGTATACCCAGCAGGATGG - Exonic
1138365713 16:56474973-56474995 GTGGATTATTCCCCGTAGGAGGG + Intronic
1140917650 16:79508303-79508325 GGGGAGTGTTCGCAGGAGGTAGG + Intergenic
1142522001 17:511469-511491 GAGCAGCATTCCCAGGAGGCGGG + Exonic
1144776994 17:17789874-17789896 GAGGAGTGAGCCCAGTGGGTGGG + Intronic
1146503229 17:33382157-33382179 GAGAAATATTCTCAGCAGGTGGG + Intronic
1147648995 17:42051205-42051227 GAGGAGGCTTCCCACCAGGTGGG - Intronic
1148541762 17:48486490-48486512 GAGGAGGATCCCCAGAAAGTTGG - Intergenic
1148770463 17:50063254-50063276 GAGCAGAGTTCCCAGTGGGTGGG - Intronic
1151239407 17:72746106-72746128 GAGGAGTGTTCTCTGAAGGTGGG + Intronic
1162938709 19:13995334-13995356 GAGTAGCATTCCCAGTGGGAAGG + Intronic
1165973978 19:39658158-39658180 GAGGAGAATACTCAGTGGGTTGG + Intronic
1167663696 19:50811374-50811396 GAGGAGCATTCCCAGAAGTGAGG + Intergenic
1168554274 19:57325150-57325172 AAGTAGTATTCCAAGTAGGCAGG + Intronic
927249157 2:20982562-20982584 GAGGGGAATTCCCAGGAGTTTGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
929153832 2:38771911-38771933 TAGGAGTTTTACCAGTATGTGGG + Intronic
932373642 2:71214665-71214687 CAGGAGTATTCACACTAAGTGGG - Intronic
932585642 2:73026389-73026411 GAGGTGTAATCCCAGCAGTTTGG - Intronic
936489796 2:112960419-112960441 TGGCTGTATTCCCAGTAGGTGGG + Intergenic
948106701 2:235420196-235420218 GAGCTGTCTTCCCAGTAGGAAGG + Intergenic
1169340882 20:4795426-4795448 GAGGAGTGGTCCCAGTGGGGAGG + Intronic
1171441126 20:25163962-25163984 GAGCTGCATTCCCAGGAGGTGGG - Intergenic
1172892014 20:38272207-38272229 GAGGAGTATAACAAGTAGGTAGG - Intronic
1175402441 20:58708259-58708281 GAGGAGGAATCCCAGGAGGAAGG + Intronic
1175636037 20:60585139-60585161 GAGGAGTGTTCCCAGCAGGAGGG - Intergenic
1175968025 20:62669340-62669362 GAGGGGCAGTCCCAGGAGGTGGG - Intronic
1178456441 21:32757811-32757833 GAAGAGTTTTGCCAGTAGGAAGG + Intronic
1182112223 22:27731962-27731984 GTGGAATATTCACATTAGGTTGG - Intergenic
1184626886 22:45741622-45741644 AAGGACTATGCCCAGTAGGGGGG - Intronic
949221262 3:1636848-1636870 GAGTTGTATTCCCAGGAGGATGG + Intergenic
949911247 3:8910043-8910065 GAGCAGAATTCCCAGAAAGTTGG + Intronic
950647742 3:14387402-14387424 TATGACTATTCACAGTAGGTGGG + Intergenic
954515694 3:51174779-51174801 GAGAAGTATTCCCATTAGTCTGG - Intronic
955587323 3:60494635-60494657 AAGGAGTATTACCAGAAGCTGGG - Intronic
958269336 3:91479611-91479633 GAGAATTATTCACATTAGGTAGG - Intergenic
961699634 3:128732566-128732588 GAGGAGTAATCCCAGCACTTTGG + Intronic
962378000 3:134874786-134874808 GAGGAGCATTCCCAATGTGTGGG + Intronic
963511682 3:146255582-146255604 GAAGAGTAATCCCAGAAAGTAGG - Intergenic
966480622 3:180404414-180404436 GAGGAGTAATCCCAGTGGGAAGG + Intergenic
971520849 4:27548323-27548345 GAGGTTTATTCCCATTAGCTTGG - Intergenic
971607861 4:28681691-28681713 GAGGAGTATTACTGCTAGGTTGG - Intergenic
976897241 4:90127544-90127566 GAGGCGGATTGGCAGTAGGTCGG - Intronic
977081319 4:92532215-92532237 AATGAGTTTTCACAGTAGGTAGG - Intronic
990764587 5:59168255-59168277 GATTAATATTCCCAGTAGTTGGG + Intronic
990981297 5:61604643-61604665 GTGGAGCCTTCCCAGTTGGTGGG + Intergenic
995979465 5:118083845-118083867 GAGGAGTGTTCCCAAAAGGCTGG - Intergenic
1001076101 5:168629122-168629144 GAGGAATATTCCCAGTCTCTGGG - Intergenic
1001723879 5:173880308-173880330 GAGGAGCAACTCCAGTAGGTAGG + Intergenic
1002679103 5:180947548-180947570 GCAGAGTATTCCCAGTACTTTGG - Exonic
1008985823 6:57541810-57541832 GAGAATTATTCACATTAGGTAGG + Intronic
1009173851 6:60434680-60434702 GAGAATTATTCACATTAGGTAGG + Intergenic
1015565556 6:134566962-134566984 GAGGTTTATTCCCTGCAGGTGGG + Intergenic
1018993533 6:168692884-168692906 TTGGAGTATGTCCAGTAGGTCGG - Intergenic
1023335246 7:39162259-39162281 GAGGAATATTTACAGTAGTTAGG + Intronic
1024211894 7:47213196-47213218 CAGGAGTAATCCCAGTGGGGAGG - Intergenic
1032015877 7:128380233-128380255 GAGGAGTCTTACCAGTGGCTGGG + Intergenic
1036521654 8:9497265-9497287 GAGAAGTATTTCCAGTGGGTTGG + Intergenic
1037534295 8:19810539-19810561 GGGAAATATTTCCAGTAGGTAGG + Intergenic
1041189504 8:55339295-55339317 GAGGAGTCTTCACTGTAGGGGGG - Intronic
1041808216 8:61877891-61877913 GATGAAAATTCCCAGGAGGTAGG + Intergenic
1044436400 8:92168912-92168934 GAGGTATTTTCCCAGTAGGCTGG - Intergenic
1049706467 8:144045475-144045497 GAAGAGTATTCCCTGCAGGTTGG + Intronic
1053588936 9:39490600-39490622 GAGGAGGATGCCCAGTAAGGGGG + Intergenic
1054577366 9:66874695-66874717 GAGGAGGATGCCCAGTAAGGGGG - Intronic
1057281074 9:93712046-93712068 GAGGTGTAATCCCAGTACTTTGG + Intergenic
1057313785 9:93956691-93956713 GAGAAGTGTCCCCAGGAGGTTGG + Intergenic
1058815347 9:108677965-108677987 GAGGAGTGTTCCCATCAGGATGG + Intergenic
1061943010 9:133893147-133893169 GAGGAGTCTTCGCGGGAGGTGGG - Intronic
1187272110 X:17788657-17788679 GTGGTTTCTTCCCAGTAGGTGGG + Intergenic
1189550287 X:42085617-42085639 GAGGAGTATATCAAGTAGGAAGG + Intergenic
1193334033 X:80266221-80266243 GAGAACTTTACCCAGTAGGTGGG + Intergenic
1201569035 Y:15394848-15394870 GAGGAGTCTACCCAGGAGATGGG - Intergenic