ID: 902199507

View in Genome Browser
Species Human (GRCh38)
Location 1:14823091-14823113
Sequence CAGAGGGAGGAGAACGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 889
Summary {0: 1, 1: 0, 2: 3, 3: 81, 4: 804}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902199507_902199515 -6 Left 902199507 1:14823091-14823113 CCAGCCCCGTTCTCCTCCCTCTG 0: 1
1: 0
2: 3
3: 81
4: 804
Right 902199515 1:14823108-14823130 CCTCTGTAGAGCAGCCTTCTGGG 0: 1
1: 1
2: 1
3: 19
4: 208
902199507_902199519 14 Left 902199507 1:14823091-14823113 CCAGCCCCGTTCTCCTCCCTCTG 0: 1
1: 0
2: 3
3: 81
4: 804
Right 902199519 1:14823128-14823150 GGGCATGTGGCACCACACCTGGG 0: 1
1: 1
2: 57
3: 335
4: 1158
902199507_902199520 18 Left 902199507 1:14823091-14823113 CCAGCCCCGTTCTCCTCCCTCTG 0: 1
1: 0
2: 3
3: 81
4: 804
Right 902199520 1:14823132-14823154 ATGTGGCACCACACCTGGGAAGG 0: 1
1: 0
2: 1
3: 34
4: 455
902199507_902199518 13 Left 902199507 1:14823091-14823113 CCAGCCCCGTTCTCCTCCCTCTG 0: 1
1: 0
2: 3
3: 81
4: 804
Right 902199518 1:14823127-14823149 TGGGCATGTGGCACCACACCTGG 0: 2
1: 32
2: 554
3: 6713
4: 27046
902199507_902199516 1 Left 902199507 1:14823091-14823113 CCAGCCCCGTTCTCCTCCCTCTG 0: 1
1: 0
2: 3
3: 81
4: 804
Right 902199516 1:14823115-14823137 AGAGCAGCCTTCTGGGCATGTGG 0: 1
1: 0
2: 1
3: 28
4: 269
902199507_902199513 -7 Left 902199507 1:14823091-14823113 CCAGCCCCGTTCTCCTCCCTCTG 0: 1
1: 0
2: 3
3: 81
4: 804
Right 902199513 1:14823107-14823129 CCCTCTGTAGAGCAGCCTTCTGG 0: 1
1: 0
2: 2
3: 14
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902199507 Original CRISPR CAGAGGGAGGAGAACGGGGC TGG (reversed) Intronic
900105529 1:979334-979356 CAGAGGGAGGGGGGCGAGGCAGG + Exonic
900156362 1:1204806-1204828 CAGAGGGTGGAGAACAGTGAGGG + Intronic
900271025 1:1788759-1788781 CAGAGGGGAAAGCACGGGGCTGG + Intronic
900646847 1:3712932-3712954 CAGAGGGTGGGGCAGGGGGCAGG - Intronic
900806573 1:4771524-4771546 CACAGGAAGGACAAGGGGGCTGG - Intronic
901661985 1:10804365-10804387 GGGAGGGAAGAGAAAGGGGCAGG - Intergenic
901664705 1:10819682-10819704 GAGAGGGCGGAGAGAGGGGCGGG + Intergenic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902618233 1:17635443-17635465 CAGAGGGAGGTGAGTGAGGCAGG - Intronic
902654818 1:17859934-17859956 CAGAGGGAGGAGCAGGGAGGTGG + Intergenic
902799259 1:18819339-18819361 CAGAGGGATGGGGAGGGGGCAGG - Intergenic
902823390 1:18956734-18956756 CAGAGGGAGGAGGGGTGGGCGGG - Intergenic
903034693 1:20486156-20486178 CAGAGGGGGGAGAGGGAGGCAGG + Exonic
903134297 1:21299237-21299259 CAGAGGGAGGAGGAAGTGGGTGG + Intronic
903282386 1:22257399-22257421 GAGGGGGAGGAGGAAGGGGCAGG - Intergenic
903656227 1:24950325-24950347 CATGGGGAGGAGAAAGGGGTTGG - Intronic
903671385 1:25037816-25037838 GGGAGGGAGGGGAATGGGGCTGG - Intergenic
903776507 1:25797531-25797553 AAGAGGGAGGAGGAGGAGGCAGG - Intergenic
903799333 1:25954934-25954956 CAAAGGGAGGAGCTGGGGGCAGG - Intergenic
903840297 1:26234137-26234159 CAGAGGCGGCAGAACGGGGTGGG + Intronic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
904049671 1:27631722-27631744 CAGAGGGTACAGAACTGGGCAGG + Intronic
904274193 1:29369653-29369675 CACAGGAAGGAGAGAGGGGCAGG - Intergenic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904376630 1:30086036-30086058 GAGAGGGAGGGGAATGGGGAGGG - Intergenic
904423773 1:30410440-30410462 CACAGGAAGGAGAGAGGGGCAGG + Intergenic
904490823 1:30858054-30858076 CTGAGGGAGGGGACAGGGGCAGG - Intergenic
904599661 1:31666461-31666483 GAGAGGGAGGAGAAGTGGGAAGG - Intronic
904770066 1:32876211-32876233 AAGAGGTAGGAGGACGGGGGCGG + Intergenic
904770088 1:32876249-32876271 GGGAGGGAGGAGGACGGGGAGGG + Intergenic
904941735 1:34168399-34168421 CAGGAGGAGGAGGATGGGGCTGG + Intronic
905486083 1:38297898-38297920 GAAAGGAAGGAGAACTGGGCTGG - Intergenic
905816155 1:40952615-40952637 CAGCGGGAGCAGAACGGGAATGG + Intergenic
905866241 1:41378339-41378361 GAGTGGGAGGAACACGGGGCTGG + Intronic
906184891 1:43854446-43854468 GAGAGGTAGGAGAACTGGGAGGG - Intronic
906399695 1:45495952-45495974 CAGAGGGAGGAGAGATTGGCAGG - Intronic
906509395 1:46402261-46402283 CAGAGGGAGGGGAAAGGGAGGGG - Intronic
906560917 1:46756222-46756244 CAGAGGCAGGAGAGTGGGGTAGG - Intergenic
906689462 1:47783018-47783040 CAGAGGGAGGACCATGGGGTGGG + Intronic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
906836367 1:49086727-49086749 CAGAGGCAGGACCACTGGGCTGG - Intronic
906949642 1:50323771-50323793 AAGAGGGAGGGGACTGGGGCAGG - Intergenic
907287385 1:53390536-53390558 CAGAAGGAGGAGAAGGGGAGTGG + Intergenic
907303694 1:53502701-53502723 CAGAGAGAGGAGAGTGGGGAGGG + Intergenic
907705462 1:56828609-56828631 CATATGGGGGAGAACAGGGCAGG + Intergenic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
910359086 1:86396414-86396436 GAGAGGGTGAGGAACGGGGCAGG + Intergenic
910703810 1:90105131-90105153 CAAAGGGAGATGAAAGGGGCAGG - Intergenic
910795421 1:91092734-91092756 CAGAGAGAGGAGGAAGGGGTGGG - Intergenic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
911368657 1:96970986-96971008 CAGAGAGAGGAGAATGGGAGAGG - Intergenic
911483949 1:98482352-98482374 AAGAGGGAGGGGAATGGGGCTGG - Intergenic
912233088 1:107818105-107818127 CAGAGTGAGGAGAGCAGGGCAGG + Intronic
912303086 1:108536717-108536739 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
912624176 1:111194238-111194260 GGGAGGGTGGAGAACAGGGCAGG - Intronic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
912669237 1:111608800-111608822 CTGAGGCAGGAGAACCAGGCAGG + Intronic
912688599 1:111786627-111786649 GAGAGGGAGGAGTGCGGGGATGG + Intronic
912756030 1:112325488-112325510 CAGAGAGAGGAGAGCCAGGCTGG + Intergenic
912954589 1:114145880-114145902 GAGAGGTAGGAGAAGGGGGTGGG + Intronic
913203603 1:116515996-116516018 GAGATGGAGGAGATCGGGGGAGG - Intronic
914425010 1:147567766-147567788 CAGGGGGAGGGGGAAGGGGCAGG - Intronic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
915156968 1:153885051-153885073 CAGAAGATGGAGAACAGGGCCGG - Intronic
915225144 1:154406132-154406154 CAGAGGGAGAAGAGGGGCGCTGG - Intronic
915524479 1:156467557-156467579 GAGCGGGAGGAGCCCGGGGCAGG + Exonic
915634105 1:157174369-157174391 CCGAGGGAGGAGGGCAGGGCTGG + Intergenic
915644793 1:157262036-157262058 CTGAGGGAGCAGAATGGAGCTGG - Intergenic
915734791 1:158077910-158077932 CAGAGGGAGGAGTACTGGTGTGG + Intronic
916863975 1:168836748-168836770 GAGAGGGAGGGGAAGGGGGAGGG - Intergenic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
917002291 1:170373551-170373573 CAAAGGGAGGATAATGAGGCTGG + Intergenic
917672046 1:177282138-177282160 CAGAGGGAGGAGTAAGGGAGGGG - Exonic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
918124328 1:181569395-181569417 CTGAGGGAAGAGGACGAGGCTGG - Intronic
918305156 1:183239507-183239529 CAGAGGGCAAAGAATGGGGCCGG + Exonic
918633771 1:186750467-186750489 CAGAGAGATGACAACAGGGCTGG - Intergenic
919691383 1:200531356-200531378 AAGAGGGAGGGGAAAGGGGCAGG + Intergenic
919746823 1:201014090-201014112 GAGAGCGAGGAGAAAGGGCCCGG + Intronic
920010066 1:202861003-202861025 CAGCGGGAGAAATACGGGGCGGG + Intergenic
920666276 1:207964727-207964749 CCGAGGGAGGAGGGCGGGGGAGG + Intergenic
920866790 1:209759947-209759969 AAGAGGGAGGAGAAGGGGAGGGG - Intronic
921191560 1:212713420-212713442 CAGATGGGGGAGAAAGGGGCTGG - Intergenic
921225527 1:213015571-213015593 CGGAGGGAGGAGAGAGGGGCGGG - Intronic
921607498 1:217173037-217173059 GAGAGGGAGGAGAAGTGGGTGGG - Intergenic
922239767 1:223748068-223748090 CAGATGGAGGGGAAGGTGGCAGG - Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922596307 1:226816113-226816135 CAGAGGAAGGAAGATGGGGCAGG - Intergenic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
923145498 1:231194883-231194905 ATGAGGGAGGAAAGCGGGGCCGG + Intronic
923342101 1:233016378-233016400 CAAAAAGAGGAGAAAGGGGCAGG - Intronic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
