ID: 902200136

View in Genome Browser
Species Human (GRCh38)
Location 1:14827123-14827145
Sequence CCCAGTCCTGAGGCATCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902200133_902200136 -1 Left 902200133 1:14827101-14827123 CCTGGGAAAAGAGAGGGATGGGC 0: 1
1: 0
2: 1
3: 41
4: 340
Right 902200136 1:14827123-14827145 CCCAGTCCTGAGGCATCCATTGG 0: 1
1: 0
2: 0
3: 13
4: 148
902200130_902200136 4 Left 902200130 1:14827096-14827118 CCTCACCTGGGAAAAGAGAGGGA 0: 1
1: 0
2: 5
3: 54
4: 557
Right 902200136 1:14827123-14827145 CCCAGTCCTGAGGCATCCATTGG 0: 1
1: 0
2: 0
3: 13
4: 148
902200126_902200136 6 Left 902200126 1:14827094-14827116 CCCCTCACCTGGGAAAAGAGAGG 0: 1
1: 0
2: 0
3: 33
4: 273
Right 902200136 1:14827123-14827145 CCCAGTCCTGAGGCATCCATTGG 0: 1
1: 0
2: 0
3: 13
4: 148
902200122_902200136 18 Left 902200122 1:14827082-14827104 CCTTTCCTCTTTCCCCTCACCTG 0: 1
1: 0
2: 6
3: 141
4: 1318
Right 902200136 1:14827123-14827145 CCCAGTCCTGAGGCATCCATTGG 0: 1
1: 0
2: 0
3: 13
4: 148
902200125_902200136 13 Left 902200125 1:14827087-14827109 CCTCTTTCCCCTCACCTGGGAAA 0: 1
1: 0
2: 3
3: 39
4: 488
Right 902200136 1:14827123-14827145 CCCAGTCCTGAGGCATCCATTGG 0: 1
1: 0
2: 0
3: 13
4: 148
902200128_902200136 5 Left 902200128 1:14827095-14827117 CCCTCACCTGGGAAAAGAGAGGG 0: 1
1: 0
2: 0
3: 49
4: 341
Right 902200136 1:14827123-14827145 CCCAGTCCTGAGGCATCCATTGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902200136 Original CRISPR CCCAGTCCTGAGGCATCCAT TGG Intronic
901247596 1:7744907-7744929 TCCAATCCTGAGGACTCCATGGG - Exonic
902200136 1:14827123-14827145 CCCAGTCCTGAGGCATCCATTGG + Intronic
902727980 1:18350054-18350076 CCCAGTCCTGAGGAAGCAGTGGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
907410916 1:54282667-54282689 CCCAGCCCTGAGGAAGCCACAGG + Intronic
912861393 1:113216927-113216949 CCCAGTCTTCAGGCAGCCACAGG - Intergenic
913085084 1:115429477-115429499 ACCAGTCATAAGTCATCCATTGG + Intergenic
914665710 1:149830961-149830983 CCCTGTCCTGAAGCAGCCAAGGG + Intergenic
914670055 1:149862833-149862855 CCCTGTCCTGAAGCAGCCAAGGG - Intronic
915347160 1:155203345-155203367 ACCAGTCCTGGGCCCTCCATGGG + Intronic
916203648 1:162295063-162295085 CCCAGTCCTGTGGGTTCCCTGGG + Intronic
916660067 1:166915329-166915351 GCTAGTCCTGAGGCTTCCTTGGG - Exonic
919732221 1:200920639-200920661 CCCAGTCACGAGGCAACAATGGG - Intergenic
920339828 1:205268872-205268894 CCAAGTCCAGAGGCATCCAGGGG + Intronic
921936430 1:220800983-220801005 CCCAGCCCTGCACCATCCATGGG + Intronic
924243885 1:242063076-242063098 CCCAGTCCTGTGCCATGCAGGGG - Intergenic
