ID: 902203526

View in Genome Browser
Species Human (GRCh38)
Location 1:14851369-14851391
Sequence GCTGGCAGTATGGGAGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902203526_902203533 10 Left 902203526 1:14851369-14851391 CCACTCACTCCCATACTGCCAGC 0: 1
1: 0
2: 2
3: 36
4: 300
Right 902203533 1:14851402-14851424 CCCACCGCTGCGATAGCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902203526 Original CRISPR GCTGGCAGTATGGGAGTGAG TGG (reversed) Intronic
900653828 1:3745208-3745230 GCTGGCAGGAACGGAGTGAATGG - Intergenic
900989826 1:6093261-6093283 AAAGGCAGTGTGGGAGTGAGTGG - Intronic
901879957 1:12187961-12187983 GCTGGCAGCAGGGGTCTGAGTGG + Intronic
902203526 1:14851369-14851391 GCTGGCAGTATGGGAGTGAGTGG - Intronic
903686223 1:25134224-25134246 ACTTGCAGAATGGGAGGGAGTGG - Intergenic
903830607 1:26171877-26171899 GCTGGCAGGATGGTAGGCAGTGG - Exonic
904811642 1:33166998-33167020 ACTGGCTGGATGGGAGTGATGGG - Intronic
904995399 1:34627645-34627667 GCTGACAGTGAGGGAGGGAGGGG + Intergenic
905693723 1:39960379-39960401 GCTGGCAGGATTGGGGTGGGTGG - Intronic
905796054 1:40817362-40817384 GCTGGGAGTCCGGGACTGAGGGG + Intronic
905796068 1:40817409-40817431 GCTGGGAGTCCGGGACTGAGGGG + Intronic
905796095 1:40817503-40817525 GCTGGGAGTCCGGGACTGAGGGG + Intronic
905892130 1:41524165-41524187 GCTGTCAGTCTGGGAGTGGGGGG + Intronic
906476612 1:46173568-46173590 TCTGGCAGGGTGGGAGAGAGTGG + Intronic
906637893 1:47421781-47421803 CCTAGAAGTATGGGGGTGAGGGG + Intergenic
907954144 1:59212512-59212534 GCTGGCACATGGGGAGTGAGGGG + Intergenic
909698172 1:78490984-78491006 GCTGGCAGCCTGGGAGGGATGGG - Intronic
910916055 1:92290611-92290633 GCTTGCAGCATGGGATTGAAAGG - Intronic
912813237 1:112809639-112809661 GGTGGCAGTGAGGGTGTGAGTGG + Intergenic
914323812 1:146591598-146591620 ACTGGAGGGATGGGAGTGAGTGG - Intergenic
915107163 1:153541816-153541838 GGTGGCAGGATGGGTGGGAGGGG - Intergenic
916582310 1:166120015-166120037 GCTGACTTTATGGGAGGGAGTGG - Intronic
919082775 1:192886760-192886782 TCTGGAGGTATGGGAGTCAGCGG + Intergenic
919691183 1:200529935-200529957 TCAGGCAGTATGTGAGTGTGTGG + Intergenic
919755723 1:201064991-201065013 CCTGGCAGGATGGGAGGAAGCGG + Intronic
919922561 1:202175038-202175060 GCTGGCAGTAGGGAGGTGGGTGG + Intergenic
919990284 1:202704595-202704617 GCAGGGAGAATGGGAGTTAGTGG - Intronic
920034033 1:203054109-203054131 GCTGCCAGTGCCGGAGTGAGAGG + Intronic
920311973 1:205053945-205053967 GCTGGCAGGAGGGGAAGGAGAGG + Intronic
921604120 1:217136215-217136237 TCTGGGAGTACCGGAGTGAGTGG + Intronic
921608681 1:217185050-217185072 GCTGGCACTATGCTAGTGTGGGG - Intergenic
922653992 1:227364926-227364948 GCTGCTAGTTTGGGAGAGAGGGG + Intergenic
1063142013 10:3263995-3264017 GCTGGCAGGTGGGGAGTTAGGGG - Intergenic
1064073194 10:12247678-12247700 GCTGGCAGGAAAGGAGAGAGTGG - Intronic
1064545994 10:16450358-16450380 GATGGCAGTATGGGTGGAAGAGG + Intronic
1067542637 10:47166742-47166764 CTTGGCAGCATGGAAGTGAGAGG + Intergenic
1067760063 10:49038447-49038469 GCTGGCTGGGTGGGAGTGGGGGG + Intronic
