ID: 902190446

View in Genome Browser
Species Human (GRCh38)
Location 1:14759191-14759213
Sequence TGGCACAGCCAGGCTGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902190446_902190450 12 Left 902190446 1:14759191-14759213 CCTATCTCAGCCTGGCTGTGCCA 0: 1
1: 0
2: 0
3: 24
4: 271
Right 902190450 1:14759226-14759248 TCTTGTTCTGATAATTGATGTGG 0: 1
1: 0
2: 3
3: 17
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902190446 Original CRISPR TGGCACAGCCAGGCTGAGAT AGG (reversed) Intronic
900308710 1:2023352-2023374 TGGCACAGTCAAGCTGAGGCCGG - Intronic
902190446 1:14759191-14759213 TGGCACAGCCAGGCTGAGATAGG - Intronic
902436441 1:16400911-16400933 AAACACAGCCAGGCTGAGATGGG - Intronic
902653563 1:17852501-17852523 ACGGACAGCCAGGCTCAGATGGG + Intergenic
903342994 1:22666194-22666216 TGATTCAGCCAGACTGAGATGGG - Intergenic
903375404 1:22862771-22862793 TGACACAGCCAAGCTGGGATAGG + Intronic
904614188 1:31741240-31741262 AGGCACAGCCAGGCAGAAGTGGG + Intronic
905239139 1:36571237-36571259 GGGGACAGCTGGGCTGAGATGGG - Intergenic
905649724 1:39648051-39648073 AGGCAGAGCCTGGGTGAGATGGG + Intergenic
905859781 1:41342480-41342502 TTACACAGCCAGGATGAGCTGGG - Intergenic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906056802 1:42924322-42924344 TGGAACCGCCAGGGTGTGATTGG + Intergenic
906690873 1:47791969-47791991 TCCCACAGCCAGGATGAGGTGGG + Intronic
908141686 1:61191656-61191678 TGGCATCACCAGGCTGAGAAGGG - Intronic
908948729 1:69533107-69533129 TGTCAAATCCAGGGTGAGATAGG - Intergenic
910693429 1:89987843-89987865 TGGCAGAGCCAGGAAGAAATGGG + Intergenic
912028241 1:105205663-105205685 TGCCACATCCAGGCTGCCATTGG - Intergenic
912949549 1:114111393-114111415 TGGCACAGCCAGGATGTGGACGG + Intronic
913046882 1:115081330-115081352 TGGCAGAGCAAGGCTGAGCAGGG - Intronic
916265054 1:162882302-162882324 TGAGACAGCCAGGCTGAGAGAGG + Intergenic
918440422 1:184561163-184561185 TGGCACTGGCAGGCTTAGGTTGG - Intronic
919074504 1:192797409-192797431 TGGCAAGGCCAGGCTGGGCTGGG - Intergenic
1062818952 10:519647-519669 TGCCACAGCCAGGCTGAGTCAGG + Intronic
1062986908 10:1777444-1777466 TGGAAAAGGCAGGCTGAGATAGG + Intergenic
1063019835 10:2116804-2116826 TGGCAAAGCCAGGTTGATGTTGG - Intergenic
1063688242 10:8258786-8258808 TGCCACAGACAGGCAGAGACAGG + Intergenic
1064413806 10:15131395-15131417 TAGCACTGGGAGGCTGAGATGGG - Intronic
1065539680 10:26750245-26750267 CAGCACAGGGAGGCTGAGATGGG + Intronic
1069534387 10:69242135-69242157 TGGGAAAGCCAGGCTGAGGAGGG - Intronic
1069715079 10:70515430-70515452 GGGCAGAGCCAGGCTGGGCTGGG - Intronic
1069824250 10:71245636-71245658 TGGCACGGCGAGGCTGGCATGGG - Intronic