1062873195 10:924578-924600 CTGAAGGAAGAGAACGCGGCTGG - Intronic
1063171621 10:3514826-3514848 CAGAGGGAAGGGAAAGGGGTGGG + Intergenic
1063178326 10:3571797-3571819 CACTGGGAGGAGAGAGGGGCAGG - Intergenic
1063228020 10:4034296-4034318 TAGAGGGACGAGAACAGGACGGG - Intergenic
1063369842 10:5514072-5514094 CAGAGGGAGGAGAGGGGGCAGGG - Intergenic
1063382260 10:5592844-5592866 GAGAGGGAGGAGAAGGGAGCTGG + Intergenic
1064010140 10:11729146-11729168 CAGAGGGAAGAGCAAGGGGTTGG - Intergenic
1064225499 10:13480373-13480395 AAGAGGGAGAAGAGCGGGCCAGG + Intronic
1064720206 10:18221087-18221109 AAGAGGGAGGAGAGAAGGGCAGG + Intronic
1065506335 10:26433626-26433648 CAGAGGGAGAAGAGCGGGGGAGG - Intergenic
1065814073 10:29469308-29469330 GGCAGAGAGGAGAACGGGGCAGG - Intronic
1066358953 10:34712129-34712151 TAGAGTGAGGAGAACTGGGTTGG - Intronic
1066746459 10:38606486-38606508 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1067047044 10:42990718-42990740 CAGAGGAAGGAGACAGGGGTGGG + Intergenic
1067105308 10:43362452-43362474 CAGAGGAAGGAGGACTGCGCTGG - Intergenic
1067213511 10:44281413-44281435 AGGTGGGAGGAGAACGGGACAGG + Intergenic
1067371042 10:45682821-45682843 AAGAGGGAGGAGAGAGGGGAAGG + Intergenic
1067388740 10:45843329-45843351 AAGAGGGAGGAGAGAGGGGAAGG - Intronic
1067417325 10:46113627-46113649 AAGAGGGAGGAGAGAGGGGAAGG + Intergenic
1067445524 10:46341238-46341260 AAGAGGGAGGAGAGAGGGGAAGG + Intergenic
1067874515 10:49992725-49992747 AAGAGGGAGGAGAGAGGGGAAGG + Intronic
1067944943 10:50683480-50683502 GAGAGGGAGGAGGACGGGCATGG - Intergenic
1068866417 10:61900277-61900299 GAGTGGGAGGAGAGCGGGGAAGG + Intergenic
1069729149 10:70599999-70600021 CAGAGGCAGGAGACCTGGCCGGG - Intronic
1070005529 10:72420581-72420603 CAGTGGGAAGAGTACTGGGCTGG + Intronic
1070097994 10:73357080-73357102 CACAGGGAGGAAAAGGGGGGTGG + Intronic
1070135955 10:73693733-73693755 AAGAGGGAGGAGAGAGGGGAAGG - Intronic
1070160718 10:73865313-73865335 CAGAGAGAGGGGAACGCCGCAGG + Intronic
1070257756 10:74825932-74825954 GAGAGGGTGGAGGAGGGGGCGGG + Intronic
1070866444 10:79710351-79710373 GAGAGGGAGGAGGACGGGCGTGG - Intronic
1070880237 10:79848482-79848504 GAGAGGGAGGAGGACGGGCGTGG - Intronic
1071491463 10:86139387-86139409 CAGAGGGAGGTGAAGGGGACTGG - Intronic
1071633354 10:87232572-87232594 GAGAGGGAGGAGGACGGGCGTGG - Intronic
1071646803 10:87364790-87364812 GAGAGGGAGGAGGACGGGCGTGG - Intronic
1072751034 10:97979004-97979026 CTGAGTGAGGAGATGGGGGCAGG + Intronic
1073353661 10:102837021-102837043 CAGGGGGTGGTGAAGGGGGCAGG + Intronic
1073539224 10:104304837-104304859 GAGAGGGAGGAGGACGGGGAGGG - Intronic
1073628307 10:105121877-105121899 CACAGGGAGGAGGAAAGGGCTGG - Intronic
1073894920 10:108144334-108144356 CAGAGGGAGGAGGGGGGGGAAGG - Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1075067971 10:119302517-119302539 CATAGGGTGGAGGATGGGGCTGG + Intronic
1075123436 10:119681040-119681062 CAGAGGGCTGAGAGCGGGGCTGG + Intergenic
1075197865 10:120376799-120376821 CAGATGGAGGCAGACGGGGCAGG - Intergenic
1076193784 10:128500632-128500654 CAGCGGGAGGGGAGCGAGGCAGG - Intergenic
1076242304 10:128917547-128917569 TAGAGGGAGGAGAAGGGGTGAGG + Intergenic
1076352642 10:129828505-129828527 CAGCTGGAGGGGAACTGGGCTGG + Intergenic
1076564094 10:131386487-131386509 CAGAGGGAGGAGCAGGGAGAGGG + Intergenic
1076727193 10:132419400-132419422 CTGAGGGAGGAGCACCTGGCGGG + Intergenic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076790523 10:132774791-132774813 TACAGGGAGGAGAGAGGGGCAGG + Intronic
1076843376 10:133057355-133057377 CACAGGGAGGAGGGCAGGGCAGG + Intergenic
1077093309 11:789145-789167 CAGGGGGAGGAGGGCGGGGAGGG + Intronic
1077219270 11:1408230-1408252 CACAGGGAGGGGAACTGGTCAGG - Intronic
1077304900 11:1864630-1864652 AGGCGGGAGGAGAAGGGGGCTGG + Intronic
1077324705 11:1958713-1958735 GCCAGGGAGGAGAAAGGGGCTGG + Intronic
1077363866 11:2153650-2153672 TCGAGGGAGGAGCCCGGGGCTGG - Intronic
1077373314 11:2193721-2193743 TACAGGGTGGAGCACGGGGCGGG + Intergenic
1077404130 11:2375243-2375265 CAGAGCCAGGGGAAAGGGGCTGG - Intergenic
1077530300 11:3091860-3091882 CAGAGGGTGCAGAGCGCGGCCGG - Intronic
1077765528 11:5156115-5156137 CAGAGGGAGAAAATCTGGGCTGG - Intronic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1078582168 11:12547129-12547151 CAGAGGGCTGAGAAGGGGCCAGG - Intergenic
1078609286 11:12806207-12806229 GAGTGGGAAGAGAAGGGGGCAGG - Intronic
1078662238 11:13296910-13296932 CACAGGCAGGAGGACGGTGCAGG - Intronic
1078845370 11:15114848-15114870 CGGGCGGGGGAGAACGGGGCGGG + Intronic
1078879254 11:15431937-15431959 CAGAGGTAGGAGTCCTGGGCTGG - Intergenic
1079360314 11:19765451-19765473 CAGAGGGAGGGGAAGGGGAAGGG - Intronic
1079405304 11:20140143-20140165 AAGAGGGAGGAGGAGGAGGCGGG - Intergenic
1080174373 11:29343985-29344007 CACAGGCAGGAGAAAAGGGCAGG + Intergenic
1080644533 11:34178643-34178665 CAGAGCCAGGAGACCGGGTCGGG + Intronic
1081206439 11:40281003-40281025 CAGAGGGAGGAGAAAAGGGATGG + Intronic
1081812596 11:45922286-45922308 ACGAGGGAGGAGGAGGGGGCCGG - Intronic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1083105024 11:60349006-60349028 CAGAGTGAAGAGAATGGGGTGGG + Intronic
1083270481 11:61569766-61569788 AAGGGGGAGGAGAGCGGGGGAGG + Intronic
1083336066 11:61922611-61922633 TACAGGCAGGAGGACGGGGCAGG - Intergenic
1083544325 11:63537768-63537790 AAGAGGGAGGAGAAAGGAGCAGG - Intronic
1083771634 11:64870932-64870954 CTCAGGGACGAGAAGGGGGCCGG - Intronic
1083920199 11:65778309-65778331 CAGAGGCAGGAGCAGAGGGCGGG + Exonic
1083990820 11:66244666-66244688 CAGAGAGAGGAGATGGGGGTGGG + Exonic
1083992839 11:66257629-66257651 CAGCGGGAGGGGGACGGGGCGGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084421196 11:69061529-69061551 CAGAGAGAGGAGGTGGGGGCAGG + Intronic
1084455777 11:69267467-69267489 GAGAGGGAGGAAGATGGGGCAGG + Intergenic
1084554401 11:69867361-69867383 CAGAGGGAAGAAAACGGTGGTGG - Intergenic
1084941977 11:72617829-72617851 CAGAGAGAGGGAAAGGGGGCAGG - Intronic
1085296207 11:75433192-75433214 CTGCGGGAGGACAAAGGGGCTGG + Intergenic
1085318798 11:75562085-75562107 CAGAGGGAGGGGCCGGGGGCCGG + Intronic
1086070837 11:82797310-82797332 GAGATGGAGGAGAAAGGGTCTGG - Intergenic
1087204244 11:95377399-95377421 GAGAAGGAGTAGAAAGGGGCAGG - Intergenic
1087487170 11:98770779-98770801 AAGAGGGAGGGGAAGGGGGAGGG + Intergenic
1087565667 11:99854219-99854241 CAGAGGGAGTATAGTGGGGCTGG - Intronic
1088510084 11:110565192-110565214 GAGAGGGAGGAGATGAGGGCAGG + Intergenic
1088759205 11:112913228-112913250 CAGAGGCAGGAGAAAAAGGCTGG + Intergenic
1088771270 11:113038047-113038069 CAGAGGCAGGAGCCCGGGACTGG - Intronic
1088889041 11:114030440-114030462 CAGAGAGAGGCCAAGGGGGCAGG - Intergenic
1088920260 11:114255468-114255490 CAGAGGGAGGAGGGGAGGGCGGG - Intergenic
1089151987 11:116371491-116371513 CAGAGGCAGGGGATGGGGGCAGG + Intergenic
1089418860 11:118316009-118316031 GGGAGGGAGGAGCACAGGGCTGG - Exonic
1089910946 11:122100478-122100500 TAGAGGACGGAGAACGGGGGCGG + Intergenic
1090269505 11:125376188-125376210 CTGGGGGAGGAGAGCTGGGCTGG + Intronic
1090293944 11:125569709-125569731 CGGAGGGAGCGGGACGGGGCCGG + Intronic
1090327815 11:125904321-125904343 CGGAGGGCAGAGAGCGGGGCGGG - Intronic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090785616 11:130044780-130044802 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
1090817948 11:130314943-130314965 GAAGGGGAGGAGAAGGGGGCGGG + Intergenic
1091233709 11:134005046-134005068 GACAGGGAGGGGAACGAGGCAGG + Intergenic
1202807684 11_KI270721v1_random:13890-13912 GCCAGGGAGGAGAAAGGGGCTGG + Intergenic
1091635550 12:2194096-2194118 CAGGAGGAGGAGGACGGGGCAGG - Intronic
1091652212 12:2318911-2318933 GAGAGGGAGGAGAGCAGGGAAGG + Intronic