1067836947 10:49647321-49647343 GATGGCAGAATGGGAATGAATGG - Intronic
1068739412 10:60451700-60451722 GCTGGCATTATGGTAGTGCTGGG + Intronic
1068754565 10:60637027-60637049 GCTGGCACTATGGGCGTGTTTGG - Intronic
1069782718 10:70966920-70966942 GCTGGAGGTCTGGGAGTGATGGG + Intergenic
1069807760 10:71136622-71136644 GCTGGGAGTAGGGGAGAGAGGGG - Intergenic
1070036321 10:72728655-72728677 GGTGGGAGTGTGGGAGTGAGGGG + Intronic
1070665781 10:78342443-78342465 CCTGGTGATATGGGAGTGAGGGG + Intergenic
1070816221 10:79325184-79325206 GTTGGTAGGATGTGAGTGAGTGG + Intergenic
1071566442 10:86673701-86673723 GCAGGCAGCCTGGGAGTGTGGGG + Intronic
1073138254 10:101231290-101231312 GGTGGCAGTAAGCGAGTGGGGGG + Intergenic
1073311535 10:102546319-102546341 GCTGGCAGAGTGGGGGTAAGGGG - Intronic
1074281103 10:112052368-112052390 GGTGGCAGTGTGGGAGACAGCGG - Intergenic
1074774872 10:116760086-116760108 TCTGGCAGAATGAGAATGAGTGG - Intergenic
1075748295 10:124743444-124743466 GCGGTCAGGATGGGGGTGAGGGG - Intronic
1076898792 10:133326991-133327013 GCTGGCAGGAGGGCAGAGAGGGG + Exonic
1076944726 10:133638075-133638097 GCGGGCAGGGTGGGAGGGAGTGG - Intergenic
1079990141 11:27237941-27237963 GATGACAGTCTGGGTGTGAGAGG - Intergenic
1080413158 11:32045199-32045221 GCAGGATGTATGGGGGTGAGTGG - Intronic
1080626629 11:34036309-34036331 GAGGGCAGTAAGGGAGAGAGAGG - Intergenic
1080679435 11:34460421-34460443 GAAGGCAGCATGGGAGTGGGCGG + Intronic
1081263340 11:40988237-40988259 GCTGGGACCGTGGGAGTGAGAGG - Intronic
1081670381 11:44939061-44939083 GCTGGCGGTGGGGGAGTGGGGGG - Intronic
1081782930 11:45726059-45726081 GCTGGCTGCATGGGAGGGAGGGG - Intergenic
1084316847 11:68350557-68350579 GCCGGCACCATGGGAGTCAGGGG - Intronic
1087963947 11:104389414-104389436 GCTGGCAGTTTGTGAGTTTGTGG + Intergenic
1088437801 11:109834524-109834546 GCAGGCAGTAGGGGTGAGAGAGG - Intergenic
1089342497 11:117767963-117767985 GCAGGCAGAAGAGGAGTGAGAGG - Intronic
1089620043 11:119717021-119717043 GCTAGCAGTAATGGAGTGATGGG + Intronic
1091837569 12:3596355-3596377 GCCGTCAGTGTGGTAGTGAGGGG - Intergenic
1095968278 12:47883858-47883880 GCTGGCAGTACTGGAGGGGGTGG - Intronic
1096264337 12:50111483-50111505 GCTGGCGGGAGGGGAGAGAGAGG - Intergenic
1097159537 12:57036617-57036639 GGTGGGTGTCTGGGAGTGAGAGG - Intronic
1097192653 12:57226829-57226851 GGTGGCAGGTTGGGAGGGAGGGG + Intergenic
1098493975 12:71113473-71113495 GATTGAATTATGGGAGTGAGAGG - Intronic
1098967614 12:76808361-76808383 GCTGGGATTACAGGAGTGAGCGG - Intronic
1099676290 12:85764932-85764954 GCTGGGATTATAGGCGTGAGGGG - Intergenic
1100693220 12:97062154-97062176 GCTGGCAGAATGAGAGAAAGAGG + Intergenic
1100819131 12:98414763-98414785 GGTGGAAGGATGGCAGTGAGTGG - Intergenic
1101708657 12:107244452-107244474 GCTGGAAGTAGGAGAGTGATGGG + Intergenic
1101819385 12:108172114-108172136 GCTGGGACTATGGGAGAGAAAGG + Intronic
1102629961 12:114269373-114269395 GATGGCAGAAGGGGAGAGAGAGG + Intergenic
1103037964 12:117671801-117671823 GCAGGCAGGATGGGAGTTTGGGG - Intronic
1103446611 12:120999246-120999268 GCTGGCCGCAGGGGAGAGAGGGG - Exonic