1065881642 10:30042392-30042414 CCCAGTACTCAAGCATCCACCGG + Intronic
1070736153 10:78865184-78865206 CGCAGTTCTGAGGCATCCGGGGG + Intergenic
1070820375 10:79350721-79350743 CAGAGTCCTGAGTCATCCGTTGG + Intronic
1071232313 10:83602702-83602724 AGTAGTCCTGAGGCATCCATGGG + Intergenic
1073395133 10:103211268-103211290 CCCAGTCCCTAGGCATTCAATGG + Intergenic
1081333214 11:41830266-41830288 CCTGTTCCTGATGCATCCATCGG + Intergenic
1083424605 11:62576683-62576705 TCCAGTCTTGAGGCATCCCTGGG + Exonic
1084482601 11:69430430-69430452 CCCAGAGCTGAGGCAGCCAAGGG + Intergenic
1084703865 11:70804628-70804650 CCCAGTCCTGGGGCCTGGATAGG + Intronic
1084937030 11:72592347-72592369 CCCAGAGCTGAGGCAGGCATTGG - Intronic
1085702273 11:78755817-78755839 CCCTGTCCTGAGGGAACAATGGG - Intronic
1088798884 11:113287751-113287773 CCCAGTCATGAAGTCTCCATAGG + Intergenic
1089590136 11:119534763-119534785 CCCAGTCCTGAGTCCCCCAAAGG + Intergenic
1091145208 11:133273403-133273425 CCAAGTCCTGCGGCATCCTGAGG + Intronic
1092769094 12:11880814-11880836 CCCAATCCAGAGGAATCCAATGG + Intronic
1093765402 12:22956115-22956137 CCAAGTTCTGACCCATCCATTGG + Intergenic
1096956705 12:55533901-55533923 GCCAGTACTGAGAGATCCATAGG + Intergenic
1098566843 12:71946708-71946730 CCCAGTCCTGAGACAAACACAGG + Intronic
1099581880 12:84458728-84458750 CCCACTCCAGAGGCAACCACTGG + Intergenic
1100434717 12:94561024-94561046 CCCAGCCCCGAGGCATACACGGG - Intergenic
1102031780 12:109743929-109743951 CCAAGGCCTGAGGCATCAAGAGG - Intronic
1102466080 12:113131507-113131529 CCCATTCCTCAGCCCTCCATGGG + Intronic
1102940694 12:116938912-116938934 CCCAGTCTGGGTGCATCCATGGG + Intronic
1103074934 12:117974446-117974468 CAGATTCCTGAGCCATCCATGGG - Intergenic
1105942035 13:25156207-25156229 CTCAGTCCTGGGGGAACCATGGG + Intergenic
1115389556 14:32839401-32839423 CCCAGATTTCAGGCATCCATTGG + Intergenic
1115790194 14:36869508-36869530 CCGAGGCCTGAGGCATCCCAGGG - Intronic
1118130815 14:62961390-62961412 CCCAGTCCTGAGAGATGCATAGG - Intronic
1118715388 14:68556254-68556276 CCCAGACCAGAGCCATCCTTGGG + Intronic
1122121316 14:99554953-99554975 ACCAGACCTGAGGCCCCCATGGG - Intronic
1124604480 15:31160465-31160487 CCCAAGCCTGAGTCATCCCTGGG + Intronic
1128359108 15:66948303-66948325 CGGAGTCCTGAGGCAGCCCTGGG - Intergenic
1128763520 15:70236166-70236188 CCCAGTCCAGAGGCCTCCCCAGG + Intergenic
1129440931 15:75580139-75580161 GCCAGTCCTGAGGGACCCAAAGG + Intergenic
1129518304 15:76170442-76170464 CCGTGTTCTGAGCCATCCATCGG - Intronic
1129671352 15:77609570-77609592 CACAGCCCTGAGGCCTCCAGTGG + Intergenic