1070951308 10:80433460-80433482 TGGCCCAGCCAGGAGGAGAAAGG + Exonic
1074602787 10:114932187-114932209 TAGTGCAGCCAGCCTGAGATTGG + Intergenic
1076414057 10:130272343-130272365 GGGCACAGTGAGGCTGAGACAGG - Intergenic
1076682569 10:132181404-132181426 TGACACTTCCAGGCTGAGAAGGG - Intronic
1077473357 11:2775154-2775176 TGGAGCAGCCAGGCTGAGCAGGG - Intronic
1077501226 11:2910579-2910601 TGGCACAGCAGGGGTGAGAATGG + Intronic
1077587054 11:3461956-3461978 TGACACAGCCTGGGTGAGGTGGG + Intergenic
1077864205 11:6209953-6209975 TGGCAAAGCCAGGCGGGTATGGG - Exonic
1078409592 11:11102739-11102761 TCTCCCAGCCAGGCTGAGAGAGG - Intergenic
1079333656 11:19553035-19553057 TTACACAGCCATGCTGAGACTGG - Intronic
1082081793 11:48017977-48017999 TGGCTCTGCCAGGCTGGGTTGGG + Intronic
1083256212 11:61496816-61496838 TGGGAGAGCCAGGCAGTGATAGG + Intergenic
1083935759 11:65869189-65869211 TCATACAGCCAGGATGAGATGGG - Intronic
1084243051 11:67835968-67835990 TGACACAGCCTGGGTGAGGTGGG + Intergenic
1084615847 11:70235325-70235347 GGACACAGCCAGGCTTGGATGGG - Intergenic
1084829940 11:71760974-71760996 TGACACAGCCTGGGTGAGGTGGG - Intergenic
1085793027 11:79512447-79512469 TGGCACACCCAGGCTGGGCCTGG + Intergenic
1085809715 11:79668902-79668924 TGGCACAGCATGGCAGAGCTGGG - Intergenic
1089074677 11:115728684-115728706 AGGCACAGGGAGGCTGAGCTAGG + Intergenic
1089163179 11:116455257-116455279 TTTCACAGCCAGGCTGACCTTGG - Intergenic
1089531174 11:119130850-119130872 TTGCAAAGCCAGGCTGACCTTGG + Exonic
1089581955 11:119486962-119486984 TGGCACAGAGAGCCAGAGATGGG + Intergenic
1090331449 11:125935619-125935641 TGGGCCAGCCAGGAGGAGATGGG - Intergenic
1091188764 11:133671649-133671671 TGGCACACCCAGGGTTCGATGGG - Intergenic
1092413295 12:8270703-8270725 TGACACAGCCTGGGTGAGGTGGG + Intergenic
1092800353 12:12158896-12158918 TGGCACAGCCAAGCAGAGGTGGG + Exonic
1095788079 12:46132679-46132701 TTGCAGAGCCAGGATGTGATTGG + Intergenic
1095982505 12:47981309-47981331 GGGCAGAGCCAGGCTCAGAGGGG + Intronic
1096615431 12:52830316-52830338 AGGCAGAGCCAGGCTGAGCCTGG - Intronic
1100713305 12:97280181-97280203 TGGCTCAACCAGGCAGAAATAGG + Intergenic
1101317995 12:103646968-103646990 TGGGACAAACAGGCTGAGAAAGG + Intronic
1102454828 12:113065020-113065042 TGGCAGAGGGAGGCTGTGATGGG + Intronic
1102680243 12:114686001-114686023 TGGGCCAACCACGCTGAGATAGG + Intergenic
1104706569 12:130951826-130951848 GGGCAGAGCCAGGCTGGGTTTGG + Intergenic
1104953072 12:132451129-132451151 CAGCACAGCCAGGAAGAGATGGG - Intergenic
1106102205 13:26704565-26704587 GAGCAGAGCCGGGCTGAGATAGG + Intergenic
1107143095 13:37025343-37025365 TGGCTCAGCCAGTCTGAGTCAGG - Exonic
1108592413 13:51923453-51923475 TGCCACACCCACACTGAGATCGG + Intergenic