1104773257 12:131377994-131378016 TGTGTCAGTGTGGGAGTGAGAGG + Intergenic
1105258269 13:18759624-18759646 GCTGGCAGTAGGGTGGTGAGAGG - Intergenic
1105263236 13:18795516-18795538 GCTGGCAGTAGGGTGGTGAGAGG - Intergenic
1105589959 13:21783229-21783251 GCTGGGGGTAAGGGAGTGAGGGG + Intergenic
1106163734 13:27223478-27223500 GCTGGCAGGAGGGGAGTAATGGG + Intergenic
1107349022 13:39494506-39494528 GTGGGCTGTATGGGAGTGAGCGG - Intronic
1107560705 13:41554633-41554655 GGTGGGAGTGTGGGTGTGAGTGG + Intergenic
1107606563 13:42063323-42063345 GCTGGTGGGAAGGGAGTGAGGGG + Intronic
1110940795 13:81345177-81345199 TCTGCTGGTATGGGAGTGAGAGG + Intergenic
1112404924 13:99110831-99110853 GATGGCTGAATGGGAGTGAGAGG - Intergenic
1113674622 13:112198766-112198788 TCTGGCAGTATGGGAAGCAGTGG - Intergenic
1113714894 13:112496644-112496666 GCTGGCCGTGTGGGAGTGGAAGG - Intronic
1116232035 14:42229512-42229534 GATGGCAGTAGGGGTGTCAGAGG + Intergenic
1116561819 14:46389251-46389273 TCTGGAAGGATGGGTGTGAGAGG + Intergenic
1117096997 14:52309281-52309303 GCTATCAGTAGGGGAGTGATGGG + Intergenic
1118045691 14:61968441-61968463 GCTGACAGTATAGGAGTGAAGGG + Intergenic
1118971517 14:70641960-70641982 GCGGGGAGAATGGGAGTGCGGGG + Exonic
1121181815 14:91934904-91934926 GCTGGCATTGTGGGGGTGGGGGG - Intronic
1121185544 14:91964647-91964669 GCTGGCACTATGGAAGAGAGGGG - Intergenic
1122044831 14:99016037-99016059 GCTGGCAGGCTGGCAGTCAGCGG + Intergenic
1122268446 14:100557511-100557533 GGTGGCAGTGATGGAGTGAGGGG - Intronic
1122378401 14:101284845-101284867 GAGGGCAGGATGGGAGTAAGAGG - Intergenic
1122692800 14:103539146-103539168 GGTGGGAGCATGGGAGGGAGGGG - Intergenic
1122904819 14:104796766-104796788 GCTGGCAGCAGGGGAGGGGGTGG + Intergenic
1122977586 14:105177243-105177265 GCTGGCAGGATGGGAGGCGGGGG + Intronic
1124149003 15:27160039-27160061 TCTTGCAGTATGACAGTGAGGGG - Intronic
1124991402 15:34677536-34677558 GCTGGCAGTGTGGAAGTCATTGG + Intergenic
1126899917 15:53304510-53304532 TTTTGCAGTAGGGGAGTGAGAGG + Intergenic
1127890946 15:63250438-63250460 GCTGGCAGAATGGTGGTCAGGGG - Intronic
1128279426 15:66382640-66382662 GCTGGGATTACGGGAGTGACAGG + Intronic
1129060569 15:72857473-72857495 CCGGGCAGTATGGAAGGGAGGGG - Intergenic
1130078228 15:80708582-80708604 GCTGGGATTATAGGAGTGAATGG + Intronic
1130090977 15:80821162-80821184 GCTGGCAGGATGGCATTGTGAGG + Intronic
1130820970 15:87495412-87495434 GATGGCAGAATGGGAGTTTGAGG - Intergenic
1131244465 15:90778527-90778549 GCTGGCAGGATGGGGATGTGAGG - Intronic
1131842058 15:96447909-96447931 GCTGGGATTACAGGAGTGAGCGG + Intergenic
1132044132 15:98549556-98549578 TCTGGCAGTTTAGAAGTGAGAGG + Intergenic
1132108941 15:99087973-99087995 GCTGCTAGTATGGGAGAGGGTGG - Intergenic
1133284420 16:4683940-4683962 GCTGGGGGTCTGGGGGTGAGGGG + Intronic
1133284881 16:4686028-4686050 GCGGGAGGTATGGGAGGGAGGGG + Intronic
1133747075 16:8695249-8695271 GCTGGCATTGTGGGAGAGAGAGG + Intronic
1134386735 16:13780547-13780569 GCAGGCAGTATGTAAATGAGTGG - Intergenic