1091839218 12:3607470-3607492 AGGAAGGAGGAGAACAGGGCAGG + Intronic
1092453386 12:8624453-8624475 CTGAGGCAGGAGAACCAGGCAGG - Intergenic
1092981393 12:13798158-13798180 CTGAGGAAGGAGAATGGGTCAGG - Intronic
1093500767 12:19809492-19809514 TAGAGGGAGGAGAGGGGGACCGG + Intergenic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1093894546 12:24562133-24562155 CAGAGGGAGGGGGACTGGGCTGG - Intergenic
1096115824 12:49054505-49054527 GTGAGTGAGGAGAATGGGGCAGG - Intronic
1096356872 12:50948852-50948874 CAGAGCGAGGAGGAGGGGGGAGG + Intergenic
1096468804 12:51863844-51863866 CCGGGGGAGGAGGGCGGGGCCGG + Intergenic
1096665174 12:53159772-53159794 CAGGGAGAGGGGAAAGGGGCAGG - Intronic
1097014274 12:55974254-55974276 CGGAGAGGGGAGAAGGGGGCCGG + Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098774030 12:74588832-74588854 CTGAGGGAGGAGAATCAGGCAGG + Intergenic
1099877515 12:88427414-88427436 CAGAGGCAGGAGTATGGGGAAGG + Intergenic
1100976301 12:100125629-100125651 CAGAGTGAGGGGAGCAGGGCAGG + Intronic
1101068075 12:101043861-101043883 CAGTGTGAGGAGCACGGTGCTGG + Intronic
1101987734 12:109460809-109460831 CAGAGGGAGGAGGCAGGGGCTGG + Intronic
1102378996 12:112447281-112447303 AAGAGGGAGGGAAACGGGCCTGG - Intronic
1102545208 12:113649424-113649446 CAGCAGGAGGGGGACGGGGCTGG - Intergenic
1102859088 12:116319954-116319976 AACAGGGAGGAGAAAGGAGCAGG + Intergenic
1103574985 12:121870963-121870985 CACAGGGAAGAGAGCTGGGCTGG + Intergenic
1103932564 12:124458315-124458337 CAGAGAGAGGAGGGCGTGGCAGG + Intronic
1104622973 12:130332167-130332189 CTGGGGGAGGGGAACGGGGTTGG - Intergenic
1104843206 12:131834408-131834430 CAGAGGGAGGACCAGGCGGCGGG + Intronic
1104948287 12:132427272-132427294 CAGGGGGTGACGAACGGGGCGGG + Intergenic
1105206519 13:18230475-18230497 CAGAGAGAGTAGAGCGGGGGTGG - Intergenic
1105828309 13:24142444-24142466 CTGAGGGGGGAGAAATGGGCTGG - Intronic
1105831404 13:24165540-24165562 CTGAGAGAGGAGAAGAGGGCAGG - Intronic
1107324491 13:39226574-39226596 CAGAGGGAGGAGCACGTGGGAGG - Intergenic
1107861005 13:44660823-44660845 GGGAGGGAGGAGAATGAGGCGGG + Intergenic
1107882294 13:44843268-44843290 GAGTGGGAGGAGAAGGGGGGTGG + Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108322393 13:49301500-49301522 GAGAGGGAGGAGTAGGGGGTTGG + Intergenic
1108407557 13:50120954-50120976 CACAGGGAGAAGAAAGGTGCAGG + Intronic
1110013008 13:70363169-70363191 CTGAGGGATGAGAAAGGAGCTGG - Intergenic
1112315786 13:98361030-98361052 CACAGGGAGGCGAGCGGAGCTGG - Intronic
1113801228 13:113087391-113087413 AAGAGGGAGGAGAATGGGGAGGG + Exonic
1113909758 13:113836422-113836444 GAGGGGGAGGAGAATGGGGAAGG + Intronic
1114222003 14:20705010-20705032 GAGAGGTAGCAGAAGGGGGCAGG - Intergenic
1114516976 14:23306789-23306811 AGGAGGGAGGAGAAAGGGGGGGG - Exonic
1114572924 14:23687172-23687194 CAGAGAGAGGAGAATGGATCTGG + Intergenic
1114635129 14:24182962-24182984 CAGAGGAAGGTGAGCAGGGCAGG - Exonic
1115298874 14:31861565-31861587 AAGAAGGAGGAGAAGAGGGCAGG - Intergenic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1118493320 14:66283177-66283199 CAGAGGCAGGAGAATTGGCCAGG - Intergenic
1119319081 14:73718856-73718878 CTGCGGGAGGAGAGCGGTGCGGG - Exonic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119827760 14:77671663-77671685 TAGAGGGAGGAGATGGGGTCGGG + Intergenic
1119853030 14:77879541-77879563 CAGAGGGAGGAGGGTGGGGCAGG + Intronic
1120255019 14:82107459-82107481 AAGAGAGAGGGGAAGGGGGCTGG + Intergenic
1121104413 14:91271142-91271164 CAGAGGGAGGGGCACAGGGAGGG + Intergenic
1121174684 14:91882393-91882415 CAGTGGGTGGAGCATGGGGCTGG + Intronic
1121220479 14:92281203-92281225 CAGAGGCTGGAGAGCAGGGCAGG - Intergenic
1121445945 14:93979009-93979031 CAGAGGAAAGAGAACTGTGCTGG + Intergenic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1121494364 14:94381725-94381747 CAGAAGGAGGAGACTGGGGCTGG + Intronic
1121688915 14:95860669-95860691 GAGAGGGAGGAAAAGGGGGAGGG + Intergenic
1121732173 14:96194484-96194506 CAGAGGGTGGTGATGGGGGCTGG + Intergenic
1122113093 14:99515138-99515160 CAGAGGAAGAAGACAGGGGCTGG + Exonic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1122448125 14:101782860-101782882 AAGAGGGAGGGGAAGGGGGGAGG - Intronic
1122774217 14:104110132-104110154 CGGAGGCAGGAGACCTGGGCCGG + Intronic
1122790651 14:104182918-104182940 CAGAGGGATGGGGAGGGGGCAGG - Intergenic
1122802885 14:104240510-104240532 CAGGGGGAGGGGAATGAGGCTGG - Intergenic
1123049272 14:105532776-105532798 CAAAGGGAGCAGAAAGGGCCCGG + Intergenic
1123108839 14:105855855-105855877 GAGAGGGAGCCGAAGGGGGCGGG - Intergenic
1123725920 15:23101393-23101415 CTGAGGGAGGAGAGCAGAGCAGG + Intergenic
1124518840 15:30393127-30393149 CAGTTGCAGGAGAAAGGGGCGGG + Intronic
1124858242 15:33411767-33411789 CAGAGGGAGGAGACCAGCACAGG - Intronic
1125053622 15:35331630-35331652 CAGAGTGAGGAGAATGAGACAGG + Intronic
1125140812 15:36404822-36404844 CAATTGGACGAGAACGGGGCAGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125880098 15:43185928-43185950 CAGCGGGAGGAAAAGGGGTCGGG - Intronic
1125953443 15:43773584-43773606 CTGCGGCAGGAGAATGGGGCAGG + Intronic
1126230179 15:46314791-46314813 CTGAGGGAGGGGAGCAGGGCAGG - Intergenic
1126336146 15:47588231-47588253 CAGAGGAAGGATAGTGGGGCAGG - Intronic
1126673262 15:51135794-51135816 AATAGGGAGGAGAAAGGGACAGG - Intergenic
1128351897 15:66896412-66896434 CTGAGGGGGTAGATCGGGGCCGG + Intergenic
1128556948 15:68638215-68638237 CAGGAGGAGGAGGACAGGGCGGG - Intronic
1128683134 15:69665908-69665930 CAGTGGGAGGAGAGAGGGGCTGG + Intergenic
1128732482 15:70030656-70030678 CAGAGGGAGAAGGAGGTGGCTGG - Intergenic
1128775736 15:70318706-70318728 AAGAGGGAGGAGAATAGGACTGG + Intergenic
1129044983 15:72725989-72726011 GAGAGGGAGGGGAAAGGGGAAGG - Intronic
1129716941 15:77857722-77857744 CAGAGAGAGGAGTATGGGGTCGG + Intergenic
1129804033 15:78438895-78438917 TAGAGGGAGGTGGACGGGGGAGG - Intronic
1129888268 15:79053740-79053762 CAGAGGGAGAAGAGACGGGCTGG + Intronic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130226059 15:82059034-82059056 GAGGGGGAGGAGAAGGGGGAAGG - Intergenic
1130324681 15:82870372-82870394 GAGAGGGAGGAGGAAGAGGCTGG - Intronic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1131106101 15:89736007-89736029 GAGAGGGAGGAGGCTGGGGCGGG + Intronic
1131116531 15:89799565-89799587 GAGAGGGACGAGACCTGGGCAGG + Intronic
1131597619 15:93813831-93813853 CAGTGGTAGGACTACGGGGCAGG - Intergenic
1132078622 15:98845463-98845485 AGGAGGGAGGAGGAGGGGGCAGG - Intronic
1132247264 15:100307244-100307266 CAGAGGGATGAGTCCAGGGCTGG + Intronic
1132921975 16:2400662-2400684 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
1132929894 16:2453725-2453747 CTGAGGAAGGAGACCTGGGCTGG - Intronic
1133747620 16:8699216-8699238 CAGAGGGAAGAGATTGGGGAGGG + Intronic
1134667344 16:16028451-16028473 CAGAGAGAGGAGGAAGGGGTGGG - Intronic
1135282591 16:21165557-21165579 GAGAGGGAAGAGAAGGGGGAGGG - Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136227554 16:28869228-28869250 CAGAGGGAGGGTCATGGGGCGGG - Exonic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136392427 16:29974032-29974054 GAGAGGGAGGAGGCCGGGGCGGG + Exonic
1136399736 16:30010885-30010907 CAGAGGCAGGTGCAGGGGGCTGG - Exonic
1136421300 16:30135242-30135264 CTGAGGGAGTAAAACGGAGCTGG - Intergenic
1136514817 16:30761836-30761858 CGGAGCGAGGCGAACGGGCCCGG - Exonic
1136531270 16:30871074-30871096 CAGAGGGGCCAGAACTGGGCAGG + Intronic
1136536547 16:30902989-30903011 AAGAGTTAAGAGAACGGGGCAGG - Exonic
1136736602 16:32473156-32473178 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
1137354145 16:47743121-47743143 AAGAAGGAGAAGAATGGGGCTGG - Intergenic
1137617530 16:49856334-49856356 CTGAGGAGGGGGAACGGGGCTGG + Intronic
1137617972 16:49858063-49858085 CGGAGCCAGGAGAACGGAGCGGG + Intergenic
