ID: 902203414

View in Genome Browser
Species Human (GRCh38)
Location 1:14850826-14850848
Sequence GAGGTACACCTGCCTAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902203414_902203425 10 Left 902203414 1:14850826-14850848 CCTCCCCTAGGCAGGTGTACCTC 0: 1
1: 0
2: 0
3: 7
4: 88
Right 902203425 1:14850859-14850881 AGACTCTGGAAGTTTTATATTGG 0: 1
1: 0
2: 0
3: 12
4: 191
902203414_902203419 -4 Left 902203414 1:14850826-14850848 CCTCCCCTAGGCAGGTGTACCTC 0: 1
1: 0
2: 0
3: 7
4: 88
Right 902203419 1:14850845-14850867 CCTCCCTAAGCCCCAGACTCTGG 0: 1
1: 0
2: 4
3: 22
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902203414 Original CRISPR GAGGTACACCTGCCTAGGGG AGG (reversed) Intronic
900346409 1:2212529-2212551 GAGGTACTGCTGCCTGGGGCCGG - Intronic
900734753 1:4291563-4291585 GAGGTACACATGCATAGGTGGGG + Intergenic
902203414 1:14850826-14850848 GAGGTACACCTGCCTAGGGGAGG - Intronic
903447514 1:23431710-23431732 GAGGTACATCTCCGAAGGGGTGG + Exonic
905541050 1:38760695-38760717 GAGGTCCTCTTGCCCAGGGGAGG + Intergenic
905812424 1:40922537-40922559 GAGGTCCACCAGCCTCAGGGTGG - Intergenic
909476584 1:76087632-76087654 GAGGTACATCCACCTAGGTGAGG + Intronic
909687679 1:78368987-78369009 GACATACAGCTGGCTAGGGGTGG + Intronic
910707346 1:90143931-90143953 GAAGTCCATCTGCCAAGGGGTGG + Intergenic
912337609 1:108877125-108877147 GCGGTGCCCCTGCCTTGGGGAGG + Exonic
920913915 1:210242887-210242909 GAAACACACCTGTCTAGGGGCGG + Exonic
922899259 1:229123551-229123573 CAGGCAAACCTGCCCAGGGGAGG + Intergenic
1064219767 10:13430915-13430937 GAGGTAGAGGTGCCAAGGGGAGG - Intergenic
1069630489 10:69894478-69894500 CAGGGACACCTGCCTGGGTGGGG - Intronic
1069904440 10:71724133-71724155 GCGGTCCTCCTGCCCAGGGGAGG + Intronic
1073094243 10:100970047-100970069 GATGTCCACCTGCCTAGTGTAGG - Intronic
1073112312 10:101070026-101070048 GGGATACACCTGTCTGGGGGTGG + Intergenic
1082031503 11:47607736-47607758 GAGGGAAACCAGCCGAGGGGTGG + Intergenic
1084216146 11:67647839-67647861 GAGGTACACCCGCAGTGGGGTGG + Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1089081194 11:115777377-115777399 GGGGTACAACTGTCTAGGAGGGG + Intergenic
1090608733 11:128451466-128451488 GGTGGACTCCTGCCTAGGGGAGG + Intergenic
1091652829 12:2322616-2322638 GAGGAACACCTGACTTTGGGAGG - Intronic
1096069684 12:48768058-48768080 GAGGGACACCTGGCTGGGGTGGG + Exonic
1099665178 12:85619520-85619542 GAGGTGTACCTGCTTTGGGGAGG + Intergenic
1100183767 12:92114323-92114345 GAGGTAGATCTGGCTGGGGGAGG - Intronic
1104753903 12:131257056-131257078 GTGGGACACCTGCTTGGGGGTGG - Intergenic
1105991337 13:25624713-25624735 GAGTTACACTTGCACAGGGGTGG + Intronic
1106133265 13:26956673-26956695 GAGGCACTGCTGACTAGGGGTGG - Intergenic
1113469064 13:110531546-110531568 GGGTTACACCTGCCAAAGGGTGG + Intronic
1122027297 14:98887090-98887112 GAGGTACTCTGGCCTGGGGGCGG + Intergenic
1122983411 14:105201632-105201654 CAGTCACACCTGCCCAGGGGAGG - Intergenic
1123009614 14:105341904-105341926 GAGGAGCCCCTGCCTAGGGACGG + Intronic
1125836847 15:42759418-42759440 GAGGCACACCTGCCAGGGGCAGG - Intronic
1132500216 16:281656-281678 GAGGTACAGCTGGCCAGAGGGGG + Intronic
1132968618 16:2673621-2673643 GAGGTCCCCCTGCCCAGGCGGGG - Intergenic
1134207040 16:12246897-12246919 GAGACAAACCTGCCGAGGGGAGG - Intronic
1135190836 16:20353140-20353162 GAGGTGCACCTGTCTTGGAGAGG + Intronic
1135546843 16:23372084-23372106 GGGGTACACCTGCCAATGTGGGG - Intronic
1136577376 16:31132627-31132649 GAGGGGCACCTGACTTGGGGAGG - Intronic
1141190175 16:81819006-81819028 GAGTTACACCTGCCTCATGGTGG - Intronic
1142115182 16:88352756-88352778 GATGTGGACCTGCCTAGGGAGGG - Intergenic
1142614955 17:1128762-1128784 GAGGTAGACCTTCCTGGGGTGGG - Intronic