1135839108 16:25857378-25857400 GTTGGAAGGATGGGAGTGATGGG + Intronic
1136092866 16:27933141-27933163 GTTGCCAGTATGGAAGGGAGGGG + Intronic
1136496592 16:30648926-30648948 GCTGGCAGTATGGGTGCCTGAGG - Intergenic
1137004059 16:35255856-35255878 GCGGGCAGGGTGGGAGGGAGTGG - Intergenic
1137019939 16:35414919-35414941 GCAGGCAGGGTGGGAGGGAGTGG - Intergenic
1138084372 16:54120294-54120316 GCTGGCAATATGGCAGTCAAAGG - Exonic
1138645068 16:58418745-58418767 GCTGACAGTCAGGGAGTGGGAGG + Intergenic
1139469743 16:67171774-67171796 CCTGGCAGAATGGGAGTGAGAGG + Intronic
1139659454 16:68410998-68411020 GCTGCCAGTGTTGGAGTGTGGGG + Intronic
1140009751 16:71119246-71119268 ACTGGAGGGATGGGAGTGAGTGG + Intronic
1140320874 16:73950635-73950657 GCTTGCAGTGAGGCAGTGAGGGG + Intergenic
1140646770 16:77039269-77039291 GCTGGGAGTATAGGAGGGAGAGG + Intergenic
1140911398 16:79456286-79456308 GGGGGCATAATGGGAGTGAGTGG - Intergenic
1141032393 16:80601298-80601320 GCTAACAGGATGGGAGGGAGTGG + Exonic
1141092431 16:81139445-81139467 GCTGGCAGTAGGGAAGGGATGGG + Intergenic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1142720191 17:1770805-1770827 GGTGGGAGTGAGGGAGTGAGAGG - Intronic
1142878644 17:2867673-2867695 GCTGGGAGTATAGGAGGGATGGG + Intronic
1143587794 17:7859428-7859450 GCTGGCAGCATGTGAGTTATAGG - Exonic
1143628885 17:8125973-8125995 GCTGGGAGGAGGGGAGTGCGAGG - Intergenic
1145973192 17:28968942-28968964 ACTGGCAGGATGGGAGAGGGAGG - Intronic
1146946904 17:36879640-36879662 GCAGGGTGTATGGGAGTGTGCGG + Intergenic
1147426399 17:40347808-40347830 GCTGGCAGAATGGGGTGGAGGGG + Intronic
1147630456 17:41927277-41927299 CATGGCAGTAGGGAAGTGAGGGG - Intronic
1148956220 17:51355773-51355795 GGAGGCAGTATGGGAGCGGGAGG - Intergenic
1150573008 17:66404702-66404724 GCAGCCAGCATGGGAGTGTGTGG - Intronic
1151493493 17:74446119-74446141 GCTGGGGGTATGGTAGTGACAGG + Intronic
1152121942 17:78424186-78424208 GCTGCCAGTAAGTGAGGGAGGGG + Exonic
1152351081 17:79784423-79784445 GCTGGCACCATGGGTGTGCGGGG - Exonic
1154425086 18:14265867-14265889 GCTGGCAGTAGGGTGGTGAGAGG + Intergenic
1154427804 18:14285267-14285289 GCTGGCAGTAGCGTGGTGAGAGG + Intergenic
1154432779 18:14321107-14321129 GCTGGCAGTAGGGTGGTGAGAGG + Intergenic
1155370719 18:25097535-25097557 ACTGGCAATATGGGAGTGTCTGG + Intronic
1157911870 18:51624068-51624090 AATGGCAGTTTGGGGGTGAGGGG - Intergenic
1158399833 18:57111885-57111907 GCCGCCAGTCTGGGAGTGGGAGG + Intergenic
1158620950 18:59032068-59032090 GCTGCCGGTGTGGGAGTGCGGGG - Intergenic
1161426347 19:4205595-4205617 CCTAGCACTATGGGAGTCAGAGG + Intronic
1161788088 19:6340672-6340694 GCAGGCAGTAAGGTAGTGACTGG + Intergenic
1161860143 19:6791912-6791934 TCTGGAAGGAAGGGAGTGAGTGG + Intronic
1162028222 19:7906050-7906072 GCTGGGAGTAAGGGAGGGGGAGG - Intronic
1162398532 19:10431541-10431563 GCTTGAAGTCTGGGAGTGACAGG + Intronic
1162739463 19:12765847-12765869 TCGGGCAGCATGGGAGAGAGAGG + Intronic
1163266698 19:16226393-16226415 GGTGGCGGTGTGGGCGTGAGGGG - Intronic
1163639567 19:18454003-18454025 GCTGGGAGCATGGGAGGGAATGG + Intronic