1137781651 16:51102783-51102805 GGGAGGGAAGAGAAGGGGGCAGG + Intergenic
1137864680 16:51881024-51881046 CAGAGAGATGGGAACGGAGCAGG + Intergenic
1138549445 16:57739639-57739661 CAGAGGGAGGGCAGAGGGGCAGG - Intronic
1138652804 16:58471404-58471426 CAGAGTGATCAGAACGAGGCTGG - Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1140134670 16:72195371-72195393 GAGAGGGAGCAGAAGCGGGCAGG - Intergenic
1140655157 16:77132406-77132428 GAGAGGGAGGGGAAGGGGGAGGG - Intergenic
1140855172 16:78971715-78971737 CAGAGGGTGGGGATCGGGGTGGG - Intronic
1140944904 16:79758709-79758731 GAGAGAAAGGAGGACGGGGCAGG + Intergenic
1141034874 16:80618279-80618301 CAGCTGTAGGAGAACGTGGCTGG - Intronic
1141116608 16:81315001-81315023 CAGAGCGCGGAGAGCCGGGCCGG + Exonic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141310873 16:82912155-82912177 AAGAGGGAGGAGGAGTGGGCTGG - Intronic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1142177422 16:88651507-88651529 CAGGGGGAGGAAATGGGGGCTGG - Intergenic
1142252650 16:88999715-88999737 CAGAGGGAGGAGGGGGGGGCGGG + Intergenic
1203016466 16_KI270728v1_random:356421-356443 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1203034801 16_KI270728v1_random:629579-629601 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1142598335 17:1040256-1040278 CAGAGGGAGGGAAGTGGGGCAGG + Intronic
1142670465 17:1485540-1485562 CAGGGGGAGGAGGCCGAGGCGGG - Intronic
1143037439 17:4007427-4007449 CAGAGGGAGGAAGAGGGGGTTGG + Intronic
1143097637 17:4486875-4486897 GAAAGGAAGGAGAAAGGGGCCGG + Intronic
1143382132 17:6503161-6503183 CAGAGAGAGGAGGACGGGGATGG - Intronic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143679678 17:8467103-8467125 CAGACGGAGGGGCACGGGGCTGG - Exonic
1144624558 17:16838152-16838174 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1144881870 17:18434569-18434591 CAGAGGGAGCAGAGCCAGGCAGG + Intergenic
1145150363 17:20509817-20509839 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1145901237 17:28491660-28491682 CACTGGGAGGTGAATGGGGCTGG + Intronic
1146162294 17:30566459-30566481 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1146176327 17:30668263-30668285 CAGAGGGAGGAGGGCGGGCTGGG + Intergenic
1146273093 17:31497451-31497473 CAGACGGAGGAGTTCTGGGCAGG + Intronic
1146349787 17:32084377-32084399 CAGAGGGAGGAGGGCGGGCTGGG + Intergenic
1146658853 17:34651428-34651450 CTGGAGGAGCAGAACGGGGCTGG + Intergenic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147182770 17:38697105-38697127 CAGAGGGAGAGGAGCTGGGCTGG - Intergenic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1147326370 17:39671653-39671675 CAGAGGAAGGAAAATGGGGATGG - Exonic
1147553534 17:41462003-41462025 TAGAGGGAGGGGAACCAGGCAGG - Intronic
1147564371 17:41527606-41527628 AAAGGGGAGGAGAACTGGGCAGG - Intronic
1147914566 17:43878776-43878798 CATAGGAAGGAGGATGGGGCTGG + Intronic
1148005491 17:44425189-44425211 CAGAAGGATGAGAAAGGGACAGG + Intronic
1148029800 17:44611703-44611725 CGGCTGGAGGAGAAGGGGGCTGG + Intergenic
1148084109 17:44984090-44984112 CAGAGGGAGTGGAACGGGGTGGG - Intergenic
1148127762 17:45245686-45245708 AAGAGGGAGAAGAACAGGCCTGG - Exonic
1148145550 17:45362417-45362439 CTGAGGGAGGAGGGAGGGGCTGG - Intergenic
1148171833 17:45527378-45527400 CAGAGGGAGCAGAATGGAGCTGG + Intergenic
1148184546 17:45632307-45632329 CTGAGGGAGTAAAACAGGGCAGG - Intergenic
1148277541 17:46319011-46319033 CAGAGGGAGCAGAATGGAGCTGG - Intronic
1148299748 17:46536876-46536898 CAGAGGGAGCAGAATGGAGCTGG - Intronic
1148364188 17:47041186-47041208 CAGAGGGAGCAGAATGGAGCTGG - Intronic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148985051 17:51613535-51613557 CAGAGGGGGGAGAGAGGGGGAGG - Intergenic
1149430509 17:56593302-56593324 CAGGAGGAGGAGAAGGGGGGTGG + Intergenic
1149612467 17:57967635-57967657 CTGAGGGAGAAGAATGGGGAGGG - Intergenic
1150124692 17:62628321-62628343 CAGAGCGAGGAGACTGGGCCCGG - Intronic
1150156545 17:62858457-62858479 CAGAGGAAGGTTAACAGGGCTGG + Intergenic
1150286054 17:63954741-63954763 CAGAGGGAGTGGAACGGCCCAGG - Intronic
1150402758 17:64872411-64872433 CAGAGGGAGCAGAATGGAGATGG + Intronic
1150833120 17:68541203-68541225 CAGAGGGGAGAGGCCGGGGCAGG + Intronic
1151467481 17:74296758-74296780 AAGAGGGAGCAGAATGAGGCTGG - Intronic
1151789858 17:76298275-76298297 CTGAGGCAGGAGAATGGCGCCGG - Intronic
1152155480 17:78629930-78629952 CAGTGGGAGGTGAACGGAACGGG - Intergenic
1152245798 17:79183967-79183989 CAGCGGCCGGAGAACGGAGCGGG - Intronic
1152336731 17:79703140-79703162 TAGAGGGAGGAGAAGGGGGAGGG - Intergenic
1152441369 17:80312260-80312282 CAGAGGGAGGAGGAAGGAGAGGG + Intronic
1152524428 17:80879420-80879442 GAGTGGGAGGAGAAAGGGGCAGG - Intronic
1153324719 18:3806800-3806822 CAGAGGGAGGGGAGCAGGGAAGG - Intronic
1153784563 18:8523175-8523197 CAGAGAGATGAGTAGGGGGCTGG - Intergenic
1153952048 18:10065804-10065826 AAGAGGGAGGCCAAGGGGGCAGG + Intergenic
1154275762 18:12958517-12958539 TAGAGGGAGGAGGAAGGGGGAGG - Intronic
1155988604 18:32256445-32256467 GAGAGGCAGGAGAAGGTGGCTGG - Intronic
1156196609 18:34781120-34781142 CAGGGGCAGGAGAAAGAGGCAGG + Intronic
1157379642 18:47201982-47202004 AAGAGGGATGAGAAGGGGGCTGG - Intergenic
1157824741 18:50802551-50802573 CAGAGGGAGGAGGGCTGGGGTGG + Intronic
1158032398 18:52982170-52982192 CAGAGGGAGGATAGAGGGGCAGG + Intronic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1159402448 18:67955609-67955631 GAGAGGGAGGAAAAGGGGGAGGG + Intergenic
1159798194 18:72868081-72868103 GGGAGGGAGGAGAAAGGAGCCGG + Intronic
1159829326 18:73254758-73254780 GAGAGGGAGGAGGGAGGGGCCGG + Intronic
1160498824 18:79392331-79392353 CAGAGGGAGGAGAGGGGACCGGG + Intergenic
1160531419 18:79567177-79567199 CAGAGGGACGAGGATGAGGCCGG - Intergenic
1160570803 18:79816398-79816420 CAGAGGGCAGAGAAGGGGGAGGG - Intergenic
1160819773 19:1052508-1052530 GAGGGGGAGGAGAAGGGGGGAGG + Intronic
1161010172 19:1956063-1956085 CAGGAGGATGAGAAAGGGGCAGG - Intronic
1161300023 19:3538025-3538047 CAGAGTGAGGAGAGGAGGGCAGG + Intronic
1161328144 19:3673127-3673149 CAGAGGGAGGAGCAGAGGGCAGG - Intronic
1161333042 19:3697297-3697319 CGGATGGAGGAGGACTGGGCCGG + Intronic
1161333062 19:3697377-3697399 CAGACGGAGGAGGACTGAGCTGG + Intronic
1161353825 19:3808417-3808439 CAGAGGGAAGAGAACGCGCCAGG - Intronic
1161422014 19:4181148-4181170 GAGAGGGAGGAGAAGAGGGCAGG - Intronic
1161479226 19:4502375-4502397 CAGTGGCAGGAGAGCTGGGCGGG + Exonic
1161629343 19:5344463-5344485 CAGAGGGCGGGGAAGGGGGTAGG - Intergenic
1161741296 19:6022627-6022649 CAGAGGGAAGGGGACGGAGCCGG - Intronic
1161759586 19:6161378-6161400 CAGAGGGAGGAGGTCGGACCTGG + Intronic
1161939629 19:7394642-7394664 CTGAGGGAGGACAGCGGGGTTGG - Intronic
1162024196 19:7884528-7884550 GAGAGGGAGGAGGAGGGGGAGGG + Intergenic
1162352406 19:10158589-10158611 GAGAGGGAGCAAAATGGGGCTGG + Intronic
1162393078 19:10401404-10401426 CAGAGGGAGGAGGGTGTGGCAGG + Intronic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1162604705 19:11697676-11697698 CAAAGGGAGGAGAATGGAGCTGG - Intergenic
1162736331 19:12748941-12748963 CAGAGGGAGGAGCGAAGGGCAGG - Intergenic
1162775204 19:12975139-12975161 CAGAGAGATGGGAACGGGACAGG + Intergenic
1163371620 19:16904187-16904209 CAGAGGGAGGGGCTCAGGGCTGG - Intronic
1163546609 19:17944485-17944507 CAGAGGGAGGAGGAAGGCACTGG + Intergenic
1163606667 19:18279659-18279681 CAGAGGGAGGAGAGAAAGGCGGG + Intergenic
1164062416 19:21687011-21687033 CTGAGGGAGAAGAACAGTGCAGG - Intergenic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164301009 19:23963500-23963522 CTGAGGCAGGAGAACGAGGCAGG - Intergenic
1164449522 19:28348428-28348450 CAGAGGCAGGAGAACCTGGGAGG + Intergenic
1164465397 19:28483339-28483361 CAGAGGGAAGAGAAAGGAGAAGG - Intergenic
1164521289 19:28982174-28982196 GAGAGGGAGGAGAAGGAGGAAGG + Intergenic