1112420025 13:99240067-99240089 AGGCAAACCCAGGCTTAGATTGG + Intronic
1112562524 13:100526828-100526850 AGGGGCAGCCAGGCTGAGCTGGG - Intronic
1113567368 13:111327004-111327026 CTGCACAGCCAGGCTCAGAGGGG - Intronic
1114587864 14:23831306-23831328 TGGAACAGCAAGTATGAGATGGG + Intergenic
1114649395 14:24274455-24274477 TGGCACAGAGAGGCTGAGCCAGG + Intergenic
1117278180 14:54210736-54210758 TGAGACAGGCAGGCTGATATGGG - Intergenic
1118167758 14:63354998-63355020 TGCCCCAGTCAGGCTGACATGGG + Intergenic
1119647171 14:76356240-76356262 AGACACAGCCAGGCAGAGAAAGG - Intronic
1120407891 14:84112481-84112503 TGTCACAGCAAGACTGTGATTGG + Intergenic
1121509497 14:94501730-94501752 TGACACAGGCATGCTGAGGTGGG - Intronic
1122607138 14:102954307-102954329 TGTCTCAGCCATGCTGAGCTGGG - Intronic
1122816418 14:104316304-104316326 TGTGACAGCCAGGCTGGGACTGG - Intergenic
1123026641 14:105427424-105427446 GGACACAGGCAGGCTGGGATGGG + Intronic
1123043463 14:105499941-105499963 AGGCCCAGACAGGCTGAGACTGG - Intergenic
1124046710 15:26157212-26157234 TGGCACAGTCTGGATGAGAGTGG - Intergenic
1124581572 15:30960279-30960301 CAGCCCAGCCAGCCTGAGATGGG + Intronic
1124997286 15:34736067-34736089 TAGAACAACCAGGCTGAGTTTGG - Intergenic
1126701038 15:51367764-51367786 TGGGTCAGCCAGGCTGACACTGG - Intronic
1127187339 15:56493211-56493233 TGGCAGAGTCAGGCAGAGACAGG - Intergenic
1127913081 15:63434499-63434521 TGGGACTGCCAAGCTGAGAATGG - Intergenic
1128172586 15:65525991-65526013 TGGCAGTGCCAAGCTGAAATAGG - Intergenic
1129180208 15:73869459-73869481 TGGCAAAGCTAGGCAGAGCTAGG + Intergenic
1129949229 15:79571429-79571451 TGGGACATCCAGGTGGAGATGGG - Intergenic
1130163038 15:81421183-81421205 TGCTACAGCCATGCTGAGTTTGG + Intergenic
1130730218 15:86484102-86484124 TTGCACTGGCAGGCTGTGATTGG - Intronic
1131376270 15:91926518-91926540 TGGCAAAGCCACGCTGGGAATGG - Intronic
1131407045 15:92173625-92173647 TAACACAGCCAGGCTGAAAAAGG - Intergenic
1132460858 16:53878-53900 GGGCAGAGCCCGGCTGAGAGGGG + Exonic
1132467191 16:82783-82805 GGCCACAGCCAGGCTGGGCTGGG - Intronic
1133001486 16:2853697-2853719 TGGCTGAGCCAGGCTGAGGCTGG + Intronic
1133068914 16:3232686-3232708 CAGGACAGCCAGGCTGAGAAGGG + Intronic
1133267581 16:4594207-4594229 TGGCACAGCCAGGCAGGCCTGGG - Intronic
1133354506 16:5126208-5126230 TGACACAGCCTGGGTGAGGTGGG + Intergenic
1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG + Intronic
1137744667 16:50812068-50812090 TGGGACTGGGAGGCTGAGATGGG - Intergenic
1138604938 16:58082582-58082604 GGGCACAGACAGGAAGAGATTGG - Intergenic
1138919047 16:61504197-61504219 AGGAACAGCGAGGCTGAGGTTGG + Intergenic