1163685982 19:18711854-18711876 TCTGGCAGTGTGGGGGTGGGTGG - Intronic
1164730733 19:30502326-30502348 GCTGGCAGTGTGGGTGGGAATGG + Intronic
1165270995 19:34707628-34707650 GGGGGCAGAATGGGAGAGAGTGG + Intergenic
1166915926 19:46196207-46196229 GGTGGCTGGAGGGGAGTGAGTGG - Intergenic
1166925117 19:46261582-46261604 GGTGGCTGGAGGGGAGTGAGTGG + Intergenic
1167603318 19:50466988-50467010 GCCTGCAGTTAGGGAGTGAGGGG + Intronic
1202637507 1_KI270706v1_random:55169-55191 GCTGGCAGTAGGGTGGTGAGAGG - Intergenic
925552055 2:5086908-5086930 ACAGGCAGTAGGGGAGTGATTGG + Intergenic
925909808 2:8566231-8566253 GAGGGCAGCATGGGAGGGAGAGG - Intergenic
926913905 2:17875903-17875925 GCAGGAAGGTTGGGAGTGAGGGG - Intergenic
926922181 2:17949916-17949938 GCCTGCAGTATGGGTGTGGGTGG + Intronic
927964897 2:27262567-27262589 GCCGGCCGGAGGGGAGTGAGAGG + Intronic
929594579 2:43168289-43168311 GCAGACAGTAAGGGACTGAGAGG - Intergenic
929632632 2:43480542-43480564 GCTGGGATTATAGGCGTGAGCGG - Intronic
933084794 2:78042689-78042711 GATGGAAGGATGGGAGTGGGAGG - Intergenic
933576989 2:84080332-84080354 ACTGCCAGAATGTGAGTGAGGGG + Intergenic
934493023 2:94775057-94775079 GCTGGCAGTAGGGTGGTGAGAGG - Intergenic
934888150 2:98042455-98042477 TTTGGCACTAGGGGAGTGAGGGG - Intergenic
935805713 2:106745719-106745741 GCTGGCAGGCTAGGGGTGAGAGG + Intergenic
936475940 2:112839773-112839795 GTTGGCACTAAGGGAGGGAGTGG + Intergenic
937939772 2:127275988-127276010 ACTGGCAGTGTGTGAGTGTGAGG + Intronic
939734807 2:145830307-145830329 GCTGGAGGTATGGGGGTTAGAGG + Intergenic
940272779 2:151909564-151909586 GCTGGGGGTTGGGGAGTGAGGGG - Intronic
940284460 2:152019951-152019973 GCAGTCAGAATGAGAGTGAGAGG + Intronic
940608174 2:155954751-155954773 GCTGACAGTATGGCATGGAGAGG + Intergenic
941042277 2:160635866-160635888 GCTGCCACTCTAGGAGTGAGAGG - Intergenic
942304081 2:174589081-174589103 GGTGGCAGTATTGGAGTCTGGGG - Intronic
943543765 2:189249639-189249661 GCTGACAGTTTGGGATTGAGTGG - Intergenic
943646559 2:190412703-190412725 ACTGGCATTTTGGGGGTGAGAGG + Intronic
944519105 2:200545691-200545713 CCTGGCAGAATGGGAGGGAGGGG - Intronic
945098175 2:206239158-206239180 GGTGGAAGCTTGGGAGTGAGGGG + Intergenic
945170389 2:206989312-206989334 AATGGCTGTACGGGAGTGAGAGG + Intergenic
945577638 2:211552064-211552086 GGTGGCAGAGTGGGAGTTAGTGG - Intronic
946182941 2:217959878-217959900 GCTGGGAGGGTGGGAGTGAGGGG + Intronic
946248074 2:218398498-218398520 GCTGGGAGTAGGGGCGGGAGGGG - Intronic
948316564 2:237031878-237031900 GCTGGCGGTGTGTGTGTGAGGGG - Intergenic
1169199557 20:3701614-3701636 GCTGTCAGGACTGGAGTGAGAGG + Exonic
1169744445 20:8929055-8929077 GCTGGCAGTAGGGGAGTAATGGG + Intronic
1170513840 20:17107196-17107218 TTTGGCAGTTTGGGAGGGAGCGG + Intergenic
1170550530 20:17472300-17472322 GGAAGCAGCATGGGAGTGAGAGG + Intronic
1171782063 20:29428070-29428092 GCGGGCAGGGTGGGAGGGAGTGG - Intergenic
1171884090 20:30639260-30639282 GCTGGCAGTAGGGTGGTGAGAGG - Intergenic
1172707257 20:36891382-36891404 CCTGGCACACTGGGAGTGAGGGG - Exonic