1164556435 19:29256190-29256212 CAAAGGGAGGAGGACGGGAAGGG + Intergenic
1164711519 19:30360103-30360125 CTGGGGGAGGAGATCGGGGCAGG + Intronic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1164820111 19:31243529-31243551 CAGAGGGAGGTGAGCCCGGCAGG + Intergenic
1166366088 19:42279265-42279287 CAGAGGGATGAGGAGGGAGCTGG - Intronic
1166609106 19:44173310-44173332 AAGAGGGAGGACAATGTGGCTGG - Intronic
1166679519 19:44758304-44758326 CAGCGGGAGGAGCCCGCGGCCGG - Exonic
1167113498 19:47475447-47475469 CAGGGGTTGGAGGACGGGGCAGG - Exonic
1167887761 19:52516147-52516169 CTGAAGGAGGAGAAAGGGACAGG - Intergenic
1167937661 19:52921090-52921112 CTGAAGGAGGAGAAAGGGACAGG + Intergenic
1168026555 19:53647821-53647843 TAGAGGGAGGAGGCCGCGGCGGG - Intergenic
1168253549 19:55154933-55154955 CTGAGGGAGGAGAAGGGGCTGGG + Intronic
1168287382 19:55341369-55341391 CAGGGGGCGGAGACCGAGGCTGG + Intronic
1202697534 1_KI270712v1_random:135841-135863 AAGAGGGAGGAGGAGGGGGAAGG - Intergenic
925010501 2:481660-481682 GGGAGGGAGGAGCGCGGGGCAGG + Intergenic
925172024 2:1755750-1755772 AAAAGGAAGGAGAAAGGGGCTGG - Intergenic
925189446 2:1871036-1871058 CAGAGGGAGAGGAAAGGGACAGG + Intronic
925326927 2:3030084-3030106 CAGAGGGAGAAGAAAGAGGCAGG + Intergenic
925407734 2:3616658-3616680 CTGAGGCAGGAGAACCAGGCAGG + Intronic
925541440 2:4971989-4972011 GAGAGGGAGGAGAAGGAGGAAGG - Intergenic
925789828 2:7472698-7472720 CCGAGGGAGTAGAATGAGGCTGG + Intergenic
926215101 2:10901443-10901465 CAGGGGGAGGAGAGCGGGAGGGG - Intergenic
926696629 2:15774067-15774089 CAGAAGGAGAAGCAAGGGGCTGG + Intergenic
927216611 2:20671023-20671045 CAGACGGAGGAGGACGGCGTTGG + Exonic
927515137 2:23667867-23667889 CAGAGGGAGGACGGCGGGGCTGG - Intronic
927591234 2:24360092-24360114 CAGAGGAAGGAACCCGGGGCCGG + Intronic
928029361 2:27765728-27765750 CAGTGGGTGGAGAATGGGGGCGG - Intergenic
928033557 2:27801131-27801153 CAGAGGCTGGAGGACGGGGCAGG + Intronic
928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG + Exonic
928914248 2:36454909-36454931 CAGAAGGAGGATAAAGAGGCAGG + Intronic
929452619 2:42047656-42047678 GCGAGGGCGGATAACGGGGCCGG - Intergenic
929604457 2:43225757-43225779 CAAAGGGAGGGGAGCGGGGAAGG + Intronic
929701748 2:44168724-44168746 CCGAGGGAGCAGCACGGGGAGGG + Intronic
930640983 2:53854259-53854281 CAGGGTGAGGAGTACGGTGCAGG + Exonic
932435387 2:71700168-71700190 CAGAGGGAGTAGCATGGGGCGGG - Intergenic
932597234 2:73101671-73101693 CTGAGGGAGGAGAGCAGGGGTGG - Intronic
932624516 2:73286712-73286734 GAGAGGGAGGAGAAAGGATCAGG - Intergenic
932728411 2:74199246-74199268 CGGAGGGAGGAGGGCGGCGCGGG - Intronic
932729428 2:74207904-74207926 GAGAGGGAGGAGGAGGGGGATGG - Intronic
932746776 2:74340478-74340500 AAGATGGAGGAGAAATGGGCAGG + Intronic
933766233 2:85711449-85711471 CAGAAGGAGGATGACGGGGGTGG + Intergenic
933943139 2:87261961-87261983 CTGAGGAAGGAGAACGTGCCGGG - Intergenic
934153522 2:89172957-89172979 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934153949 2:89177042-89177064 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934155567 2:89196742-89196764 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934187756 2:89762273-89762295 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
934211757 2:89986017-89986039 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934213285 2:90004893-90004915 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934213714 2:90008975-90008997 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934278706 2:91592865-91592887 AAGAGGGAGGAGGAGGGGGAAGG - Intergenic
934308861 2:91845675-91845697 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
934664337 2:96159176-96159198 AGCAGGGAGGAGAACGGGTCTGG - Intergenic
934789439 2:97046217-97046239 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934817033 2:97336323-97336345 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934820663 2:97372161-97372183 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
935279099 2:101502382-101502404 CTGAGGGTGGAGACCCGGGCTGG - Intergenic
935838435 2:107080399-107080421 CAGAGGGAGGGCAACGCGTCCGG + Intergenic
936121283 2:109747647-109747669 CTGAGGCAGGAGAACTGGGGTGG + Intergenic
936223414 2:110623824-110623846 CTGAGGCAGGAGAACTGGGGTGG - Intergenic
936337073 2:111599602-111599624 CTGAGGAAGGAGAACGTGCCGGG + Intergenic
936534209 2:113299033-113299055 CAGAGAGAGAAGAACAGGGGAGG - Intergenic
937110583 2:119364063-119364085 CAGAGATAGGAGAAAGGGGGAGG + Intronic
937408066 2:121649120-121649142 CAGAGGGAGGGGATCGGCCCTGG - Intronic
937953746 2:127407999-127408021 CAGGGGGAAGAGGAGGGGGCGGG - Intergenic
938238092 2:129722657-129722679 TAGAGGGAGGACCACAGGGCAGG + Intergenic
938374963 2:130798994-130799016 TAGAGGGCGGGGAAGGGGGCAGG - Intergenic
938536453 2:132253000-132253022 CAGGGGGAGGGGGAAGGGGCGGG + Intronic
940135014 2:150425797-150425819 CAGAGGAAGGAAACTGGGGCAGG - Intergenic
940226933 2:151410139-151410161 CAGAGGGAGGAGATCGGCGGAGG - Exonic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
942945476 2:181667539-181667561 TTGAGGGAGGGGAAAGGGGCTGG + Intronic
945041354 2:205746014-205746036 CTGAGGCAGGAGAACATGGCAGG - Intronic
945538706 2:211055149-211055171 GAGAGGGAGGAGGAGGGGGAGGG + Intergenic
945891515 2:215435933-215435955 CAGAGGGTGGGGAAGGGGACGGG + Exonic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946130708 2:217604509-217604531 CATTGGGAGGAGAGGGGGGCAGG + Intronic
946169828 2:217888288-217888310 CAGATGGAGGAGAGGAGGGCAGG - Intronic
946179965 2:217943083-217943105 GAGAGGGAGGAGCAGGGGGAAGG + Intronic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
946410234 2:219511899-219511921 GAGAGGGAGGAGAGAGGGGACGG + Intergenic
946905537 2:224412721-224412743 CAGTGGGAAGAGAACTGGTCTGG + Intergenic
946909259 2:224443723-224443745 CAGAGGGAGGAGGATGGGGTAGG - Intergenic
947142145 2:227029288-227029310 AAGAGGAAGGAGGAAGGGGCTGG - Intronic
947531896 2:230914648-230914670 GTGGGGGAGGGGAACGGGGCGGG + Intronic
947791876 2:232873301-232873323 CAGTGGGAGGAGGCCAGGGCAGG + Intronic
948078989 2:235190079-235190101 CCGAAGGAGGAGATGGGGGCAGG - Intergenic
948523402 2:238556446-238556468 GAGAGAGAGTAGAAGGGGGCAGG + Intergenic
948567491 2:238896141-238896163 CGGAGGGGGGAGAGAGGGGCGGG + Intronic
948757945 2:240170026-240170048 CAGAGGTGGGAGAAGGGAGCGGG - Intergenic
948856859 2:240734277-240734299 CAGGGAGAGGGGAGCGGGGCTGG + Intronic
948983835 2:241508374-241508396 CAGAGGGAGGGGCCCGGGGCGGG - Intronic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
1169557832 20:6768507-6768529 CAGGGGGAGGAGTGCGGGGCAGG - Exonic
1170024482 20:11874130-11874152 GACAGGGAGGACAACAGGGCTGG - Intergenic
1171173524 20:23035185-23035207 CCGAGGTGGGAAAACGGGGCGGG + Intergenic
1171437718 20:25136010-25136032 CAGAGGGAGCAGACCGAGCCAGG + Intergenic
1172279797 20:33700873-33700895 CTGAGGCAGGAGAACCAGGCAGG - Intergenic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172442334 20:34974737-34974759 CAGAGGCTGGAGAGCTGGGCTGG - Intergenic
1172445320 20:34990354-34990376 CAGGGGGTGAAGGACGGGGCTGG - Intronic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1172638300 20:36424638-36424660 CAGAGGAATGAGAACGGCTCTGG - Intronic
1172640536 20:36437729-36437751 CAGAGGGAAGAGAACAGGTCAGG + Intronic
1172735671 20:37125316-37125338 CTGAGGCAGGAGAACCAGGCAGG - Intronic
1172793448 20:37521568-37521590 CAGCGCGAGGAGGACGGCGCAGG - Intronic
1173492314 20:43493019-43493041 CAGAGGCAGCAGAAGAGGGCAGG + Intergenic
1173672658 20:44809584-44809606 CAGACGGAGGGGAACCGGCCAGG - Intronic
1173877012 20:46379430-46379452 CTGAGGGAGGAGAGCAGAGCAGG - Intronic
1173929606 20:46807656-46807678 CAGGGGGAGGAGAAGGGAACAGG + Intergenic
1174197842 20:48786047-48786069 CAGCAGGAAGAGAATGGGGCTGG + Intronic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174494510 20:50930567-50930589 CACAGGGCGGAGAAGGGGGTCGG + Intronic