1139255447 16:65536762-65536784 TTGCACAACCTGGATGAGATTGG - Intergenic
1141471637 16:84242652-84242674 TGGCACTGCCAGGCTCAGTGTGG + Intergenic
1142714995 17:1742472-1742494 TGGTTCAGCCAGGCTCAGAGAGG - Intergenic
1144719875 17:17461903-17461925 GGGCCCTGCCAGGCTGAGAAAGG - Intergenic
1147600723 17:41743699-41743721 GGGCAAAGCCAGGCAGAGGTAGG + Intergenic
1147761717 17:42802118-42802140 TTCAACAGCGAGGCTGAGATGGG + Intronic
1148214065 17:45824932-45824954 TGGCAGAGCCAGGCACGGATGGG - Intronic
1149470300 17:56910838-56910860 TGGCAGAGCCAGTCTCAGCTGGG - Intronic
1151697317 17:75724216-75724238 TGGCACAGCCGGGAGGAGAGGGG - Intronic
1152121598 17:78422230-78422252 TGGCCCAGCCAGGCTGGGGGAGG + Intronic
1152380896 17:79941842-79941864 TGACACAGCCAGGCCGAGACAGG + Intronic
1152569099 17:81113628-81113650 TGCCCCCGTCAGGCTGAGATTGG + Intronic
1152571498 17:81123149-81123171 CCGGACAGCCAGGCCGAGATGGG - Intronic
1154249994 18:12736470-12736492 TGGAACAGCCAGGCTGGCTTAGG - Intergenic
1155364703 18:25038403-25038425 CGGCACAGACAGGAGGAGATGGG + Intergenic
1160340942 18:78088175-78088197 AGGCAGAGCCCGGCTGTGATCGG + Intergenic
1160681103 19:412039-412061 TGGCCAAGCCAGGCTGTGGTGGG - Intergenic
1160816450 19:1038154-1038176 TGGCACATTCAGGCTGTGCTGGG + Exonic
1161313489 19:3607373-3607395 CGACACAGCCAGACTGAGAAAGG + Intergenic
1162725627 19:12688450-12688472 TGGCTGAGCTGGGCTGAGATGGG + Intronic
1163847793 19:19647065-19647087 TGCCAGGGCCAGGCTGATATAGG - Intronic
1165118781 19:33545788-33545810 TGGCAGAGCCAGGCTGGCATGGG + Intergenic
1165146944 19:33736829-33736851 TGTCACTGCCATTCTGAGATAGG + Intronic
925035266 2:680205-680227 AGCCACAGCCAGGCTGACATGGG + Intergenic
925612482 2:5713371-5713393 TGGCTCAGCCAGTTTGAGTTGGG + Intergenic
925743500 2:7026017-7026039 TGGCACACAATGGCTGAGATGGG + Intronic
926196460 2:10766285-10766307 TGGCAGAGCGAGGCTGAGGCGGG - Intronic
927468941 2:23357822-23357844 TGGCCCAGCCAGGCACAGCTGGG + Intergenic
928907334 2:36381409-36381431 TGGCAGAGCCAGGCTCAGGAAGG + Intronic
929503602 2:42510784-42510806 TGGGAGAGCCAGGCAGAGAGAGG + Intronic
929747754 2:44676591-44676613 AGGCACAGCAAGGCTGGAATGGG - Intronic
929779810 2:44950129-44950151 AGGAACAGCCAGGCTGACAGAGG + Intergenic
929921100 2:46172178-46172200 CTGCAAAGCCAGGCTGAGCTGGG + Intronic
931212732 2:60213320-60213342 TGGCACAGCAAGGAGGAGAGTGG - Intergenic
931818754 2:65930762-65930784 TGGCACAGCCAGGCAGACAGGGG + Intergenic
932218649 2:69983534-69983556 GGGCCCAGCTAGGCTGAGCTGGG + Intergenic
932331956 2:70902784-70902806 ATCCACAGCCAGGCAGAGATGGG + Intronic
932459039 2:71870624-71870646 AGGCACAGCCTGGCTGGGGTGGG + Intergenic