1172853471 20:37983408-37983430 GCTGGCAGTAGGGGAGGGATCGG + Exonic
1173888777 20:46486094-46486116 GCTGGCAATGTGGTAGTGGGAGG + Intergenic
1173982292 20:47234022-47234044 GCTGGCAAGATGGAAGTGACAGG - Intronic
1175211956 20:57364340-57364362 GCTGGCATTATGAGATTGAGAGG + Intronic
1175374129 20:58513371-58513393 CCTGCCAGTCTGGGAGCGAGAGG - Intronic
1176846959 21:13884157-13884179 GCTGGCAGTAGGGTGGTGAGAGG - Intergenic
1179134776 21:38669836-38669858 CCTGTCAGTATGTGAGTGAATGG - Intergenic
1179600504 21:42474477-42474499 ATAGGCAGTGTGGGAGTGAGGGG - Intronic
1182097475 22:27635869-27635891 GCTGGAAGTCAGGTAGTGAGGGG - Intergenic
1182320852 22:29478002-29478024 GCTGGGAGGATGGAGGTGAGTGG - Intergenic
1183086110 22:35488255-35488277 GCTGGCGGGATGGGATTTAGGGG + Intergenic
1183350338 22:37331253-37331275 GCTGGCAGTGGGGGAAGGAGGGG - Intergenic
1183715937 22:39533651-39533673 GCTGGGATTACAGGAGTGAGGGG + Intergenic
1184247105 22:43241331-43241353 GCTGGGAGCATGAGAGTGGGAGG - Intronic
949421664 3:3872552-3872574 GCTGGGAGTAAGGGAATGGGAGG - Intronic
950756178 3:15174674-15174696 GCTGGGTGTATGGGAGGGAAAGG - Intergenic
953208163 3:40850435-40850457 GGAGGCAGAATGGGAGAGAGAGG + Intergenic
953795975 3:45986344-45986366 GGTGGCAGTGGGAGAGTGAGAGG - Intronic
953814431 3:46142851-46142873 TCTGTCAGTATGGCACTGAGTGG + Intergenic
953927627 3:46990447-46990469 GGTAGCAGTCTGGGAATGAGAGG - Intronic
954962716 3:54580423-54580445 GCTGTGAGCAAGGGAGTGAGTGG - Intronic
956710233 3:72032646-72032668 GCTGGCAGGATGGGAGGAAGGGG + Intergenic
956733994 3:72222586-72222608 TCAGGCAGTATGCGAGTGATGGG + Intergenic
960672861 3:120169017-120169039 GCTGGACCTCTGGGAGTGAGTGG + Intronic
961478917 3:127167038-127167060 GATGGAAGTGTGGGAGTGAAGGG + Intergenic
967217239 3:187220919-187220941 GCTGGCAGTGTGGGGGCGCGGGG - Intronic
968350537 3:198048603-198048625 GTTGGCAGTAGGGTGGTGAGAGG - Intergenic
968884240 4:3318755-3318777 GCTGCCAGTGTGGGAGTGTGCGG + Intronic
973393303 4:49573895-49573917 GCTGGCAGTAGGGTAGTGAGAGG + Intergenic
975543732 4:75540071-75540093 CTTGTCAGTATTGGAGTGAGAGG - Intronic
975619757 4:76284488-76284510 ACTGGGATTATAGGAGTGAGTGG - Intronic
976213047 4:82691374-82691396 GGTGGAAGTGTGGGAGGGAGAGG + Intronic
976381431 4:84403912-84403934 GCTGGCAGGAAGAGAGTGAGTGG - Intergenic
976713460 4:88098841-88098863 GCTGGGATTATAGGAATGAGCGG - Intronic
980320588 4:131267805-131267827 GCTGCCAGTAGGCGAGGGAGAGG + Intergenic
980981653 4:139659308-139659330 GCTGGCAGGGTGGGCATGAGAGG + Intergenic
982530691 4:156539094-156539116 TATGGCAGAATGGGAGTGAATGG + Intergenic
983513914 4:168637215-168637237 GGTGGCAGAATGGGAGTGAAAGG + Intronic
985448111 4:190038584-190038606 GCGGGCAGGGTGGGAGGGAGTGG - Intergenic
985936951 5:3104761-3104783 GCTGGCAGTTTGGGAATCTGGGG + Intergenic
993129767 5:83880610-83880632 GCTGACAGTAAAGGAGAGAGAGG - Intergenic
993485215 5:88475697-88475719 GCTGGAAGTAAGAGAGTAAGTGG - Intergenic
997512765 5:134464952-134464974 GCAGGCAGTATACAAGTGAGTGG - Intergenic
997521027 5:134524870-134524892 GCTGGCAGGAGGGGAGTGGAGGG - Intronic
