ID: 902193091

View in Genome Browser
Species Human (GRCh38)
Location 1:14777487-14777509
Sequence GGTCGCATGGGGCATAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902193091_902193097 -9 Left 902193091 1:14777487-14777509 CCAATTCTATGCCCCATGCGACC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 902193097 1:14777501-14777523 CATGCGACCCCCACAGGGCCCGG 0: 1
1: 0
2: 2
3: 15
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902193091 Original CRISPR GGTCGCATGGGGCATAGAAT TGG (reversed) Intronic
901531956 1:9859281-9859303 GCTGGCATTGGGCATAGGATGGG - Intronic
902193091 1:14777487-14777509 GGTCGCATGGGGCATAGAATTGG - Intronic
910709100 1:90160179-90160201 AGTCACTTGGGGCATAGAACAGG + Intergenic
911608133 1:99931801-99931823 GGTTGCCTGGGGATTAGAATGGG + Intergenic
916378136 1:164178434-164178456 GGTCCCTAGGGGAATAGAATGGG - Intergenic
916882752 1:169036169-169036191 GGTAGAATTGGGAATAGAATGGG - Intergenic
918585982 1:186188780-186188802 GGTCTGATGGGACATGGAATAGG + Intronic
920832567 1:209478852-209478874 GGTAGGATGGGGCAGAGAACAGG - Intergenic
1064179130 10:13100005-13100027 GGTCGGGTGGGGTATGGAATGGG + Intronic
1068009536 10:51430915-51430937 GGTTGCCTCGGGCAGAGAATGGG + Intronic
1071696063 10:87872932-87872954 GGTGGAATGGAGCATAGATTTGG + Intronic
1075564454 10:123493420-123493442 GCTTGCATGAGTCATAGAATTGG + Intergenic
1077343621 11:2036761-2036783 GGTCTCAGGGGGCCTAGGATTGG + Intergenic
1077649696 11:3959020-3959042 AATAGCATGGGGCCTAGAATGGG - Intronic
1078437026 11:11333850-11333872 TGTTGAATGGGGCACAGAATTGG + Intronic
1079004693 11:16783436-16783458 GGTCACTTGGGACACAGAATTGG + Intronic
1079315329 11:19403363-19403385 GATGGCAAGGGGCATAGAACCGG + Intronic
1079405333 11:20140324-20140346 GGAGACATGGGGCACAGAATGGG + Intergenic
1090039399 11:123276811-123276833 TGGAGCATGGGGCACAGAATGGG + Intergenic
1202826607 11_KI270721v1_random:91950-91972 GGTCTCAGGGGGCCTAGGATTGG + Intergenic
1091806746 12:3362334-3362356 CCTCGCATGGGGCTTAGAAAAGG + Intergenic
1097079093 12:56416547-56416569 GTTGGCATGGGGCATAGAAAAGG - Exonic
1101438119 12:104681417-104681439 GGTTGCATAGGGCTTAGAAAGGG + Intronic
1112585025 13:100711482-100711504 TGTCCCATTGTGCATAGAATAGG + Intergenic
1112609833 13:100945569-100945591 GGTCAGATGGGGGATAGATTGGG - Intergenic
1121498212 14:94412479-94412501 GGTTGCAGGGGGCATACAAGGGG - Intergenic
1121630751 14:95420291-95420313 GGTCTCATGGGTCAGAGATTTGG - Intronic
1121672086 14:95718147-95718169 GGTAGCATGGGGGTTAGTATAGG - Intergenic
1124864012 15:33471495-33471517 GGGCGCCTGGGGGATAGAAAGGG + Intronic
1128137840 15:65277150-65277172 GGTCACATGAGGAATAGCATTGG - Intronic
1137624247 16:49897627-49897649 GGTGGCATGGGGCGAAGAGTGGG - Intergenic
