ID: 902203950

View in Genome Browser
Species Human (GRCh38)
Location 1:14853681-14853703
Sequence CAAGAGACACAGCTGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 419}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902203950_902203963 28 Left 902203950 1:14853681-14853703 CCAGGCTCCAGCTGTGTCTCTTG 0: 1
1: 0
2: 6
3: 53
4: 419
Right 902203963 1:14853732-14853754 ACCCAGAATCAGGCTGCTCAAGG 0: 1
1: 0
2: 2
3: 20
4: 192
902203950_902203960 18 Left 902203950 1:14853681-14853703 CCAGGCTCCAGCTGTGTCTCTTG 0: 1
1: 0
2: 6
3: 53
4: 419
Right 902203960 1:14853722-14853744 CCCACCACTGACCCAGAATCAGG 0: 1
1: 0
2: 1
3: 20
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902203950 Original CRISPR CAAGAGACACAGCTGGAGCC TGG (reversed) Intronic
900181844 1:1314579-1314601 CATGAGAGACAGAAGGAGCCTGG + Intronic
900291965 1:1927456-1927478 CTTCAGACACAGCTGGATCCAGG - Intronic
900306204 1:2009825-2009847 AAAGAGGCACAGGTGGTGCCAGG + Intergenic
900326719 1:2111758-2111780 CAAGAAACAAGGGTGGAGCCAGG - Intronic
900390079 1:2430004-2430026 ACAGAGAAACAGCTGGAGCATGG + Intronic
900474578 1:2870147-2870169 GAGGGGACAGAGCTGGAGCCTGG - Intergenic
901277341 1:8002526-8002548 CAAGAGGCACAGCAAGACCCTGG - Intergenic
901423753 1:9168003-9168025 CTAGAGACAGGGCTGGAGCTGGG + Intergenic
902203950 1:14853681-14853703 CAAGAGACACAGCTGGAGCCTGG - Intronic
902254006 1:15175696-15175718 CAAGAGACAGAGCTTGTGCAGGG + Intronic
902399851 1:16151843-16151865 CCAGAGAGGCAACTGGAGCCTGG + Intronic
902988740 1:20171439-20171461 CAACCCACACAGCTGGTGCCAGG + Intronic
903785272 1:25857021-25857043 CAAGAGGATCACCTGGAGCCCGG + Intronic
903830932 1:26174086-26174108 CAAAAGACAAAGCTGGAGACGGG + Intergenic
904265024 1:29313189-29313211 CAAGAGAAAGATGTGGAGCCAGG - Intronic
904277780 1:29395405-29395427 CAAAATAGACACCTGGAGCCCGG - Intergenic
904542378 1:31241661-31241683 CAAGTGACAGTGCTGGAACCGGG - Intergenic
905263271 1:36733939-36733961 CAAGAATCTCAGCTGGGGCCAGG - Intergenic
906532371 1:46531144-46531166 GAAGAGACAGGACTGGAGCCTGG + Intergenic
907040168 1:51251781-51251803 CAAAAGAATTAGCTGGAGCCGGG + Intronic
907747000 1:57223491-57223513 CCAGAGACACGGCTGCAGTCTGG - Intronic
911975572 1:104489886-104489908 CAAGAGACAGGCCTGGAGTCAGG - Intergenic
912394315 1:109328947-109328969 CAGGTGAAACACCTGGAGCCCGG - Intronic
912495763 1:110090114-110090136 CAAGAGACACAGCCTTAGGCAGG + Intergenic
912511811 1:110194888-110194910 ACTGGGACACAGCTGGAGCCTGG + Intronic
912551024 1:110485389-110485411 GAAGTCACACAGCTGGTGCCTGG + Intergenic
912724181 1:112044176-112044198 CCAGAGACATTGCAGGAGCCAGG + Intergenic
912763096 1:112386289-112386311 CAAGGGAGTCAGCAGGAGCCAGG + Intergenic
915075875 1:153307670-153307692 CAAGAGACACAGTTGAGACCAGG - Intronic
915789606 1:158653741-158653763 CAAGAAATCCAGCTAGAGCCTGG - Intronic
915965983 1:160308620-160308642 CAGGAGTCTCAGCTGGATCCTGG + Intronic
917033443 1:170720382-170720404 AAAGAAACACAGCTGGAAACAGG - Intronic
917836080 1:178942567-178942589 CAGGTCACACAGCTGGTGCCTGG + Intergenic
918162786 1:181916931-181916953 GAAGAGACAAAAATGGAGCCAGG + Intergenic