1000039262 5:157472962-157472984 GCTTGGAATATGTGAGTGAGAGG + Exonic
1002032733 5:176442479-176442501 GCTGGCAGAATGGGAAAGGGAGG - Intergenic
1003165173 6:3671221-3671243 CCTGGCTGCATGGGAGGGAGTGG + Intergenic
1003617969 6:7672637-7672659 ACTGTCAGCATGGGAGAGAGTGG - Intergenic
1004108779 6:12693683-12693705 CCTGGCATTATGGGAGTGTCAGG + Intergenic
1005044488 6:21628948-21628970 GCTGGGAGTTTGGGATTAAGTGG + Intergenic
1007103400 6:39267144-39267166 GCGGGGAGAATGGGACTGAGAGG + Intergenic
1007908837 6:45492149-45492171 GCTGGCAGGCTGGGGGTGAGGGG + Intronic
1010345789 6:74809384-74809406 GCTGGCAGAATGGGCATGGGTGG - Intergenic
1011489690 6:87877998-87878020 GCTGGCATCCTGGGGGTGAGGGG + Intergenic
1013185323 6:107752591-107752613 GGTGGGAGTGTGGGAGTGAATGG + Intronic
1013963542 6:115928730-115928752 GATGGGAGTGTGGGAGTGAGGGG - Intergenic
1015864827 6:137717529-137717551 GATGGCAGGATGTGAGTGAGAGG - Intergenic
1019006315 6:168799674-168799696 GATGGCAGTAGGGGAGAGAGAGG - Intergenic
1019763568 7:2832316-2832338 GCTGTGTGTATGGTAGTGAGTGG - Intronic
1021561993 7:21977547-21977569 ACTGGAAGTATGTGAGTAAGAGG + Intergenic
1021600564 7:22359143-22359165 GTTGGAGGTATGGGGGTGAGTGG - Intergenic
1021889595 7:25174279-25174301 GCTAGCAGAAAGGGAGAGAGAGG - Intronic
1022102229 7:27175406-27175428 GCTGAGGGTATGGGAGGGAGGGG - Intronic
1022762010 7:33365353-33365375 GCTGGCAGTATGAGATGTAGAGG + Intronic
1023082611 7:36539338-36539360 GCTGTCAATATGGGGCTGAGAGG + Intronic
1023109087 7:36792111-36792133 GTTGGCAGGTTGGAAGTGAGGGG - Intergenic
1023899258 7:44462617-44462639 CCTGGGAGTTTGGGAGTGTGTGG + Intronic
1024447863 7:49502659-49502681 GCTGCCAGTATGGGAAAGTGAGG - Intergenic
1025023104 7:55495402-55495424 GGCGGCAGGATGGGAGGGAGGGG - Intronic
1025258340 7:57400106-57400128 CCTGGCAGTGTGGGAGGGTGTGG + Intergenic
1028506934 7:91581034-91581056 GCTGGGAGGAAGGGAGTGGGTGG + Intergenic
1029291330 7:99504500-99504522 GCTGGAAGGCTGGGAGTGGGCGG - Intergenic
1030011535 7:105173466-105173488 TCTGGCAGCATGGGTGTTAGAGG - Intronic
1030971719 7:116065476-116065498 TCATGCATTATGGGAGTGAGTGG + Intronic
1031961735 7:127996115-127996137 GCAGGGAGTAAGGGAGAGAGAGG - Intronic
1032389041 7:131543947-131543969 GCTGGCATCATGGGACTGATGGG - Intronic
1032398865 7:131610041-131610063 GCTGGCCTTCTGGGAGGGAGAGG + Intergenic
1033073174 7:138223363-138223385 GCTGGGATTATAGGAGTGAATGG - Intergenic
1034550003 7:151814486-151814508 GATGGCAGGATGCGAGTGACGGG + Intronic
1034556059 7:151851071-151851093 GATGGCAGCAAGGGTGTGAGTGG - Intronic
1035767605 8:2119639-2119661 GCTGGCAGTGAGGGAGAGCGAGG + Intronic
1037127088 8:15364874-15364896 GCTGGGAGTAGGGGAGAGGGAGG + Intergenic
1037922392 8:22816398-22816420 GGTGGGAGTAGGGGGGTGAGAGG - Intronic
1038869938 8:31482806-31482828 TCTGGCATTATGGGAGGCAGTGG - Intergenic
1039411315 8:37357545-37357567 GCTGGCACTATGACAGTAAGAGG - Intergenic
1041100966 8:54396237-54396259 GGTGGAAGACTGGGAGTGAGAGG + Intergenic
1041206987 8:55509988-55510010 GCTGGGAGTAGGGGAGAGAGAGG - Intronic