932685250 2:73863682-73863704 TGGAACAGCCAGGCTGCTCTGGG - Exonic
934709490 2:96505581-96505603 ATGCACAGCCAGCTTGAGATTGG - Intronic
937139836 2:119590548-119590570 TGGCTGAGCCCAGCTGAGATGGG - Intronic
937234856 2:120424658-120424680 GGGCACAGCCACCCTGAGGTGGG + Intergenic
938139629 2:128784947-128784969 TGGCACAGCCAGTCTCACGTAGG + Intergenic
943506785 2:188770498-188770520 TGCCACAGCCACGTTGAGAAAGG + Intronic
946382928 2:219361206-219361228 TGGAGCATCCAGGCTGAGCTAGG - Intergenic
946399793 2:219462191-219462213 TTCCACAGCCAGGCTGAGACTGG - Intronic
947076513 2:226351067-226351089 TGGCAACCCCAGGCTGAGAATGG - Intergenic
947402884 2:229746331-229746353 AGGCAGAGGCAGGCTGGGATCGG + Intergenic
947835132 2:233169836-233169858 TGGCACAGCCAGGATGCAAAGGG - Intronic
948191469 2:236062385-236062407 AGGCAGAGCCAGGCTGGTATGGG + Intronic
948792404 2:240385787-240385809 TGGCTAAGCTAGGCTGAGCTGGG + Intergenic
949065453 2:241987591-241987613 CGGAACAGCCAGGCTGCGCTGGG + Intergenic
1169880615 20:10342338-10342360 GTGCACAGCCAGGCTGTGGTGGG - Intergenic
1170314814 20:15031070-15031092 GTGCACAGCCAGGCTGTGGTGGG + Intronic
1171431387 20:25085006-25085028 TGGCAGCGCCAGGCTGAGGTTGG + Intergenic
1171488146 20:25498430-25498452 TGGGACAGCCATGCTGGGCTAGG - Intronic
1172119948 20:32592384-32592406 TGGCCCAGCCAGCCTGAGTGGGG - Intronic
1172390515 20:34562020-34562042 TGGGACAGACAGACTGAGCTGGG - Intronic
1172590369 20:36113505-36113527 TGGCTGAGCCAGGCTGGGACAGG + Intronic
1172613244 20:36266897-36266919 AGACACAGACAGGCTGAGGTAGG - Intronic
1172811608 20:37652059-37652081 TGGCACCGCCACCCTGAGACAGG - Intergenic
1174764643 20:53241315-53241337 TGGAACAGCGAGTCTGAGCTGGG - Intronic
1174779827 20:53378956-53378978 TTGAACAGCCAGGATGGGATAGG - Intronic
1175922245 20:62455708-62455730 TGGTCCTGCCAGCCTGAGATGGG - Intergenic
1176103222 20:63373927-63373949 AGGCACAGCCAGGGTGGGCTCGG + Intronic
1178838374 21:36117827-36117849 TGGCACAGGAAGGCTGGGATGGG - Intergenic
1179166182 21:38937024-38937046 TGGGAGAGTCAGGCTGACATGGG - Intergenic
1179284611 21:39966770-39966792 TGCCACAGCCTGGGTGGGATTGG + Intergenic
1179716462 21:43291180-43291202 TGGCACAGTGAGGCTGAGCCAGG - Intergenic
1180020417 21:45121450-45121472 GGGGACAGTCAGGCTGAGAGCGG - Intronic
1181503890 22:23337913-23337935 TGACACAGACAGGCTGGCATAGG + Intergenic
1181604019 22:23969209-23969231 TGGGACAGCCTGGCTGAGGGCGG - Intronic
1181654727 22:24287448-24287470 TGACACAGACAGGCTGGCATAGG + Intronic
1181708879 22:24668133-24668155 TGACACAGACAGGCTGGCATAGG + Intergenic
1181770273 22:25120146-25120168 TGGCACAGGCAGTGGGAGATGGG - Intronic
1182420293 22:30245601-30245623 GGGGACAGCCAGGCAGAAATGGG - Intronic