919075365 1:192807290-192807312 CAGGAGACCCAGTTAGAGCCTGG - Intergenic
919364963 1:196648325-196648347 CACAAGACATTGCTGGAGCCAGG - Intergenic
919667869 1:200310080-200310102 CAAGAGACTGAGATGGGGCCAGG + Intergenic
919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG + Intergenic
920828616 1:209445838-209445860 CAAGGGACACAGCAGGCACCTGG - Intergenic
922534814 1:226372029-226372051 CACGAGCCCCAGCTGCAGCCAGG + Intronic
922619912 1:226983076-226983098 CAAGGGGCAGAGCTGGGGCCTGG + Intronic
922744771 1:228037684-228037706 CCAGAGAGGCCGCTGGAGCCAGG - Intronic
923022395 1:230175035-230175057 CTAGAGACACAGCAGGGGCCAGG - Intronic
923495341 1:234519727-234519749 AATGAGTCACAGCTGGTGCCAGG + Intergenic
923902180 1:238338111-238338133 CAATGAACACAGCTGGTGCCTGG - Intergenic
924944615 1:248838119-248838141 CAACAGACAAAGCGGGAGGCAGG + Intergenic
1064625217 10:17254450-17254472 GAACAGACACAGTTGGAACCAGG - Intergenic
1065822922 10:29542962-29542984 CCAGAGACAGAGCTGGAGCTTGG - Intronic
1065930292 10:30473013-30473035 CACGGGAGACAGCTGGGGCCAGG + Intergenic
1066991736 10:42521343-42521365 CAACACACACAATTGGAGCCTGG - Intergenic
1067521386 10:47009323-47009345 CAGGAGCCACACCTGCAGCCAGG + Intergenic
1067660352 10:48232769-48232791 GAAGAGACAGAGCTGGAGCAAGG + Intronic
1069097558 10:64278050-64278072 CATGTGACACAGAAGGAGCCAGG - Intergenic
1071505116 10:86227431-86227453 CAAGAGGCAAGGCTGGAGGCAGG - Intronic
1072193698 10:93096991-93097013 GAAGAGAACCAGCAGGAGCCGGG + Intergenic
1072350994 10:94556922-94556944 CAGGAAACACATCTGGAGACAGG - Intronic
1072758569 10:98037460-98037482 TAAAAGGCAGAGCTGGAGCCGGG + Intergenic
1072971449 10:100021019-100021041 CAATAGAGCCAGCGGGAGCCAGG - Intergenic
1073179976 10:101577783-101577805 CAAGAGCCACAGTGGGGGCCTGG - Intronic
1074701151 10:116093631-116093653 CAAGAGGTACAGCTGGAGCTCGG + Intronic
1074873978 10:117600277-117600299 CAAAAAACACAGCTGGTGGCAGG + Intergenic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1075917811 10:126184681-126184703 CAAGAGACAGAACTGAAGCGTGG - Intronic
1076010368 10:126983222-126983244 CAAGGGAGACAGATAGAGCCAGG - Intronic
1076381608 10:130027723-130027745 CAAGAGCCAAGGCTGCAGCCGGG + Intergenic
1076732800 10:132446818-132446840 CCAGAGCCACAGCAGGGGCCTGG + Intronic
1076851386 10:133095150-133095172 CAGGAGCCCCAGCTGGAGCTCGG + Intronic
1076853578 10:133104679-133104701 CAAGGAACACAGCTGGAACACGG - Intronic
1077135060 11:994350-994372 CCAGAGCCACAGCCAGAGCCTGG - Intronic
1077388676 11:2288826-2288848 CAAGAGCAACAGTTGGAGGCAGG - Intergenic
1077645312 11:3918440-3918462 CAGGAGACTGAGCTTGAGCCTGG + Intronic
1077877537 11:6320555-6320577 CCTGAGTCACAGCTGGAGCTGGG - Exonic
1077917690 11:6621995-6622017 CAGCAAACACAGCTGCAGCCCGG - Exonic
1077993054 11:7429184-7429206 CCAGAGACAAGGATGGAGCCAGG - Intronic
1078248934 11:9601394-9601416 GCAGAGACAGAGCTGGAGGCTGG + Intergenic
1079125829 11:17718254-17718276 AAAGAGACACAGCTAAGGCCTGG + Intergenic
1079282071 11:19096566-19096588 CTAGAAACACAGCTGGAGACTGG + Intergenic