1138190076 16:55007601-55007623 GGACCCATGGGGCAGAGAAGGGG + Intergenic
1146566506 17:33917510-33917532 GGTAGCAAGGGGAAGAGAATGGG - Intronic
1147765405 17:42832344-42832366 GGTCCCATGGGGCATAATATTGG - Intronic
1151239990 17:72750120-72750142 GCTCCCAAGGGGCACAGAATGGG - Intronic
1157319697 18:46624523-46624545 GGTAGCATGGGGGAAAGAACTGG - Intronic
1162625647 19:11882406-11882428 GTTTGCATGGGGCATAGGCTGGG - Intronic
1166826765 19:45614695-45614717 GGTCCCCTGGGGCAGAAAATGGG + Exonic
930990772 2:57651016-57651038 GGTGGCATGGGTCATAGCAAAGG + Intergenic
937335970 2:121062567-121062589 GGTCGCAGGGGTCATAGCACCGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
946445486 2:219736703-219736725 TGGCCCATGGGGCAGAGAATTGG - Intergenic
948612538 2:239179033-239179055 GGACGCCTGAGGCATAGAGTGGG + Intronic
948612557 2:239179123-239179145 GGACGCCTGAGGCATAGAGTGGG + Intronic
948893038 2:240916343-240916365 GGGCGCAGGGGGCGTAGAGTGGG - Intergenic
1177210888 21:18069584-18069606 GGACGCATGGGTCATAGAGCAGG - Intronic
1182561205 22:31160567-31160589 TCTCGCACGGGGGATAGAATGGG - Intronic
1184274889 22:43404591-43404613 GGTCCCATAGTGCATAGCATGGG + Intergenic
952823216 3:37502906-37502928 GGTCTCATCGTGGATAGAATAGG + Intronic
954072359 3:48152179-48152201 GGTGGCATTGGGCATGGCATTGG - Intergenic
956898484 3:73688262-73688284 GGGCGCAGGGGGCATAGGTTAGG + Intergenic
958979291 3:100702281-100702303 GGTTGCCTGGGGATTAGAATAGG - Intergenic
960485662 3:118249865-118249887 GGTATCCTGGGGCATAGGATTGG + Intergenic
989103666 5:37841217-37841239 ATTCACATGGGGCATGGAATTGG + Intergenic
994939283 5:106300506-106300528 GTTTGCATGGGGAATAGAAAGGG - Intergenic
1004079161 6:12374033-12374055 GGCTCCATGGGGCAAAGAATGGG - Intergenic
1005152319 6:22766435-22766457 GGTTGCATGTGGCAAAGAAAGGG - Intergenic
1011823029 6:91274970-91274992 GGTGTCAGGGGGCATAGAATAGG + Intergenic
1030197526 7:106867549-106867571 GGTCGCATAGGGCATGGAGCTGG + Exonic
1030474810 7:110017675-110017697 GGTTGCCAGGGGCATAGAGTTGG + Intergenic
1037519976 8:19671160-19671182 GGTGGAATGGGGAATAGAAAAGG + Intronic
1037616101 8:20520204-20520226 GCTCCCATGGGACACAGAATAGG + Intergenic
1038864650 8:31426702-31426724 AGATGCATGGGGCAGAGAATAGG + Intergenic
1038983019 8:32779776-32779798 GGTAGCAGGGGGAATAAAATGGG - Intergenic
1044185346 8:89244006-89244028 GCTCCCATGGGACAAAGAATTGG - Intergenic
1048391157 8:133966074-133966096 GATCTCAAGGGGCATAGAAGAGG - Intergenic
1051811241 9:21052577-21052599 GGCAGCATGGGGAATAGAACTGG - Intergenic
1060545413 9:124456394-124456416 GGTGGCTTGGGAGATAGAATTGG + Intronic
1061917226 9:133761664-133761686 GGTGGCATCGGGCATACAAATGG - Intergenic
1186997683 X:15141088-15141110 GGTCCCATGGGGCACAGATCAGG - Intergenic
1192184800 X:68939731-68939753 GGTGGCTGGGGGCATAGAATTGG + Intergenic