1130411890 15:83654415-83654437 CCCAGTCCTGAGGCCCCCTGGGG - Intronic
1133238940 16:4403366-4403388 CCCAGGGCTGAGGTACCCATTGG + Intronic
1134037262 16:11040439-11040461 CCCAGTCCTTGGTCATCCCTGGG + Intronic
1139517821 16:67462159-67462181 CCCAGGCCTGAAGGCTCCATGGG + Intronic
1142257877 16:89024026-89024048 TCCAGTCCTGAGGCCACCTTTGG + Intergenic
1143117307 17:4588350-4588372 CCCAGGCCTGAGGCACTCACGGG - Intronic
1143633317 17:8150964-8150986 CCCAGGCCTGGGGCTTCCAATGG + Intronic
1144929901 17:18850910-18850932 CCCAGTCCTTAGGCCTCCCTAGG + Intronic
1146065307 17:29630386-29630408 TCCAGACCTGAGGCATCGAATGG - Exonic
1147188441 17:38725425-38725447 CCCAGGCCAGAGGCTTCCATTGG + Intronic
1148104874 17:45113793-45113815 CCCAGTCTTGAGGGATCCCAGGG - Intronic
1148438706 17:47700812-47700834 CCCAGTGCTGGGGCCTCCAGGGG + Intronic
1151123156 17:71815403-71815425 CCCAGTCCTGAGGCCACATTAGG - Intergenic
1151697503 17:75725032-75725054 CCCAGGACTGAGGCACCCAGAGG + Intronic
1161590131 19:5125744-5125766 ACCAGTCCTGAGCCCTCCCTGGG - Intronic
1163523870 19:17808433-17808455 CCCACTCCTGAGGGACCCAGGGG + Intronic
1163781374 19:19250796-19250818 CCCAGTCCTTAAGCAGACATTGG + Exonic
1164702516 19:30295958-30295980 ACCTGTCCAGAGGCCTCCATGGG + Intronic
1167373005 19:49095276-49095298 CCCAGCCCTGCAGCATTCATTGG + Intronic
925238451 2:2299375-2299397 GCCAGCCCGCAGGCATCCATGGG - Intronic
925661454 2:6207595-6207617 CCCAATGCTGAGGCATGCAGGGG - Intergenic
926086252 2:10022220-10022242 CCCAGGACTGAGGCATCCTCAGG - Intergenic
926710472 2:15875506-15875528 CCCAGTCCTGAGACAACCCTGGG - Intergenic
928138520 2:28707279-28707301 CCAGGTACTGAGGCTTCCATGGG + Intergenic
929450879 2:42036219-42036241 CCCAGGCCTGAGGTTTCCATGGG - Intergenic
930717106 2:54603544-54603566 CCCACTCCTAAGGGCTCCATGGG - Intronic
933751988 2:85608815-85608837 CCCAGAGCTGCTGCATCCATAGG - Exonic
934768056 2:96891704-96891726 CCAAGGCCTGAGGCAGCCAGAGG + Intronic
935342083 2:102067548-102067570 CCCAGGCCTGAGGGATCTCTTGG + Intronic
936407941 2:112224793-112224815 CTCAGACCTTAGGCATCCACTGG - Intronic
940017703 2:149124037-149124059 CCCACTCCTGTGGAATCCAAGGG + Intronic
942543512 2:177038838-177038860 CCCACTCCTGTGGTATCCGTGGG - Intergenic
948327227 2:237134531-237134553 CCCAGGCCTGAGGCAACCTCAGG - Intergenic
948541030 2:238691536-238691558 CCAAGTCCTGAGCCATGCCTGGG - Intergenic
948662755 2:239516989-239517011 CACTGTCCTGAGGCCTCCAGAGG + Intergenic
948909472 2:240995776-240995798 CCGAGTCCTGGGGCATCCTGAGG + Intergenic
1172215782 20:33234678-33234700 CCCAGGCCTGAGGGATCCTTTGG - Intergenic