1079733909 11:23971469-23971491 CATGCCACATAGCTGGAGCCAGG - Intergenic
1081600329 11:44488353-44488375 CCAGAGACAAGGCTGGAGGCCGG + Intergenic
1081666689 11:44920784-44920806 CAAGAGACACAGCAGGGGACAGG + Intronic
1081705882 11:45181593-45181615 CAACAAAAACAGCTGTAGCCCGG - Intronic
1081968619 11:47184211-47184233 CAAGGGACACAGCCAGACCCAGG + Intronic
1082115297 11:48321481-48321503 ACAGAGACACAGCTGGAACCTGG - Intergenic
1082258378 11:50057805-50057827 ACAGAGACACAGCTGGAACCTGG + Intergenic
1082759320 11:57111624-57111646 CAAGAGGCACAGGTTGAGCTTGG - Intergenic
1083059252 11:59852384-59852406 CAAGGGAGACATCTGGAGGCAGG + Intergenic
1083478059 11:62926592-62926614 CACGTGAAACTGCTGGAGCCCGG + Intergenic
1083750342 11:64757624-64757646 AAAGTCACACAGCTGAAGCCAGG - Intronic
1084360359 11:68665040-68665062 CACCAGACACAGCTGGGGACTGG + Intergenic
1084404635 11:68964125-68964147 CATCAGACATAGCTGGATCCTGG - Intergenic
1084409834 11:69000396-69000418 CTTCAGACACAGCTGGATCCAGG - Intergenic
1086074513 11:82835895-82835917 CTAAAGACACAGCTCTAGCCGGG + Intronic
1086210872 11:84317106-84317128 CAAGCAACACAGCTGCAGCCGGG - Intronic
1086334415 11:85785322-85785344 CAAGCAACACAGCTGGACCCAGG + Intronic
1086985233 11:93240817-93240839 GAACAGACACAGCTGAATCCAGG - Intergenic
1087167578 11:95020607-95020629 CAACAGACACAGCTTTATCCTGG + Intergenic
1087685964 11:101265549-101265571 CAAGACACACAGCCGTGGCCAGG + Intergenic
1088248328 11:107840692-107840714 CCAGAGAAGCAGCAGGAGCCAGG - Intronic
1089412988 11:118262747-118262769 CAAGTGACAGAGCTGCAGACAGG - Intronic
1089627020 11:119757752-119757774 AAAGAGACACAGCTGGAGCTGGG - Intergenic
1089668544 11:120035726-120035748 CCAGGGACACAGAAGGAGCCAGG - Intergenic
1089672471 11:120065981-120066003 CCAGACACACAGCTCGGGCCTGG + Intergenic
1089693332 11:120200033-120200055 CAAGAGAGGCAGGGGGAGCCAGG + Intergenic
1089733144 11:120532095-120532117 AGACAGCCACAGCTGGAGCCGGG + Intronic
1090501412 11:127265110-127265132 AAAAGGACACAGCTGGAGGCAGG - Intergenic
1090581065 11:128159659-128159681 CAAGAGATGAAGCTGCAGCCGGG + Intergenic
1091349821 11:134884164-134884186 GCAGGGACACAGATGGAGCCGGG - Intergenic
1091403019 12:192393-192415 CAGGACACACAACTGGGGCCAGG - Intronic
1091490936 12:932061-932083 CAAGAAAGACAACTGGAGCCAGG + Intronic
1091569573 12:1672786-1672808 AAAGTGACACAGCTCGGGCCTGG - Intergenic
1092152794 12:6262549-6262571 CAGGACACCCAGCGGGAGCCTGG + Intergenic
1094199565 12:27781778-27781800 CATGACCCACAGCTTGAGCCTGG + Intronic
1094355381 12:29572507-29572529 CCAGAGACACAGCTGGAGTCTGG + Intronic
1094713400 12:32987193-32987215 CAGGAAACAAAGCTGGGGCCTGG - Intergenic
1096210400 12:49760930-49760952 CAGGAGAAACACCTGAAGCCGGG - Intronic
1097281970 12:57850554-57850576 CAAGGGAGATAGCTGAAGCCAGG + Intergenic
1100262095 12:92942042-92942064 CAAGAGAATCAGTTGAAGCCAGG - Intergenic
1100745176 12:97637865-97637887 CCAGAGACGCAGCAGGATCCAGG + Intergenic
1101216702 12:102593056-102593078 GAAGAGAAACAGCTGGACACTGG - Intergenic
1101309305 12:103561759-103561781 GAAAAGACACACCAGGAGCCAGG - Intergenic