1175225542 20:57441886-57441908 CAGGGGGAGGGGCAGGGGGCAGG + Intergenic
1175344725 20:58264676-58264698 CAAAGGGAAGAGACTGGGGCTGG + Intergenic
1175777699 20:61663527-61663549 CGGAGGAAGGTGAACAGGGCAGG + Intronic
1175920623 20:62449079-62449101 CAGAGGGAGGTGAGTAGGGCAGG - Intergenic
1176021461 20:62964322-62964344 CCCAGGGAGGGGACCGGGGCTGG + Intronic
1176072592 20:63234835-63234857 CAGTGGGAAGAGAACGGGCCAGG + Intergenic
1176513682 21:7767407-7767429 GAGAGGGAGGGGGAGGGGGCAGG - Intronic
1176549060 21:8213699-8213721 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1176556954 21:8257919-8257941 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1176567992 21:8396737-8396759 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1176575896 21:8440956-8440978 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1176949712 21:15030688-15030710 CAGAGGGAGGAAAACATGGAAGG + Intronic
1178647795 21:34397931-34397953 GAGAGGGAGGGGGAGGGGGCAGG - Intronic
1179104038 21:38382656-38382678 GAGAAGGAGGAGACCAGGGCTGG - Exonic
1179353852 21:40640291-40640313 CAGCGGAGGGAGAACAGGGCAGG + Intronic
1179444276 21:41420484-41420506 CAGGGGGCGGGGAAGGGGGCAGG - Intronic
1179794921 21:43776905-43776927 CAGAGGGATGAGAAGAAGGCAGG + Intergenic
1179929397 21:44557510-44557532 CAGAGGAAGGAGAGAGGGGGAGG + Intronic
1180000647 21:44993886-44993908 CACAGGTAGGAGGACGGGGCAGG - Intergenic
1180039336 21:45268090-45268112 CTGAGGCAGGAGAACCAGGCAGG - Intronic
1180535944 22:16392763-16392785 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1180623955 22:17181613-17181635 CAGGGGTTGGGGAACGGGGCAGG + Intronic
1180759434 22:18188233-18188255 CAGAGAGAGTAGAGCGGGGGTGG + Intergenic
1180769744 22:18372533-18372555 CAGAGAGAGTAGAGCGGGGGTGG + Intergenic
1180776585 22:18490133-18490155 CAGAGAGAGTAGAGCGGGGGTGG - Intergenic
1180809313 22:18747502-18747524 CAGAGAGAGTAGAGCGGGGGTGG - Intergenic
1180827681 22:18875489-18875511 CAGAGAGAGTAGAGCGGGGGTGG + Intergenic
1180938287 22:19640286-19640308 CAAGGGGAGGAGAATGGGGATGG - Intergenic
1181072234 22:20352483-20352505 CAGAGAGAGTAGAGCGGGGGTGG - Intronic
1181195308 22:21181424-21181446 CAGAGAGAGTAGAGCGGGGGTGG - Intergenic
1181214139 22:21311350-21311372 CAGAGAGAGTAGAGCGGGGGTGG + Intergenic
1182803160 22:33048574-33048596 CAGAGAGAGGAGTACGTGCCAGG - Intronic
1183073319 22:35411351-35411373 GAGAAGGAGGAGGTCGGGGCTGG + Intronic
1183143905 22:35971647-35971669 GAGAGGGAGGTAAACAGGGCAGG + Intronic
1183503335 22:38194402-38194424 CAGAGGGAGGGGATGGGGACTGG + Intronic
1183546659 22:38457760-38457782 CAGGGAGAGGAGGAAGGGGCAGG + Intergenic
1183914855 22:41109725-41109747 CAGGGGGAGGAGGACGGGAACGG + Intronic
1184264450 22:43339659-43339681 TAGAGTGAGGAGAATGGGGGAGG - Intronic
1184333728 22:43841289-43841311 CAGAGGGAGGAGGACAGGTGTGG + Intronic
1184379581 22:44136668-44136690 CAGAGGGAGGAGAGCTGGGGTGG - Intronic
1184515135 22:44957087-44957109 CAGAGGGAGGAGGGAGGGGGCGG - Intronic
1184686714 22:46099554-46099576 CAGAGGAAGGAGAACAGCGTGGG + Intronic
1184720441 22:46309491-46309513 CACAGAGAGGAAGACGGGGCGGG + Intronic
1184797012 22:46738389-46738411 AAGAGGGAGGAGGAAGGGGCCGG + Intergenic
1184797917 22:46742430-46742452 CAGAGGGAGGTCAGCCGGGCAGG - Intergenic
1185045136 22:48524950-48524972 AAGAGGCAGGAGAAAGGGCCAGG - Intronic
1203231573 22_KI270731v1_random:113717-113739 CAGAGAGAGTAGAGCGGGGGTGG + Intergenic
1203253947 22_KI270733v1_random:130014-130036 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1203262003 22_KI270733v1_random:175093-175115 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1203277781 22_KI270734v1_random:101486-101508 CAGAGAGAGTAGAGCGGGGGTGG + Intergenic
950297743 3:11846670-11846692 CAGGGCGAGGACAACCGGGCGGG + Exonic
951477954 3:23128753-23128775 CAGAGTGAAGAGAAAGGGGAAGG - Intergenic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952723945 3:36562154-36562176 CAGAGAGAAGAGAAAGGGCCAGG + Intergenic
952840496 3:37641471-37641493 CAGAGGGAGAAGATCTGGGGAGG + Intronic
953435079 3:42871602-42871624 TAGAAGGAGGAGAAATGGGCTGG - Intronic
953785293 3:45906864-45906886 GAGAGGCAGGGGAATGGGGCAGG - Intronic
953929047 3:46996898-46996920 CAGAGGGAGGAGGGGGTGGCAGG - Intronic
954060243 3:48061289-48061311 CTGAGGGAGGAGAATCAGGCAGG - Intronic
954396973 3:50298179-50298201 CATAGGGAGAAGAAAGGGACAGG - Intronic
954411843 3:50374311-50374333 GAGGGGGAGGAGAAAGGGGAGGG + Intronic
954567248 3:51608864-51608886 CAGAGGGAGGGGCAGGGGGAGGG + Intronic
955101904 3:55858899-55858921 CAGAGGGAGCAGAACGGCTAAGG - Intronic
955240216 3:57171111-57171133 CAGAGAGAGGAGAACTGTTCTGG + Intergenic
955500950 3:59582314-59582336 CAGATGGAGGAGAAGGGGTGAGG - Intergenic
955996332 3:64684537-64684559 CAGAAGGAAGACAAAGGGGCAGG + Intronic
956187572 3:66577021-66577043 TATAGGGAGAAGAACGCGGCTGG - Intergenic
956413484 3:69003090-69003112 GAGGGGGAGGAGGACGGGGAGGG - Intronic
956488390 3:69745451-69745473 CAGAGGAAGGGGAACTGGGGAGG + Intronic
958616059 3:96494445-96494467 CAGAGGGAGGACACAGAGGCAGG - Intergenic
958952993 3:100436491-100436513 CAGAGGGAGGAGATGAGGGAGGG - Intronic
959095525 3:101951364-101951386 CAGGGGTAGGGGAGCGGGGCAGG + Intergenic
959152648 3:102625807-102625829 CAGAGTGTGGACAAAGGGGCTGG - Intergenic
959395954 3:105838516-105838538 GAAAGGGAGGAGAAAGGGGCAGG + Intronic
960247156 3:115412476-115412498 CAAAGGAAGGACAATGGGGCTGG - Intergenic
960583706 3:119301719-119301741 CAGTGGGTGGAGAAAGGGGATGG + Intronic
960946347 3:122969422-122969444 CAGTGGGAGAGGAACTGGGCTGG - Intronic
961592762 3:127993024-127993046 TAAAGGGATGAGAACTGGGCTGG + Intergenic
961821858 3:129579248-129579270 CTGAGGGCGGAGGACAGGGCTGG + Intronic
963755546 3:149231769-149231791 GAGAGGGAGGAGAAGGGAGGAGG + Intergenic
963923177 3:150925202-150925224 CAGAGGGTGGAAAGTGGGGCGGG - Intronic
963925267 3:150944471-150944493 CAGAGGGGAGAGATGGGGGCTGG + Intronic
966099187 3:176245396-176245418 CAGAAGGAGGAGAAGGGAGATGG + Intergenic
966650172 3:182291798-182291820 CAGTGGGAAGAGAAAGTGGCAGG - Intergenic
966850077 3:184159233-184159255 CAGAGGGAGGACAGTGGAGCAGG - Intronic
966924442 3:184635242-184635264 AAGAGGGAGGAGGAGGGGACGGG + Intronic
966932452 3:184684739-184684761 AAGAGGTAGGAGAGCGGGGGAGG + Intronic
966967077 3:185004379-185004401 CTGAGGCAGGAGAACCAGGCAGG + Intronic
967246985 3:187497833-187497855 CAGAGGGAACAGAAAGGGGTAGG - Intergenic
967255859 3:187591231-187591253 CAGGGGGAGGGGCAGGGGGCGGG + Intergenic
967712732 3:192727646-192727668 GGGAGGGAGGCGAAGGGGGCGGG - Intronic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
968258395 3:197298695-197298717 GAGAGGGAGGAGTTCGGGGAGGG + Intronic
968310052 3:197675620-197675642 CACAGGGAGGAGGCCTGGGCTGG + Intronic
968336501 3:197918029-197918051 AAGAAGGAGGAGAAATGGGCTGG - Intronic
968548090 4:1208642-1208664 GAGAGGGCTGAGAACGCGGCAGG - Exonic
968573683 4:1355223-1355245 CTGAGGGAGGGGAAAGGCGCAGG + Exonic
968649287 4:1754049-1754071 CCTGGGGAGGAGCACGGGGCTGG - Intergenic
968654513 4:1772773-1772795 CAGAGGGAGGGGCATGGGGTGGG - Intergenic
968948323 4:3677140-3677162 CAGCGGGAGGAGCCCGGGGCTGG + Intergenic
969232224 4:5839757-5839779 CTGTGGAGGGAGAACGGGGCTGG + Intronic
969512943 4:7629993-7630015 CAGAGGTAGGAGAACTGGAGGGG - Intronic
970371879 4:15416373-15416395 CAGAGGGAGTTGAACCGAGCTGG - Intronic
971107543 4:23543252-23543274 GAGATGGGGGAGAACGAGGCCGG + Intergenic
972939595 4:44181342-44181364 CTGAGGCAGGAGAACCAGGCAGG - Intronic
973028904 4:45310604-45310626 CAGAAGGAGGAGCACGGTGTTGG - Intergenic
973675408 4:53256896-53256918 GAGAGGGAGGGGGACGGGGAGGG + Intronic
975292153 4:72689406-72689428 CAGTGGGAAAAGAAGGGGGCAGG + Intergenic
975329738 4:73099823-73099845 CAGGTGGAGGGCAACGGGGCTGG - Intronic