1041220811 8:55649043-55649065 GGTGGGAGTATGGGAGTAGGGGG + Intergenic
1041383553 8:57277092-57277114 GCTGCCAGTATGGGGCTGAATGG + Intergenic
1041383722 8:57278484-57278506 GCTGCCAGTATGAGGCTGAGTGG - Intergenic
1042284666 8:67094831-67094853 GGAGACAGTATGGGAATGAGTGG - Intronic
1042857849 8:73285716-73285738 GCGGGCAGTGTGGGAGCCAGCGG + Intergenic
1043874277 8:85466340-85466362 GGTGGTGGTGTGGGAGTGAGGGG + Intronic
1045392756 8:101731782-101731804 GCTGGCAACCTGGGAGGGAGTGG - Intronic
1046951925 8:120027452-120027474 CCTGGCATTTTGGGAGGGAGAGG + Intronic
1048210479 8:132450495-132450517 GTTGGCAGTACGGAGGTGAGAGG - Intronic
1048860372 8:138720353-138720375 CCTGGCAGGGAGGGAGTGAGAGG - Intronic
1049486294 8:142865454-142865476 GCTGTCTGTATCGGACTGAGTGG - Intronic
1049549993 8:143252771-143252793 GCCGTCAGCATGGGGGTGAGGGG + Intronic
1049929994 9:446742-446764 TCTGGCACTATGAGAGTGAAAGG - Intronic
1051370215 9:16352893-16352915 GCTGGCAGTGGGAGAGTGTGGGG - Intergenic
1052518015 9:29508945-29508967 GGTGGTAGTATGGGGGTGGGAGG + Intergenic
1052878874 9:33587960-33587982 GCTGGCAGTAGGGTGGTGGGAGG + Intergenic
1053497099 9:38556260-38556282 GCTGGCAGTAGGGTGGTGGGAGG - Intronic
1053665526 9:40314882-40314904 GCTGGCAGTAGGGTGGTGGGAGG + Intronic
1053846661 9:42245116-42245138 GTTGCCAGGATGGGAGTGAAAGG - Intergenic
1053915109 9:42939929-42939951 GCTGGCAGTAGGGTGGTGTGAGG + Intergenic
1054376679 9:64454912-64454934 GCTGGCAGTAGGGTGGTGGGAGG + Intergenic
1054519088 9:66061402-66061424 GCTGGCAGTAGGGTGGTGGGAGG - Intergenic
1055654066 9:78436280-78436302 CCTTGCAATCTGGGAGTGAGGGG + Intergenic
1056460932 9:86809324-86809346 GCCAGCAGTATGGGAGGCAGAGG - Intergenic
1056860657 9:90177956-90177978 GCTGGCCATCTGGGAGAGAGAGG + Intergenic
1057418354 9:94885779-94885801 GCTAGCAGAATTGGAGTGTGTGG + Intronic
1057985879 9:99713282-99713304 GCGGGGAGTATGGGAGGTAGGGG - Intergenic
1059117151 9:111609990-111610012 GATGGCAAGATGGGAGTGTGTGG - Intergenic
1059238208 9:112780219-112780241 GCAGGCAGAATTGGGGTGAGAGG + Intronic
1060622301 9:125078590-125078612 GCTGGCAGTATAGGGGTGGTGGG - Intronic
1061627316 9:131848671-131848693 GCTGGCTTTGTGGGAGGGAGCGG + Intergenic
1061792166 9:133064546-133064568 GCTGGCAAGGTGGGAGTGGGTGG + Exonic
1062021439 9:134321221-134321243 GCTGGCAGTGTGGGGGTGGAGGG + Intronic
1062373330 9:136251479-136251501 GCCGGCAGTTTGGGTGTGGGAGG + Intergenic
1188987266 X:36779033-36779055 TCTGGCAGTAAGTGAATGAGTGG - Intergenic
1189153658 X:38733184-38733206 GCTGGCAGAAAGGTAGAGAGAGG - Intergenic
1189891749 X:45610277-45610299 ACTGGCAGCATGGCAGTGGGTGG + Intergenic
1195042992 X:101031223-101031245 CCTAGCAGTTTGGGAGTGTGAGG - Intronic
1195410225 X:104562239-104562261 ATTGGCAATGTGGGAGTGAGAGG - Intergenic
1195704404 X:107728642-107728664 GCTGGAATGATGGGAGTGGGGGG + Intronic
1195754048 X:108183499-108183521 GCAGGCAGTACGGGATTGAGTGG - Intronic
1198585132 X:138112027-138112049 GGTGGCAGGCTGGGAGGGAGTGG + Intergenic
1199732534 X:150650666-150650688 GCTGCCAGTGTGGGGGTGAGGGG - Intronic