1101842620 12:108339332-108339354 CCAGAGAAACAGCTGGAGGGAGG + Intronic
1101857595 12:108456832-108456854 CCAGGGACACAGCGGGAGGCCGG - Intergenic
1101963333 12:109265801-109265823 CCAAAGTCACAGCTGGAGCAGGG + Intronic
1102229898 12:111255422-111255444 CAGCAGACACACCTGGAGGCAGG + Intronic
1103924020 12:124413889-124413911 GAAGAGACACAGGTGGTGGCGGG + Intronic
1103927820 12:124433490-124433512 CGAGGGACCCAGCTAGAGCCGGG - Intronic
1104382747 12:128322151-128322173 CAAGAGAGACAGATGGAGGCTGG - Intronic
1104665112 12:130642244-130642266 CCAGAGTCCCAGCCGGAGCCAGG - Intronic
1105214416 13:18275965-18275987 CATGGGGCACAGCTGAAGCCTGG + Intergenic
1105954068 13:25263402-25263424 CAATAGACACAGCTGTGGGCAGG + Intronic
1106393020 13:29354067-29354089 CAGGGGACTCAGGTGGAGCCTGG - Intronic
1106498002 13:30299081-30299103 CAAGAGGAACAGTGGGAGCCTGG + Intronic
1107500761 13:40972742-40972764 AAAGTTACACAGCTAGAGCCAGG + Intronic
1108418267 13:50222860-50222882 CAATACACACAGCTGCTGCCTGG + Intronic
1108688457 13:52841553-52841575 CAAGAGAGAAAGCTAAAGCCAGG - Intergenic
1108869986 13:54973019-54973041 CAAGAGGCACAGCTGGGCCAGGG + Intergenic
1110593808 13:77295449-77295471 CTTGAGACACAGATGGATCCGGG - Intronic
1111850222 13:93563703-93563725 CAAGAAAAACGTCTGGAGCCTGG + Intronic
1112575930 13:100636678-100636700 CCAGGGACACAGCAGCAGCCAGG + Exonic
1112793307 13:103027840-103027862 CAACAGACCCAGCTGGAGCCTGG - Intergenic
1113083777 13:106546357-106546379 GTAGAAACAAAGCTGGAGCCAGG - Intronic
1114455680 14:22851850-22851872 CAGGGGACAAAACTGGAGCCAGG - Intergenic
1116326851 14:43540989-43541011 CCAGAGCCAAAGCTGGAGCCCGG + Intergenic
1118989415 14:70784445-70784467 CAAGAAGCAAAGCTGAAGCCGGG + Intronic
1119035695 14:71228739-71228761 CAAAAGCTACAGCTGGGGCCAGG - Intergenic
1119558717 14:75572937-75572959 CCAGTGAAACAGCTGGAGCTCGG + Intergenic
1119609753 14:76051840-76051862 AAAGAGACAAAACTGCAGCCAGG - Intronic
1119766824 14:77195717-77195739 GAAGTGACAGAGCTGGTGCCTGG + Intronic
1120762357 14:88296531-88296553 AAAGAGAAACAGCTGCAGCATGG - Intronic
1121235442 14:92388561-92388583 CAACAGAGACAGCGAGAGCCAGG - Intronic
1121484849 14:94306610-94306632 TTAGTGGCACAGCTGGAGCCAGG - Intronic
1122099360 14:99394874-99394896 CAAAAGGCACAGCTAGGGCCAGG - Intergenic
1122183830 14:99974332-99974354 TAATAGCCATAGCTGGAGCCTGG + Intronic
1122390700 14:101380675-101380697 CAAGAGACAGGGCAGGGGCCAGG + Intergenic
1122650238 14:103221925-103221947 CAACAGCCAGAGCTGGAGACCGG - Intergenic
1123415842 15:20094593-20094615 TAAGAGACAGAGCTAGAGGCTGG - Intergenic
1123450910 15:20358328-20358350 GAGGGGACAGAGCTGGAGCCAGG - Intergenic
1123525182 15:21101707-21101729 TAAGAGACAGAGCTAGAGGCTGG - Intergenic
1125688772 15:41579643-41579665 TAAGAGACAAAGCTGGGGCCAGG - Exonic
1125794207 15:42392442-42392464 CAAGAGACACAGCTCCAGACAGG - Intronic
1126314367 15:47353657-47353679 GAAGATAAACTGCTGGAGCCTGG + Intronic
1126378745 15:48023832-48023854 CAGGAGCCACAACTGGAGGCAGG + Intergenic
1126921909 15:53536075-53536097 CAAGAGGCACAGCTGGGACTTGG + Intronic
1127263013 15:57339427-57339449 CAAGAGAGACAGCTGGTGGTGGG - Intergenic