976178017 4:82373848-82373870 GAGTGGGAGGCGAAGGGGGCAGG - Exonic
976207990 4:82640177-82640199 CAGAGGGAGGAGGCAGGAGCAGG - Intronic
977086409 4:92604502-92604524 CACAGGGAGGGGAACAGGGAGGG + Intronic
977890043 4:102299126-102299148 GAGTGGGAGGAGAAGGGGACTGG - Intronic
978402884 4:108349682-108349704 CAGAGGGAGTAGATTGGGGCTGG - Intergenic
978746207 4:112197065-112197087 CTGAGGCAGGAGAACGGCCCCGG + Intergenic
979096230 4:116554031-116554053 CAGAGGGAGGATATAAGGGCTGG - Intergenic
980844912 4:138312811-138312833 GAGGAGGAGGAGAAAGGGGCAGG - Intergenic
981342611 4:143639347-143639369 CTGAGTGAGGAGATCTGGGCTGG + Intronic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
982167522 4:152628288-152628310 CTGAGGGTGGAGAAGGAGGCGGG - Exonic
982806549 4:159772618-159772640 AAAAGGGAGGAGAAGGGAGCAGG - Intergenic
985445630 4:190019731-190019753 GAGAGGGAGGAGAGCGGGCAAGG - Intergenic
986347864 5:6851176-6851198 CAGTTGGAAGGGAACGGGGCTGG + Intergenic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
987122890 5:14784351-14784373 CAGAGGAAGGAGCACCAGGCAGG - Intronic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
988699296 5:33657329-33657351 CAAAGGGAGGAGATCCAGGCTGG + Intronic
989165993 5:38434026-38434048 CAGAGGGAGGAGAATGAATCTGG - Intronic
991601344 5:68354459-68354481 CAGAGGGATGTGAAGGTGGCGGG - Intergenic
991910263 5:71552719-71552741 CTGAGGCAGGAGAACCAGGCAGG + Intronic
992638354 5:78747120-78747142 CAGAGGGCGGGGTAAGGGGCAGG + Intronic
993263214 5:85688446-85688468 CAGAGAGAGTAAAATGGGGCTGG - Intergenic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
995533953 5:113117180-113117202 CAGAGTGAGGAGAGAGGGTCGGG - Intronic
997507578 5:134430205-134430227 CAGAGGGAGGGGAAAGAGGTGGG + Intergenic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
998025481 5:138811942-138811964 GAGAGGGAGGGGAAGGGGGAGGG + Intronic
998170578 5:139870056-139870078 CACAGGGAGGAGGAGGGTGCAGG + Intronic
998231696 5:140364995-140365017 GAGAGGGGAGAGAAAGGGGCAGG + Intronic
998401173 5:141849828-141849850 CGGACGGAGGAGGCCGGGGCCGG + Intergenic
998468483 5:142364691-142364713 CAGAGGCAGATGACCGGGGCGGG - Intergenic
999319338 5:150603724-150603746 CAGAGGAAGGAGCACAGGGCTGG + Intronic
1000578685 5:163008964-163008986 CAGAGGGAGGAGAAAGAGAGTGG - Intergenic
1000822311 5:165999735-165999757 TAGAGGGAGGACAAAGGGGTGGG - Intergenic
1001265484 5:170271172-170271194 CAGAGAGAGAAGAAAGGGGAAGG + Intronic
1002253630 5:177944023-177944045 CAGAGGTAGGAGCAGGGCGCAGG - Intergenic
1002522977 5:179801520-179801542 GACAGGGAGGAGCACGGGGTGGG - Intronic
1002533118 5:179860553-179860575 CAGGGGGTGGAAAACGGGGAAGG - Exonic
1002600884 5:180353379-180353401 GAGAGGGCGGGGAAGGGGGCGGG + Exonic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1002758446 6:183321-183343 CAGAGGCAGGAGAACGGGCAAGG - Intergenic
1003308797 6:4950977-4950999 CAGAGGCTGGAAAACAGGGCTGG - Intronic
1003505030 6:6733823-6733845 GAGAGGGAGCTGAATGGGGCTGG - Intergenic
1003611040 6:7615215-7615237 CAGAGGGAAGAGCTCGGGGGAGG - Intergenic
1003908470 6:10722993-10723015 CAGCGGGTGGAGAGTGGGGCGGG - Exonic
1004017056 6:11741785-11741807 GAGAGAGAGGGGAAGGGGGCAGG - Intronic
1004057796 6:12158635-12158657 GAGAGGGAGGAGAACTGAGAAGG - Intronic
1004350874 6:14889287-14889309 CTGAGGCAGGAGGATGGGGCAGG - Intergenic
1004883030 6:20027400-20027422 CAGAGGGAGCAAGAAGGGGCTGG + Intergenic
1005622268 6:27630977-27630999 CAGAGGGAGGGGCAGGCGGCGGG + Intergenic
1005865198 6:29932160-29932182 CTGAGGCAGGAGAATCGGGCAGG - Intergenic
1006173748 6:32109708-32109730 GGGAGGGAGGGGAAGGGGGCTGG - Intronic
1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG + Exonic
1006216096 6:32443963-32443985 CTGAGGGAGGAAAACAGGGTGGG + Intronic
1006247214 6:32747888-32747910 AAGGGGGAGGAGCAGGGGGCTGG - Intergenic
1006335900 6:33420372-33420394 CAGGGGGAGGGGCAGGGGGCGGG + Intronic
1006406950 6:33851006-33851028 GTGAGGGAGGAGAGCTGGGCTGG + Intergenic
1006808610 6:36805585-36805607 CTGAGGGATGAAAACTGGGCAGG + Intronic
1006972429 6:38060448-38060470 CAGAGAGAGGAGAAAAGGGAGGG - Intronic
1007424014 6:41735336-41735358 CAGAGCGAGGTGAGCGGGACCGG - Intronic
1007577115 6:42932390-42932412 CAGAGGAAGGAGAACCTGCCCGG + Intronic
1007626014 6:43246791-43246813 CAGAGGGAGGGTAGCGGGGAGGG + Intronic
1008022852 6:46600526-46600548 CAGAGGCTGGGGAATGGGGCTGG - Intronic
1008700046 6:54087934-54087956 CAGAGGGAGAACACCTGGGCAGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010752497 6:79631241-79631263 GAGAGGGAGGAGGAGGGAGCCGG - Intergenic
1011700390 6:89949948-89949970 GAGAGGGAGGAGAAAGAGGGGGG + Intronic
1013680589 6:112521457-112521479 CCCAAGGAGGAGAAAGGGGCTGG - Intergenic
1015223870 6:130834246-130834268 CAAAGGGAGGAGAATGGTGGGGG + Intronic
1015483642 6:133743771-133743793 AAGATGGAGGAGAACCTGGCAGG + Intergenic
1015965635 6:138693247-138693269 AAGGGGGAGGAGAAAAGGGCCGG + Intergenic
1016161309 6:140883954-140883976 AAGAGGGAGGAGAAAGGAGGAGG - Intergenic
1016694112 6:146973304-146973326 CAGAGGGTGGAGAAAGGATCTGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017788374 6:157774590-157774612 CAGAGGAAGGAGACCCCGGCAGG - Intronic
1017882723 6:158572936-158572958 CAGAGGGAGGAGTGTGGTGCTGG + Intronic
1018744458 6:166751182-166751204 TTCAGGGAGGAGCACGGGGCTGG - Intronic
1018818143 6:167351148-167351170 CAGAGGCGGGAGAACCAGGCAGG - Intronic
1019058735 6:169241055-169241077 CAGGGGCAGGAGTCCGGGGCAGG - Intronic
1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG + Intronic
1019158240 6:170052874-170052896 CAGAGGGAGGGGGAGGGGGAGGG - Intergenic
1019421718 7:954040-954062 CAGAAAGAGGAAATCGGGGCTGG - Intronic
1019564082 7:1671004-1671026 CAGAGGGACGAGGACGAGGATGG - Intergenic
1019654152 7:2179572-2179594 CAGAGGGAACAGAATGGGGCTGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019938385 7:4270947-4270969 GGGAGGGAGGAGGACGGGGAGGG + Intergenic
1020080244 7:5282859-5282881 AAGAGGGAGGAGGAGGGGGGAGG + Intronic
1020285061 7:6672328-6672350 CTGAGGCAGGAGAATTGGGCAGG + Intergenic
1021211978 7:17864776-17864798 GAGAAGGAGGAGAAGGGGGAGGG + Intronic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021655688 7:22871299-22871321 TGGAGGGAGGACAAAGGGGCAGG + Intergenic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1022444417 7:30457974-30457996 CAGAGGGAGGGCAGAGGGGCAGG + Intronic
1022537439 7:31106807-31106829 CTGAGGGGGGAGAAGGAGGCAGG + Exonic
1022870367 7:34471774-34471796 CTGAGGGAGGAGAATCTGGCTGG + Intergenic
1022992271 7:35720272-35720294 TAGATGGAGGAGAATGGGGGTGG + Intergenic
1023156917 7:37260564-37260586 CAGTGGAGGGAGAACTGGGCAGG - Intronic
1024610040 7:51056247-51056269 CAGGGGGAGGAGAGCTGAGCAGG + Intronic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1025211298 7:57020692-57020714 TAGAGGGAGCGGAAGGGGGCGGG - Intergenic
1025660655 7:63556155-63556177 TAGAGGGAGCGGAAGGGGGCGGG + Intergenic
1026560350 7:71443578-71443600 CAGAAGGTGGAGGATGGGGCAGG - Intronic
1026735998 7:72949066-72949088 CAGCTGGAGGAGCCCGGGGCAGG - Exonic
1026786348 7:73304000-73304022 CAGCTGGAGGAGCCCGGGGCAGG - Exonic
1026837586 7:73648700-73648722 CAGAGGGAGAGAGACGGGGCAGG - Intergenic
1026890179 7:73977290-73977312 CACAGGGAGGAGCCCTGGGCAGG - Intergenic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1027219511 7:76204956-76204978 CTGAGTGAGGAGAAAGGAGCTGG - Intronic
1028209189 7:88052408-88052430 CAGAGGCAGGAGAACCCGGGAGG + Intronic
1029423396 7:100483379-100483401 CCGAGGGTGGGGAACGGGACGGG - Intergenic
1029564124 7:101323736-101323758 CATAGAAAGGAGAACCGGGCTGG - Intergenic
1029657602 7:101937219-101937241 CAGGGGGAGGAGCTGGGGGCTGG - Intronic
1030153153 7:106426325-106426347 AAGAGGGAGGAGAGTGGGGAAGG - Intergenic
1030614941 7:111729261-111729283 CAGATAGAGGAGAAAGGAGCTGG + Intronic