1174178039 20:48657288-48657310 CCCAGTCCTGCTGGATCCCTTGG - Intronic
1174708111 20:52677489-52677511 CCCATTCCTGAGTCTTTCATTGG - Intergenic
1175224639 20:57437911-57437933 GCCAGTCCTGATTCATCCCTAGG + Intergenic
1175997481 20:62818054-62818076 ACCAGTCCTGAGATACCCATAGG - Intronic
1176299907 21:5094706-5094728 CACAGTCCTGGGGCACCCAGTGG - Intergenic
1178521768 21:33292844-33292866 ACCAGTCCTGAGGTGTGCATAGG + Intronic
1179857115 21:44167205-44167227 CACAGTCCTGGGGCACCCAGTGG + Intergenic
1181783549 22:25209481-25209503 CCCCTTCCTGAGGCCCCCATAGG - Intergenic
952923856 3:38307471-38307493 CCAGGCCCTGAGCCATCCATGGG - Intronic
952926181 3:38321228-38321250 CACAGTTCACAGGCATCCATGGG - Intergenic
953640619 3:44703784-44703806 CCCATTTCTGAGGCAGTCATAGG + Intergenic
954455046 3:50593179-50593201 GCCAGGCCTGAGGCTCCCATCGG - Intergenic
955139799 3:56258083-56258105 CCTAGTCCTGCTGCATCCAGAGG - Intronic
962447783 3:135483614-135483636 TCCAGTCCTCTGGCATCCAGAGG + Intergenic
965788697 3:172364327-172364349 CCCAGACCTGTGGCTTCCATTGG + Intronic
966171421 3:177085358-177085380 CCAAGTTCTGTGGCACCCATGGG - Intronic
969621642 4:8281705-8281727 CACAGGCCTGAGGCATGCAGTGG - Intronic
970176816 4:13347953-13347975 ACCAGTACTGAGTCATCCAGGGG + Intergenic
974490658 4:62559332-62559354 CCCAGACAAGAGGCATCTATCGG - Intergenic
976531575 4:86160344-86160366 CCCATTCCTGTGGCATACACTGG + Intronic
978904616 4:113991143-113991165 GCCAGTCCTGAGGCTTTCCTAGG - Intergenic
979018745 4:115467982-115468004 CAGAGTCCTGAGGCAGCCCTTGG - Intergenic
979449926 4:120858690-120858712 CCCAGGGCAGAGGAATCCATGGG - Intronic
979878242 4:125920843-125920865 GTCAGTCCTGAGGCATCTTTTGG + Intergenic
980177369 4:129363359-129363381 CCCTGTCCTGATGCATAAATTGG - Intergenic
981567076 4:146113210-146113232 CGCTGTCCTGCGGCAGCCATGGG - Intergenic
983253864 4:165376996-165377018 CCCAGACCTGATGAATTCATAGG + Intronic
983745128 4:171189083-171189105 TCCAGTCCTGAGCTATCCCTTGG - Intergenic
984420196 4:179511670-179511692 CCCAGTCCTGATCCACCCAAAGG - Intergenic
985492265 5:186851-186873 CCCAGTGCTGAGGCATGGACGGG - Exonic
985627855 5:999322-999344 CCCAGTCCTGCCTCAGCCATGGG + Intergenic
986236645 5:5916727-5916749 CCCAGACCTGAGGTATACACAGG - Intergenic
988100009 5:26663038-26663060 CCAAGACCTGAGGCTTCCAAGGG - Intergenic
993096466 5:83484661-83484683 GCCAGTTATGAGTCATCCATGGG - Intronic
997157769 5:131577227-131577249 CCCAGGCCTTCGGCATCCAGTGG + Intronic
997243159 5:132323305-132323327 CCCAGTCAGGAGGTATCCAAAGG - Intronic