1127810452 15:62560872-62560894 CAACCGAGGCAGCTGGAGCCAGG + Intronic
1128792380 15:70442724-70442746 CGAGAAACAGAGCTGGAGTCCGG - Intergenic
1128880396 15:71237093-71237115 CAAGAGATGCAGCAGGAGCCAGG + Intronic
1129596451 15:76967954-76967976 CAAGAGACACAGCTGTAACCTGG + Intergenic
1129781585 15:78275542-78275564 CAGGAGCCTGAGCTGGAGCCTGG + Exonic
1130580479 15:85133421-85133443 CAAGGGACACAGCTGGAAACTGG + Intronic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131541580 15:93279541-93279563 CAGGAGCCAAAGCTGGAGCCTGG + Intergenic
1132647185 16:1004474-1004496 CCAGAGAGACCCCTGGAGCCGGG + Intergenic
1132692282 16:1186991-1187013 CAAGAGACCCAGGAGGGGCCGGG - Intronic
1132725502 16:1336601-1336623 CCACAGACACAGCAGGGGCCCGG + Intronic
1133264757 16:4576303-4576325 CAACAGACACGGCTGCAGCTGGG + Exonic
1133835329 16:9362595-9362617 CAAGAGACAGAGCTTGTGCAGGG + Intergenic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1135048654 16:19174431-19174453 CAGGACCCACAGCTGGAGCCTGG + Intronic
1135201346 16:20440187-20440209 GAAGCAAAACAGCTGGAGCCTGG - Intronic
1135217763 16:20587677-20587699 GAAGCAAAACAGCTGGAGCCTGG + Intergenic
1135331950 16:21567763-21567785 TAAAAGCCACAGCTGGAGCCAGG - Intergenic
1135667847 16:24351030-24351052 CAGGAGACAGAGCTGGCCCCTGG - Intronic
1136079686 16:27843678-27843700 CTTCAGACACAGCTGGATCCAGG - Intronic
1137367800 16:47875830-47875852 CAGGTGACACAGCTGGTGACTGG + Intergenic
1137666735 16:50254198-50254220 CAACAGACACAGCAGCAGACAGG + Intronic
1138576623 16:57911582-57911604 CAAGAGCCACATCTTGGGCCGGG - Intronic
1139935642 16:70569004-70569026 CAAGTCACACTGCTGGGGCCCGG - Intronic
1141146293 16:81532633-81532655 CAGGAGACCCACCTGGTGCCAGG + Intronic
1141185019 16:81780492-81780514 CAAGAGAAACTGCTTGAGGCTGG - Intronic
1141710585 16:85696697-85696719 CAGGAGACTCACCTGGAGGCAGG + Intronic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1142482255 17:226269-226291 CAGGTGACACAGCAGGCGCCAGG + Intronic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1142822375 17:2480458-2480480 GAAGAGACACAGCCAGAGCCTGG + Intronic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1143101726 17:4508233-4508255 GAAGAGGCACAGCTGTGGCCAGG + Intronic
1143314910 17:6025222-6025244 GAAGAGACACAGCTTCAGCTTGG - Intronic
1144028369 17:11298470-11298492 AGAGAAACACAGCTAGAGCCTGG + Intronic
1144666154 17:17103596-17103618 TAAGAGACAGAGCAGGGGCCTGG - Intronic
1145304742 17:21667344-21667366 CCAGACACCCAGCTGGACCCAGG - Intergenic
1146058996 17:29594665-29594687 CAAGAGCCAGAGCTGGGCCCGGG + Intronic
1147317846 17:39629312-39629334 CAGGAGTCAAAGCTGGAGACTGG + Intronic
1147596692 17:41722615-41722637 CTAGAGAGACAGCTGGAGGCTGG + Intronic
1149764405 17:59262921-59262943 CAAGATACAAAGCTGTGGCCGGG - Intronic
1149993521 17:61395702-61395724 GAGGCGGCACAGCTGGAGCCCGG + Intergenic
1151035245 17:70791661-70791683 CAAGACACTCAGCTGGTGTCTGG - Intergenic
1151393451 17:73803419-73803441 CAAGAGGCACAGGAGTAGCCTGG - Intergenic
1151487436 17:74410024-74410046 GCAGAGCCACAGCTGGATCCAGG - Intergenic
