ID: 902202262

View in Genome Browser
Species Human (GRCh38)
Location 1:14842518-14842540
Sequence TCGATGATGTAGGACAACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902202262_902202268 29 Left 902202262 1:14842518-14842540 CCCTCGTTGTCCTACATCATCGA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 902202268 1:14842570-14842592 TTAAAAGTCATTGCACTGAATGG 0: 1
1: 0
2: 1
3: 24
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902202262 Original CRISPR TCGATGATGTAGGACAACGA GGG (reversed) Intronic
900630144 1:3630598-3630620 TGGATGTGTTAGGACAACGAGGG - Intergenic
902089807 1:13894002-13894024 TCGATGACGAAGGACAAACAAGG - Intergenic
902202262 1:14842518-14842540 TCGATGATGTAGGACAACGAGGG - Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
917007841 1:170435241-170435263 TAGATAATGTAGTACAACAAAGG - Intergenic
917520611 1:175745410-175745432 TGGATGAAGTAGGACAAAGATGG + Intergenic
1090991858 11:131824876-131824898 TAGATGCTGGAGGACAAGGAAGG + Intronic
1091880504 12:3973554-3973576 TAGATGATGTTGGAGAACGTGGG + Intergenic
1100592708 12:96044336-96044358 TCGATGAAGAAGGAAAACCAAGG + Intergenic
1101652388 12:106689357-106689379 TTGATGAGGTAGGTCAACAAGGG + Exonic
1102718340 12:114994451-114994473 TCTCTGCTGTAGGACAAAGAGGG - Intergenic
1103181791 12:118918840-118918862 TTGATGCTGTAGGACAGGGAGGG + Intergenic
1110027354 13:70557665-70557687 GAGATGATGAAGGACAATGAAGG - Intergenic
1119109704 14:71959988-71960010 TCGATGGTATAGGAAAAGGAAGG - Intronic
1129208283 15:74050349-74050371 TCCATGATGTAGGCCACAGATGG - Intergenic
1136053490 16:27670592-27670614 TCGATGCTGGAAGACAACGGAGG - Intronic
1165135878 19:33668340-33668362 TCCATGATGAAGGCCAGCGAAGG - Intronic
925421519 2:3716660-3716682 TTGATGATGTAGGACAAAATAGG + Intronic
931277390 2:60755929-60755951 TCAAAGATGTAGGATAACGGAGG + Intergenic
938118070 2:128615564-128615586 TCGATGAGGCAGGACAACCCTGG - Intergenic
940689148 2:156893169-156893191 GCGATGATTTAGGACAGTGAAGG + Intergenic
1170143938 20:13152643-13152665 TTGATGATGGAGCACAACTAGGG - Intronic
1178666256 21:34549670-34549692 TCCAAGATGGAGGACAATGATGG + Intronic
951301500 3:21003724-21003746 TCAAAGATGTAGGATAAGGATGG + Intergenic
957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG + Intronic
1003527741 6:6911934-6911956 TAGATGATGCAGGAAAAGGAGGG - Intergenic
1004805252 6:19197179-19197201 TCCATGATCTAGGATAATGAAGG + Intergenic
1025790328 7:64682085-64682107 TGGATGAGGTAGGAAAAGGAAGG - Intronic
1026531956 7:71207306-71207328 AAGATAAGGTAGGACAACGAAGG - Intronic
1048486438 8:134852155-134852177 TCCATGGTGTAGGACACAGATGG - Intergenic
1052101093 9:24447064-24447086 TCCCTGATGTAGGACAGTGAAGG + Intergenic
1057327044 9:94074929-94074951 TTGATGATGGATGAGAACGAAGG + Intronic
1187661913 X:21556930-21556952 TTGATGATGCAGGAGAAAGAAGG + Intronic