1183651151 22:39153676-39153698 TGGCACTGTGTGGCTGAGATCGG - Intergenic
1184116114 22:42423310-42423332 TGCCCCTCCCAGGCTGAGATGGG - Intronic
1184258783 22:43302633-43302655 TGACAGAGCCAGGCTGGGAACGG + Intronic
1184806012 22:46795344-46795366 GGGCACTGTCAGGCTGAGAGTGG + Intronic
1184980027 22:48089459-48089481 TGGAGCAGCCAGGCTGACGTGGG + Intergenic
1185332494 22:50258029-50258051 TGGCACAGCTGGGCAGAGCTGGG - Intronic
950455558 3:13090858-13090880 AGGCACAGACAGGCTGAGAATGG + Intergenic
950525288 3:13519505-13519527 AGAGGCAGCCAGGCTGAGATTGG + Intergenic
952903910 3:38127361-38127383 GGGCTCAGGCAGGCTAAGATTGG - Intronic
954611982 3:51949370-51949392 TGGCACAGACAGGCAGAGGCTGG - Intergenic
954755500 3:52837177-52837199 TTTCGCAGCCAGGCTAAGATAGG - Exonic
955954273 3:64272484-64272506 TGGCACAGCCCGGCAATGATTGG - Intronic
956738295 3:72255751-72255773 TGCCACAGCAAGGCTGAGCCTGG - Intergenic
956839691 3:73126464-73126486 TGGCACAGCAACTCTGAGGTTGG - Intergenic
957058395 3:75461893-75461915 TGACACAGCCTGGGTGAGGTGGG + Intergenic
960953261 3:123013188-123013210 TGACTGAGCCAGGCTGAGATAGG - Intronic
961654681 3:128434750-128434772 TCACACAGCTGGGCTGAGATTGG - Intergenic
961663841 3:128484356-128484378 GGGCCCAGCCAGGTTGAGCTGGG - Intronic
961890852 3:130129355-130129377 TGACACAGCCTGGGTGAGGTAGG + Intergenic
962795597 3:138847088-138847110 AGTCACAGACAGGATGAGATAGG + Intergenic
964435146 3:156643548-156643570 TAGCACAGCGAGGCTGAGTGTGG + Intergenic
964588810 3:158337719-158337741 AGGTGCAGCCAGGATGAGATAGG - Intronic
964767575 3:160193571-160193593 GGTCAGAGCCAGGATGAGATGGG + Intergenic
965901440 3:173645561-173645583 ATGCACAGTCAGGCCGAGATGGG + Intronic
968624491 4:1620880-1620902 TGGCCATGCCAGGCTGGGATCGG + Intronic
968947628 4:3673912-3673934 TGCCACATCCAGGCTTGGATGGG - Intergenic
969002242 4:3991773-3991795 TGACACAGCCTGGGTGAGGTGGG + Intergenic
969720460 4:8890649-8890671 GGGCACAGCCAGGCAGAGACTGG - Intergenic
969732401 4:8964626-8964648 TGGCAAAGGCAGGCAGATATGGG - Intergenic
969751768 4:9116741-9116763 TGACACAGCCTGGGTGAGGTGGG - Intergenic
969811680 4:9653039-9653061 TGACACAGCCTGGGTGAGGTGGG - Intergenic
973673597 4:53241432-53241454 AGGCACAGCCAGGCTGGGAGAGG - Intronic
973936711 4:55853768-55853790 CGGCACAGCCAGGCTCAGTCCGG + Exonic
976092153 4:81470444-81470466 TGGCACAGTCACACTCAGATGGG - Intronic
978132025 4:105210379-105210401 TGGAGAAGCCAGCCTGAGATTGG - Intronic
978549652 4:109911724-109911746 TGGCAGAGGCTGGCTGAAATAGG + Intergenic
980730071 4:136812621-136812643 CGGCACAGTCAGGCAGAGGTGGG - Intergenic
981785706 4:148477237-148477259 TGGCACAGCTAGGAAGAGAATGG - Intergenic