1152120812 17:78417257-78417279 GAAGACACAAAGCTGGAGCCAGG + Intronic
1152337531 17:79707017-79707039 GAGGAGACAGAGCTGGAGCCAGG + Intergenic
1152388322 17:79988349-79988371 AATCAGCCACAGCTGGAGCCAGG - Intronic
1152745540 17:82037056-82037078 CAAGCGGCACAGCTGGGGACTGG + Intronic
1153166701 18:2269739-2269761 CAAGTCACACAGCTGGTGCATGG + Intergenic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1153602531 18:6795427-6795449 GAAGGCACACAGCTGCAGCCTGG + Intronic
1153842022 18:9015906-9015928 GGAGAGCCAGAGCTGGAGCCAGG - Intergenic
1154021657 18:10668788-10668810 AAAGAGGCAAAGCTGTAGCCAGG + Intronic
1154335254 18:13459955-13459977 CATGTGACAGGGCTGGAGCCAGG - Intronic
1154335262 18:13459993-13460015 CCAGTGACTGAGCTGGAGCCAGG + Intronic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1158725502 18:59968224-59968246 CAAGAGACAGAGATGGAGGCAGG + Intergenic
1160174623 18:76582750-76582772 TAAGACACACAGCTAGAGGCTGG - Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160533580 18:79579133-79579155 CAAGTAACGCAGCTGGAGGCAGG - Intergenic
1161055818 19:2190216-2190238 CACGAGACACAGCAGGACCGGGG - Intronic
1161065144 19:2233849-2233871 CAAGCCACTCAGCTGGAACCTGG + Exonic
1161419195 19:4166689-4166711 CAATAGAAACAGATGGGGCCAGG - Intronic
1161809626 19:6464521-6464543 CAGGAGAGACAACTGGCGCCAGG - Intronic
1161981837 19:7633977-7633999 AAGGAGACAGAGCTGGAGCTAGG - Intronic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162439534 19:10683871-10683893 CCGGAGACACTGCTGGACCCCGG + Intronic
1162496071 19:11024031-11024053 CAAGAGGGACAACTGCAGCCGGG - Intronic
1162888825 19:13717185-13717207 GAAGAGACAGAGCTGGACACCGG - Intergenic
1163546753 19:17945251-17945273 CAAGAGCCACAGCAGTGGCCTGG - Intergenic
1164436485 19:28234736-28234758 CAAGAGAGGCAGCCAGAGCCTGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1165184650 19:34007286-34007308 GATGAGACACAGCTGGAGCCTGG + Intergenic
1165952466 19:39481919-39481941 CAAGGGCCACAGCAGCAGCCGGG + Exonic
1166292661 19:41873048-41873070 CAAGCAACCCAGCTGCAGCCTGG + Intergenic
1166337865 19:42119578-42119600 CAAGAGAATCACCTGAAGCCGGG + Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166368907 19:42290870-42290892 CAAATGACACAGCAGGTGCCAGG + Exonic
1166488194 19:43232576-43232598 CAAAAGGCACAGCTGGAGGATGG - Intronic
1166494861 19:43293056-43293078 CAAAAGGCACAGCTGGAGGATGG - Intergenic
1166726448 19:45031227-45031249 TAAGAGACAGAGCGAGAGCCTGG - Intronic
1166866172 19:45838745-45838767 CCAGAGGCAGAGCTGCAGCCTGG - Intronic
1167011703 19:46813107-46813129 CATCAGAGGCAGCTGGAGCCGGG + Intergenic
926293218 2:11547314-11547336 GAAGACACACAGCTAGTGCCTGG - Intronic
926620329 2:15041426-15041448 CAAGAGAAACAGCTGCAGGGTGG + Intergenic
926723251 2:15978536-15978558 CAAGAGATGCAGCTGGTACCTGG - Intergenic
927801178 2:26101322-26101344 TAGCAGCCACAGCTGGAGCCTGG + Intronic
929386681 2:41416057-41416079 CAAGAGACAAATCTGAAGACTGG + Intergenic
929893359 2:45937258-45937280 CAAGGGACACAGCTATGGCCGGG - Intronic
931090076 2:58876312-58876334 GAAGAGGCACAGCTGGGGACTGG - Intergenic