1033057876 7:138076402-138076424 CAGAGGGAGGAGCAGAGGGAAGG - Intronic
1033398296 7:140996281-140996303 CTGAGGCAGGAGAACGGTGTGGG + Intergenic
1034337749 7:150334332-150334354 CAGAGGGAGGAGAACACGGAAGG - Intronic
1034466141 7:151230269-151230291 AAGAGAGAGGAGAAAGGGACTGG + Intergenic
1035026836 7:155831726-155831748 CAGTGGGAGGAGCGCGGGGTCGG + Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035564373 8:631381-631403 CAGAGAGAGGTGTGCGGGGCAGG + Intronic
1035650872 8:1263749-1263771 CAGAGAGCAGAGAACAGGGCTGG - Intergenic
1036180365 8:6579293-6579315 CAAATGGAGGAGAAGGGGACCGG - Intronic
1036283932 8:7426804-7426826 CAAAGAGAGGAGAAAAGGGCTGG - Intergenic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1036337543 8:7884726-7884748 CAAAGAGAGGAGAAAAGGGCTGG + Intergenic
1037497048 8:19450217-19450239 AAGAGGGAGGGGGAGGGGGCAGG + Intronic
1037695013 8:21215963-21215985 CAGAGGGAGGAGATAGGAGATGG - Intergenic
1037880264 8:22570210-22570232 CAGAGGGGGAAGAAGGTGGCTGG + Intronic
1037887832 8:22604460-22604482 CAGAGGGAGGCGAGCGTGGTAGG + Intergenic
1038029666 8:23626768-23626790 CAGAGGGATGAAAGTGGGGCTGG + Intergenic
1039474294 8:37831357-37831379 CTGAGGGAGGGCAACGTGGCTGG + Intronic
1041145571 8:54872767-54872789 CAGGGTGGGGAGAAAGGGGCAGG - Intergenic
1042130429 8:65582486-65582508 AAGAAGGAGGAGAAGGGGGAGGG + Intergenic
1042865886 8:73356600-73356622 TGGAGGGAGGAGGAGGGGGCTGG - Intergenic
1043342978 8:79263948-79263970 CTGAGGAAGGAGAACGCGGGAGG + Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043712663 8:83441677-83441699 CAGAGGGAGGAGGAAAGGGGTGG - Intergenic
1044157141 8:88861471-88861493 CAGAGAGAGGATAAAGGGACGGG - Intergenic
1046096927 8:109573600-109573622 CAAAGGGAGGATAAAGAGGCTGG - Intergenic
1046359040 8:113126663-113126685 CAGAAGGAGGAGGAAGGGGAAGG + Intronic
1047340360 8:123975048-123975070 CAGAGGGAGGAGAGCCTGGGAGG + Intronic
1047746995 8:127852739-127852761 GAGAGGGAGGAGGGCTGGGCAGG - Intergenic
1048517830 8:135126428-135126450 CAGAGGGAGGGGAATTGGGTGGG - Intergenic
1048727177 8:137400130-137400152 CAGAGGGAGGACAAAGATGCTGG + Intergenic
1048808593 8:138264053-138264075 GAGAGGGAGGGGAAAGGAGCAGG - Intronic
1049235649 8:141510936-141510958 CCCAGGCAGGAGAAGGGGGCTGG + Intergenic
1049358862 8:142202355-142202377 CAGAGGGCGGAGACGGCGGCTGG - Intergenic
1049403993 8:142443508-142443530 CAGAGGGAGGGAAGCAGGGCCGG + Intergenic
1049411384 8:142475439-142475461 CAGAGGGCGGGGATCAGGGCAGG - Intronic
1049433975 8:142577763-142577785 CAGAGGGTGCAGAGCGTGGCTGG + Intergenic
1050185154 9:2965520-2965542 CAGAGGGAGGAAGACGGAGAAGG - Intergenic
1050562361 9:6847487-6847509 CTGAGGCAGGAGAACGGCCCCGG - Intronic
1051305854 9:15708434-15708456 AAGAGGGAGGATACCGTGGCAGG - Intronic
1051350157 9:16191423-16191445 CAGAGGGAGGAAGGCGGGGAGGG + Intergenic
1052531191 9:29686312-29686334 GAGAGGGAGGAGGAGGGGGAGGG + Intergenic
1052806418 9:33017840-33017862 TCCAGGGAGGAGAAAGGGGCTGG - Intronic
1052900648 9:33791921-33791943 CAGAAGGAGGGGCAAGGGGCAGG + Intronic
1053020311 9:34689892-34689914 CAGAGGGAGGAGACAGGGCCAGG + Intronic
1053737118 9:41108678-41108700 CCGAGGGAGGGGAGAGGGGCTGG - Intergenic
1055762352 9:79622385-79622407 CAAAGGGAAGAGAACTGGGTAGG - Intronic
1055777289 9:79780107-79780129 CAGAGGGAGGAGACATGGGTCGG - Intergenic
1056267861 9:84917396-84917418 CAGTGGAAGGAGCACTGGGCCGG + Intronic
1056681258 9:88721134-88721156 CTGGGGGAGGAGAGTGGGGCTGG - Intergenic
1057200555 9:93137573-93137595 GAGCGGGAGGAGGACGGGGCTGG + Intergenic
1057392046 9:94648285-94648307 GGGAGGGAGGAGAAGGGGACTGG - Intergenic
1057555069 9:96081575-96081597 GAGAGGAAGGATAAGGGGGCAGG - Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057630666 9:96716513-96716535 GAGAGGGAGGGGGACGGGGAGGG + Intergenic
1058268980 9:102945346-102945368 CAGAAGGAGAAGAAAGGAGCAGG - Intergenic
1058618575 9:106861150-106861172 GAGTGGGAGGAGAAAAGGGCAGG + Intergenic
1059165567 9:112073509-112073531 CAGAGAGAGGAGGATGGGGGTGG - Intronic
1059203379 9:112440321-112440343 GAGAGGCAGGAGACCGAGGCAGG + Intronic
1059433644 9:114264224-114264246 AAGTGGGAGGAGGAGGGGGCCGG + Intronic
1059455396 9:114397401-114397423 CAGAAGGAGAAGAAATGGGCTGG - Intergenic
1059599961 9:115766457-115766479 AATAGGGAAGGGAACGGGGCAGG - Intergenic
1059644521 9:116251463-116251485 CACAGGGAGGAGAAAGGAGATGG + Intronic
1059733061 9:117075482-117075504 CAGATGGAGGGGAAGGGGGAGGG + Intronic
1060358273 9:122931250-122931272 CACAGGGAAGGGAAAGGGGCGGG + Intronic
1060827052 9:126693495-126693517 CAGAGAGAGGGGAACAGGTCAGG - Intronic
1061152051 9:128834345-128834367 CAGAGGGAGGATCATGGAGCAGG + Intronic
1061202026 9:129143511-129143533 CAGAGGCGGGACAACGGGGAAGG + Intronic
1061284344 9:129613652-129613674 CAGAGGGAGGAAAAGAGGGTGGG - Intronic
1061287236 9:129631047-129631069 CAGAGGGCGGAGAGTGGAGCGGG - Intronic
1061363438 9:130157935-130157957 CAGAGGGAGGAGAATGGCCAGGG + Intergenic
1061377390 9:130234517-130234539 CAGAGCGAGGAGGCCCGGGCTGG + Exonic
1061390600 9:130315306-130315328 CAGAGGGAGGAGGGAGGGGAGGG - Intronic
1061482324 9:130903249-130903271 CAGAGGCAGGAGAAATGGGATGG + Exonic
1061619663 9:131803647-131803669 CAGAGGTAGGAGGAGGGAGCAGG + Intergenic
1061960581 9:133986929-133986951 GGGAGGGAGGAGAACAGGCCGGG - Intronic
1062044765 9:134419898-134419920 CACAGGGAGCAGAATGTGGCAGG - Intronic
1062051075 9:134447420-134447442 CAGAGGGAGGAGGATGCGGCTGG + Intergenic
1062126019 9:134863542-134863564 CAGTGTGAGCAGAACGTGGCTGG - Intergenic
1062254244 9:135613643-135613665 CAGGGGCAGGAGGATGGGGCAGG + Intergenic
1203470347 Un_GL000220v1:113158-113180 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1203478168 Un_GL000220v1:157130-157152 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1185512001 X:670725-670747 CAGAGGAAGAAAGACGGGGCTGG + Intergenic
1186435883 X:9543022-9543044 CACAGGGAGGAGTCCGGGGCAGG - Intronic
1186444710 X:9617314-9617336 CTCAGGGAGCAGAACAGGGCAGG + Intronic
1187401325 X:18963119-18963141 GAAAGGGAGGAGACAGGGGCTGG - Intronic
1189298630 X:39936354-39936376 GTGAGGGAGGGGAAAGGGGCAGG + Intergenic
1189857548 X:45238455-45238477 GAGAGGAAACAGAACGGGGCAGG + Intergenic
1190687426 X:52887520-52887542 CACAGGGAGGATAACTGGGGAGG + Intergenic
1190698556 X:52968272-52968294 CACAGGGAGGATAACTGGGGAGG - Intronic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1191184219 X:57592505-57592527 CCGGGGGCGGAGATCGGGGCCGG - Exonic
1191213174 X:57909954-57909976 CCGGGGGCGGAGATCGGGGCCGG + Exonic
1192636398 X:72823715-72823737 CAGAGGGAACAGAACAGGGTTGG - Intronic
1192645316 X:72897099-72897121 CAGAGGGAACAGAACAGGGTTGG + Intronic
1193865848 X:86728933-86728955 CAGAGGGAAAATAACGGGGTTGG + Intronic
1194128771 X:90053305-90053327 CAGAAGGGGGAGAATGGGACGGG + Intergenic
1195709952 X:107765755-107765777 GATAGGGAGAAGAAAGGGGCTGG + Intronic
1196778385 X:119361492-119361514 CCGAGGCAGGAGAACCAGGCAGG - Intergenic
1197231354 X:124007158-124007180 GAGAGGGAGGAAAGCGGGGAAGG - Intronic
1197693995 X:129531380-129531402 CAGAGGGAGTAGTATTGGGCAGG - Intergenic
1197829902 X:130630405-130630427 TAGAGGGAGGAGAGAGTGGCTGG + Intronic
1198709448 X:139485353-139485375 GAGAGGGAGGAGAACAAGTCAGG + Intergenic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199800746 X:151248371-151248393 CAGAGGGAGGGGGAGGGGGAGGG + Intergenic
1200003465 X:153073411-153073433 CAGATGGTGGAGAGCGTGGCCGG + Exonic
1200004258 X:153076598-153076620 CAGATGGTGGAGAGCGTGGCCGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200137771 X:153883309-153883331 CAGAGGGAGGAGACGGGGAGTGG + Intronic
1200250713 X:154552410-154552432 CAGAGGGAGAAGCACGCTGCCGG + Intronic
1200829110 Y:7673371-7673393 CAGGGGGAGGGCAGCGGGGCCGG - Intergenic
1201328985 Y:12798069-12798091 GAGAGGGAGGGGAAGGGGGAGGG - Intronic