984360136 4:178719392-178719414 TAGCACAGCCAGGCAGAGAAAGG + Intergenic
984623389 4:181978290-181978312 TGGCAGAACCAGGATGAGAAGGG + Intergenic
985826221 5:2193464-2193486 TGGCACTGCCAGGCTGCGGATGG + Intergenic
986003415 5:3648271-3648293 GTCCACAGCCAAGCTGAGATGGG - Intergenic
986422478 5:7598834-7598856 TGGGAGACCCAGGCTGACATGGG - Intronic
991114579 5:62939246-62939268 TGGCACAGCTGCCCTGAGATAGG - Intergenic
991336526 5:65554251-65554273 TGGCTAAGACAGGCTGAGACAGG - Intronic
991943516 5:71877796-71877818 TGGCACAGAGAGGGTGAGACAGG + Intergenic
993892965 5:93496640-93496662 TGGCAAAGCCAGGAAGACATTGG - Intergenic
994292525 5:98045613-98045635 AGGCACAGCAAGCCTGAGACTGG - Intergenic
997381761 5:133443566-133443588 AGACACACCCAGGCTCAGATTGG - Intronic
1000180994 5:158811135-158811157 TGGCACAGGGAGTTTGAGATGGG + Intronic
1000379691 5:160617650-160617672 TGGCAAAGCCACACTGATATGGG + Intronic
1001140530 5:169140132-169140154 TGGCACAGGCAGCTGGAGATGGG + Intronic
1001406766 5:171482219-171482241 TTTCACACCCAGGCTGAGCTGGG - Intergenic
1001745684 5:174090611-174090633 TCACACAGCCAGCCTGAGATTGG - Intronic
1001942703 5:175751807-175751829 AGGTACAGCCTGCCTGAGATGGG + Intergenic
1002174882 5:177396316-177396338 TGACGGAGCCAGGCTGAGAAAGG + Intronic
1004404835 6:15323345-15323367 TAGCACACCCAGGCTGGGCTAGG - Intronic
1007335235 6:41150781-41150803 TGGTAGGGCCAGGCTGAGATAGG + Intronic
1009561548 6:65251848-65251870 TGGCACAGGGAGGCTGGGATGGG - Intronic
1010840276 6:80641691-80641713 TGGCACAGGCAGGCTCTGAATGG + Intergenic
1015079041 6:129201237-129201259 TGGCAAGGCCAGGCTGTGTTTGG - Intronic
1015241613 6:131030233-131030255 CGACATGGCCAGGCTGAGATGGG + Intronic
1015480081 6:133699073-133699095 TGGCCCAAGCAGGCTAAGATGGG + Intergenic
1015736814 6:136409651-136409673 TGGCAAAGCCAGGCTGGTTTAGG + Intronic
1016428418 6:143958057-143958079 TGGTGCAGCCTGGCTGGGATGGG + Intronic
1017247434 6:152241562-152241584 TGCCACAGCCAAGCTCAGGTTGG - Intronic
1018611775 6:165654294-165654316 TGGCCCAGCCTTGCTGAGACTGG - Intronic
1019369750 7:655470-655492 TGGAAAAGCCATGCTGAGAAGGG - Intronic
1022304212 7:29131272-29131294 TGGCAAATACAGGCTAAGATTGG + Intronic
1022537342 7:31106398-31106420 TGGCACTGCCAGCCTGGGAAGGG + Intronic
1024048011 7:45598228-45598250 TGGCAGAGCCAGGGTGAGCCCGG + Intronic
1024216536 7:47253846-47253868 TGGCCCTGCCACGCTAAGATAGG + Intergenic
1024330257 7:48148006-48148028 TGGCTCACCAAGGCTGAGGTGGG + Intergenic
1024612911 7:51082467-51082489 TGGCACACCCTGTTTGAGATGGG - Intronic
1029957329 7:104653403-104653425 TGGAACAGCGAGGCAGAGAGAGG + Intronic
1032450995 7:132030928-132030950 TGGAGCAGCCAGGCTGTGCTAGG + Intergenic