931200360 2:60091817-60091839 GTAGAAACTCAGCTGGAGCCAGG - Intergenic
933337860 2:80983276-80983298 AAAAAGACACAGATGGAACCTGG + Intergenic
933727201 2:85433702-85433724 CAAGGGAAGCAGATGGAGCCAGG - Intronic
933759844 2:85665724-85665746 CCAGAGCCAGAGCAGGAGCCAGG - Exonic
933804405 2:85987683-85987705 AAAGTCACACAGCTGGAGCCAGG - Intergenic
935705795 2:105856127-105856149 CAAGAGGCACATGGGGAGCCGGG - Intronic
935858554 2:107302138-107302160 GAGGAGACAAAGCAGGAGCCAGG - Intergenic
936117406 2:109713078-109713100 CAAGAGACCCAGGTGGAGGAAGG - Intergenic
937274803 2:120677195-120677217 CAAGAGAAACAGCTCGTTCCAGG + Intergenic
938590410 2:132730400-132730422 CAAGAGACTCAGCTGAATCCAGG + Intronic
940553613 2:155193801-155193823 CAAAGGACACAGCTGGTGCAGGG - Intergenic
942267670 2:174244715-174244737 CAGGAGAAACAGCTTGAGCCCGG - Intronic
942399005 2:175581328-175581350 CACCAGACACAGATGGAGCCAGG + Intergenic
942572499 2:177328084-177328106 CAAGACAGACAGCTGGATTCAGG + Intronic
943662000 2:190569019-190569041 CAAAAGAAACAGCTGAGGCCAGG + Intergenic
945178311 2:207065814-207065836 CCAGAGGCACAGCTAGAGCTAGG + Intergenic
945304073 2:208241975-208241997 CAAGGTACAGAGGTGGAGCCTGG - Exonic
947303973 2:228722839-228722861 TGAGAGATACAGCTTGAGCCAGG + Intergenic
947525991 2:230877079-230877101 CAAGAGACATTGCTGGCACCTGG + Intronic
948589348 2:239039338-239039360 CAAGAGACACAGAGGTGGCCGGG - Intergenic
948655805 2:239476089-239476111 CAAGAGAGAGAGCTTGAGACAGG + Intergenic
948981526 2:241497149-241497171 CAGGAGCCCCACCTGGAGCCTGG - Intronic
1169548900 20:6681008-6681030 CAAAAGCCTCAGCTGCAGCCTGG - Intergenic
1170928199 20:20744943-20744965 CAAGAGAGAGAGGTGGTGCCAGG - Intergenic
1171453942 20:25256026-25256048 CAAAAGAAAGAGCTGGAGCCAGG - Intronic
1171522252 20:25784784-25784806 CCAGACACCCAGCTGGACCCAGG - Intronic
1171530001 20:25846729-25846751 CCAGACACCCAGCTGGACCCAGG - Intronic
1171554575 20:26071099-26071121 CCAGACACCCAGCTGGACCCAGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172614384 20:36274000-36274022 CAAGAGAGAGGTCTGGAGCCAGG + Intergenic
1173839014 20:46144879-46144901 CTAGAGAGAAAGCCGGAGCCTGG + Intergenic
1174024807 20:47565274-47565296 TAAGAGAGACATCTGGGGCCAGG - Intronic
1174287393 20:49482877-49482899 CAAGAGATGCCCCTGGAGCCCGG + Intergenic
1174365644 20:50054747-50054769 GAAGTCACACAGCTGGAGCTAGG + Intergenic
1175259753 20:57667097-57667119 CCAAAGACACAGCTGGAGGTGGG - Intronic
1175297524 20:57919292-57919314 GAAGAAACACCGCTGGAGACAGG + Intergenic
1175547603 20:59788647-59788669 CATCAGAAAGAGCTGGAGCCAGG - Intronic
1175871609 20:62211917-62211939 CAGGAGACAGGGCTGCAGCCAGG - Intergenic
1175940775 20:62536599-62536621 CAGGATACAGGGCTGGAGCCAGG - Intergenic
1176034783 20:63030926-63030948 CAAGAGTCAGTGCTGGGGCCGGG + Intergenic
1176161146 20:63649466-63649488 CCACAGACACAGCTGGTGCCAGG + Intronic
1176656059 21:9589783-9589805 CCAGACACCCAGCTGGACCCAGG - Intergenic
1178202703 21:30425827-30425849 GAAGAGCCACAGGAGGAGCCTGG + Exonic
1178599107 21:33980673-33980695 CAAGATGCACAGCTGGCCCCAGG - Intergenic