1142614972 17:1128834-1128856 GAGGTAGACCTTCCTGGGGTGGG - Intronic
1142614989 17:1128906-1128928 GAGGTAGACCTTCCTGGGGTGGG - Intronic
1145863426 17:28226010-28226032 GATTGACACCTGCATAGGGGTGG + Intergenic
1147927525 17:43954702-43954724 GAATGACACCTGCATAGGGGTGG - Intronic
1148961377 17:51396147-51396169 GTGGTACTCCTGCCCATGGGGGG - Intergenic
1153582919 18:6593652-6593674 GAGGTACACATGACTGGGGGAGG - Intergenic
1156466668 18:37352182-37352204 GAGGGACACCTGCAAAGGTGTGG - Intronic
1157734226 18:50032382-50032404 GATTTACAGCTGCCTAGGGCTGG - Intronic
1161156440 19:2734122-2734144 GAGGTACACACTCCTATGGGAGG + Intronic
1162042513 19:7979302-7979324 GAGGGACACCTGCCCAGGCCTGG + Intronic
1165753264 19:38274839-38274861 GAGGTAGACCAGCTTACGGGAGG + Intronic
925013089 2:500635-500657 GAGGGCCAGCTGCCTAGTGGAGG + Intergenic
925444491 2:3915958-3915980 GGCGTGCACCTGCTTAGGGGAGG - Intergenic
925844090 2:8020254-8020276 GAGGAACATCTGCCGAGGGCTGG - Intergenic
929928972 2:46237582-46237604 GAGGTCTACCTGCCAAGGGTAGG - Intergenic
932101853 2:68908514-68908536 CAGGGACACCTGCGGAGGGGAGG - Intergenic
933662941 2:84942537-84942559 GAGCTCCATCTGCATAGGGGAGG + Intergenic
935091872 2:99902486-99902508 GAGGTACACCTGCCTTGACGAGG - Intronic
941905022 2:170712075-170712097 GTGGTCCTCCTGCCTCGGGGCGG - Intergenic
942098871 2:172558544-172558566 AAGATACACCTGCCTGTGGGAGG - Intronic
945899447 2:215521369-215521391 GAGGCACATCTGCCTAGCAGAGG - Intergenic
948806796 2:240456555-240456577 GAGGGAAACGTGCCTGGGGGAGG - Intronic
1170052213 20:12158633-12158655 GAGGAACACCTGCTCATGGGTGG - Intergenic
1175155304 20:56967361-56967383 GGTTTACTCCTGCCTAGGGGAGG - Intergenic
1183365185 22:37403189-37403211 CAGGTGCACCTGCCTGGGGGTGG - Intronic
1184265790 22:43345134-43345156 GAGGGGCACCTGGCTAGGGCTGG - Intergenic
1185018919 22:48362253-48362275 AAGCCACACCTGCCTGGGGGTGG + Intergenic
950224714 3:11224330-11224352 GAGATACATCTAGCTAGGGGAGG + Intronic
951759493 3:26129878-26129900 GAGGGGCACCTGCCTATGTGAGG + Intergenic
954181828 3:48887441-48887463 ATTGAACACCTGCCTAGGGGTGG - Intronic
957790742 3:84937646-84937668 GAGGTAATCATGACTAGGGGAGG + Intergenic
961459783 3:127042958-127042980 GAGGCGCACCTGCCCTGGGGAGG - Intergenic
967327519 3:188256856-188256878 GAGGTACACATGCATACGTGTGG + Intronic
968160532 3:196423202-196423224 GAGGCACAGCTGCCCTGGGGAGG + Intronic
992072406 5:73159889-73159911 GTGGTGCACCAGCGTAGGGGAGG + Intergenic
994124670 5:96155668-96155690 GAAGTAGAGCTGCCTAGGAGTGG - Intergenic
999426061 5:151488545-151488567 GAGGTGCACCAGCAGAGGGGAGG - Exonic
1010990072 6:82470244-82470266 GAGGAACCCCCGCATAGGGGTGG + Intergenic
1012450434 6:99349048-99349070 GAGGGGCACCTGGCTAGGGCAGG - Intronic
1013276069 6:108585940-108585962 GAGGGACACATGCCTAAGGTCGG + Intronic
1015116918 6:129660041-129660063 GAGGTACAACCCCCTGGGGGAGG + Intronic
1015263782 6:131268231-131268253 GAAGTATATCTGCCTGGGGGTGG + Intronic
1015407284 6:132852065-132852087 GAGGATCACCTGACTAGGGGAGG + Intergenic
1017036174 6:150269373-150269395 GAGGCCCACCTGCATTGGGGAGG - Intergenic
1018682305 6:166274938-166274960 GAGGCACCCATGCCTTGGGGTGG - Intergenic
1018872764 6:167796023-167796045 GTGGCCCACCTGCCTCGGGGCGG - Intronic
1021484242 7:21149298-21149320 CAGATACACCTGGCTGGGGGAGG - Intergenic
1041028473 8:53711125-53711147 GAGCTTCACCTGCCAACGGGAGG + Intergenic
1050536425 9:6634663-6634685 GAGCTACAGCTGCCCATGGGAGG - Intronic
1055934272 9:81590305-81590327 GAAATAGACCTGCCCAGGGGTGG - Intronic
1191084346 X:56547954-56547976 GAGGGACACCTGCCTATATGAGG - Intergenic
1192137061 X:68612780-68612802 TAGGTAAACCTGCCTGGGGGCGG - Intergenic
1192896596 X:75448911-75448933 GAGGCCCACCTGCATTGGGGAGG - Intronic