1033682601 7:143609851-143609873 TGGCACAGGCATGATGATATTGG + Intergenic
1033702292 7:143852066-143852088 TGGCACAGGCATGATGATATTGG - Exonic
1034083636 7:148303366-148303388 TGACATAGCCAGGCAGAGACGGG + Intronic
1034396327 7:150828090-150828112 TGGCCCAGCCAGACTGATTTTGG - Intronic
1035758255 8:2050229-2050251 TGGGACTGCCAGGCGGAGGTGGG - Intronic
1036374977 8:8192171-8192193 TGACACAGCCTGGGTGAGGTGGG - Intergenic
1036854566 8:12230980-12231002 TGACACAGCCTGGGTGAGGTGGG + Intergenic
1036875925 8:12473473-12473495 TGACACAGCCTGGGTGAGGTGGG + Intergenic
1041377917 8:57221220-57221242 TGGCACCGGCAGGCTGCGAATGG + Intergenic
1042742234 8:72062862-72062884 TTGCACAGCCAGGTGGAGAGGGG + Exonic
1043973529 8:86559979-86560001 TGCCAAGGCCAGGCTGAGAGGGG + Exonic
1047830681 8:128626562-128626584 CTTCACAGCCAGGCTGAGCTAGG - Intergenic
1048501148 8:134976276-134976298 TGACACTGGCAGGCTGAGAGGGG + Intergenic
1048984646 8:139728715-139728737 TGGCAGAGCCAGGCTGTATTTGG + Intergenic
1049423696 8:142527958-142527980 TGGCACACACAGGGTGAGGTGGG - Intronic
1051784629 9:20729008-20729030 TGAGGCAGCCAGACTGAGATTGG + Intronic
1053294886 9:36905680-36905702 TGGATCAACCAGGCTGAGAAAGG + Intronic
1055792047 9:79933022-79933044 AGGCCCAGGCAGGCTCAGATGGG - Intergenic
1056658662 9:88529053-88529075 TGGCTCAGGCAGGCTGAGCACGG + Intergenic
1057856083 9:98601828-98601850 GGGCACTGCCAGGCTGAGCCTGG + Intronic
1059734732 9:117089823-117089845 TGCCACAACCTGGATGAGATTGG - Intronic
1060472794 9:123962571-123962593 TGGGCCTGCCAGGCTGAGGTGGG - Intergenic
1061215454 9:129219126-129219148 AGGCACAGACAGGCTGAGTGTGG + Intergenic
1061964207 9:134004070-134004092 TGGCACATCCAGGATGGGAGAGG + Intergenic
1062716001 9:138010379-138010401 TGGCACAGCTGTGCTGGGATAGG - Intronic
1185633152 X:1531450-1531472 GGGCACAGTCAGGCTGGGAGGGG - Intronic
1186160890 X:6776017-6776039 TGGCACAGCCACCGTGAGAAAGG - Intergenic
1186434265 X:9529511-9529533 TGGCACAGCCAGGTAGAGACTGG + Intronic
1186998528 X:15150082-15150104 TCACAGAGCCAGGCTGAGAAGGG - Intergenic
1187480097 X:19647691-19647713 TGGCAGGAACAGGCTGAGATGGG - Intronic
1187537086 X:20151749-20151771 TATCAAAGCCATGCTGAGATGGG + Exonic
1187908262 X:24087259-24087281 TGGCACAGCCTGGCTGGGCATGG - Intergenic
1188193238 X:27197389-27197411 TGGCTCTGCCAAGCTGAGATGGG - Intergenic
1188514911 X:30974846-30974868 TGGCTCAGCCAGGCATAGATGGG - Intronic
1190817436 X:53940412-53940434 TGGTACTGTCAGACTGAGATTGG + Exonic
1192192437 X:68999569-68999591 TGAGTCAGCCAGGCTGAGAGAGG - Intergenic
1193190026 X:78559903-78559925 TTGCACAGTCAGGATGATATTGG + Intergenic
1196022777 X:111007569-111007591 TGCCACAGCCAGCATGAAATGGG - Intronic