997718245 5:136058013-136058035 CCCAGGCCTGAGGCACCCCTGGG + Intronic
999109375 5:149104803-149104825 CTCAGTCCATAGGCCTCCATAGG + Intergenic
1003331872 6:5135616-5135638 GACAGGCCTGAGGCATCCAGAGG - Intronic
1003623513 6:7723334-7723356 CCCTGTCCTGAGGCTTCCAGGGG + Intergenic
1005734042 6:28728839-28728861 CTCAGTCCAGAGGCAGCCGTCGG - Intergenic
1006295566 6:33168616-33168638 CCCACTCCTGAGGGGTCCCTTGG - Intronic
1012302455 6:97606351-97606373 CCAAGTCCTGAGGTCACCATAGG + Intergenic
1012703664 6:102495019-102495041 CCCAGCACTCAGGCATCCCTGGG - Intergenic
1015546847 6:134370070-134370092 CCGTGTCCTGGGGCCTCCATGGG - Intergenic
1018905529 6:168073382-168073404 CCCAGTCCTGAGTCCCCCAGGGG - Intronic
1019899181 7:4006730-4006752 CCCAGTCCTGCTGCAGCTATAGG - Intronic
1021861914 7:24914243-24914265 CCCAGACCAGAGCCAGCCATTGG + Intronic
1024290407 7:47799784-47799806 CCCAACCCTGAGCCTTCCATAGG + Intronic
1027038515 7:74943929-74943951 CTCAGTCCTGGGGCAGCCCTGGG + Intergenic
1032933560 7:136702428-136702450 CCAAGTGCTGATGCATGCATGGG + Intergenic
1035024815 7:155818586-155818608 CCCCTTCCTGTGGCATCCACTGG + Intergenic
1036543793 8:9746678-9746700 CCCAGTCCTCAGCCCTCCATAGG + Intronic
1036604229 8:10292340-10292362 CCCAGTCCTGGGGCCTACAGAGG + Intronic
1036714291 8:11106399-11106421 CCCATGCCTGAGGCACCCTTAGG + Intronic
1047688302 8:127323486-127323508 CCCACTCCTGTGGCTTCCCTGGG - Intergenic
1048182909 8:132212848-132212870 TCCAGGCCTGAGCCATCCCTGGG + Intronic
1048922512 8:139244233-139244255 CCCAGTCCTGGGGTCTCCACAGG - Intergenic
1050941371 9:11462922-11462944 CTGACTCCTGAGGCATACATGGG + Intergenic
1056246547 9:84701324-84701346 CACAGGCCTGGGGCTTCCATGGG - Intronic
1060278576 9:122200448-122200470 CCCAGTCCTGCAGCAGTCATGGG + Intergenic
1061580452 9:131532700-131532722 CCCAGGCCTGAGGCTTTCTTGGG - Intergenic
1061792333 9:133065199-133065221 CCCAGTGCTGAGGAACCCAAGGG - Exonic
1061881119 9:133569551-133569573 CCCAGTCCTGGGCCAGCCAGTGG - Exonic
1061894632 9:133640849-133640871 CCCAGGCCTGAGGCTTTCTTGGG + Intronic
1185487885 X:497066-497088 CCCAGTCTTCTGGGATCCATAGG + Intergenic
1186271055 X:7888579-7888601 ACCAATCCTGGGGCATCCCTTGG - Intergenic
1186499387 X:10039059-10039081 CCCAGCCCTCAGCCATCCTTTGG - Intronic
1189611317 X:42739227-42739249 CTCAGTCCTGAAGCAACCACTGG + Intergenic
1190265036 X:48823166-48823188 ACCATTTCTGAGGCAGCCATTGG + Exonic
1190533615 X:51406027-51406049 CTAAGTCCTCAGGCACCCATGGG - Intergenic
1191858268 X:65645053-65645075 CCAAGCCCTGAGTCATCCCTGGG + Intronic
1198055921 X:132994664-132994686 CCAAATCCAGAGGCATCCAGAGG + Intergenic