1178940738 21:36902946-36902968 AATGAGACACTGCTGGAGACAGG + Intronic
1180628109 22:17207940-17207962 CAAGGGGCACAGCTGGTGTCTGG - Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1182264501 22:29103262-29103284 TAACAGACCCAGCAGGAGCCAGG + Intronic
1182437523 22:30340337-30340359 CAAGATACTCATCTGGAGCAGGG + Exonic
1182543846 22:31061381-31061403 TAAGAGACAGAGCTAGAGACCGG + Intergenic
1182558477 22:31141538-31141560 GAAGAGACTCAGATGGAGCCTGG - Intergenic
1183267336 22:36836768-36836790 TGAGAGAGGCAGCTGGAGCCAGG + Intergenic
1184287978 22:43482759-43482781 CATGGGACAGAGCTGCAGCCAGG + Intronic
1184583855 22:45434643-45434665 CAAGAGGCCCAGTGGGAGCCTGG - Intergenic
1184743448 22:46442492-46442514 CAGGAGCCACAGCTGGGGGCAGG - Intronic
1185119137 22:48955356-48955378 CAGGAGACCCACCTGGAGCCTGG - Intergenic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949643354 3:6065401-6065423 ACAAAGACACAGCAGGAGCCTGG + Intergenic
950889017 3:16386789-16386811 CAAGGGACATGGCTGGGGCCCGG + Intronic
952611492 3:35215817-35215839 CCAGAGCCAAAGCTGGAGCCTGG + Intergenic
952701478 3:36332992-36333014 CAAGAGACAGAGCCAGAGCCAGG - Intergenic
952881533 3:37989038-37989060 CCAGAGACACAGAGGGAGGCTGG + Intronic
953170565 3:40503053-40503075 CAAGACACACACATGGAGCAGGG - Intergenic
954219172 3:49142299-49142321 CAAGGGTCACAACTGTAGCCTGG + Intergenic
954805849 3:53220018-53220040 CAGGAGGCACTGCTGCAGCCAGG + Intergenic
954902990 3:54035729-54035751 CAAGAGGAACAGCTGGATCTGGG + Intergenic
955160690 3:56462908-56462930 CAAATGGCAAAGCTGGAGCCTGG - Intronic
955246023 3:57225970-57225992 CAGGAGACTCAGTTGAAGCCGGG - Intronic
956642579 3:71428883-71428905 CAGGAGGCACTGCTGAAGCCGGG + Intronic
957913451 3:86654073-86654095 CAAGTAACCCAGCTGGAGTCCGG + Intergenic
959524905 3:107365851-107365873 CAAGAGACCCAGCTGGCAGCTGG + Intergenic
959587955 3:108042778-108042800 TCAGACACACAGCTGGATCCTGG - Intergenic
960951850 3:123004316-123004338 CAAGAGGCACAGCTGGAAAAAGG + Intronic
962201662 3:133405148-133405170 CAAAAGGAACAGCTGAAGCCAGG + Intronic
962669295 3:137689101-137689123 CCAGAGAAAAAGTTGGAGCCAGG - Intergenic
963196739 3:142540254-142540276 CAAGAGACACTTAAGGAGCCAGG + Intronic
965071982 3:163925803-163925825 AAATAGACACAGCTGGTGCCAGG - Intergenic
966946683 3:184781755-184781777 CAAGAGACACAACTGGAAAATGG + Intergenic
968058554 3:195711478-195711500 CAGGAGACTCACCAGGAGCCAGG - Intergenic
968484685 4:853508-853530 CATGAGACACAGCTCGCCCCCGG + Intronic
969335657 4:6508282-6508304 CAATAGAAACAGCTGAAGCTGGG + Intronic
969886248 4:10218023-10218045 CAAGAGCCACGGCTGGAGTTGGG + Intergenic
970423435 4:15926003-15926025 CAGGGCACCCAGCTGGAGCCAGG - Intergenic
972380929 4:38519706-38519728 AAAGAGACTCAGCTGGAGGGAGG + Intergenic
972556242 4:40183804-40183826 AGAGAGACACAGCAGAAGCCTGG - Intergenic
974168216 4:58231239-58231261 CAAGAGACTCAATTGGATCCTGG - Intergenic
974433494 4:61828749-61828771 CATCAGCAACAGCTGGAGCCTGG + Intronic
976093381 4:81480370-81480392 AAAGAGACAGATCTGGAGCTAGG + Intronic
977035109 4:91940979-91941001 CATGAGACAAAGATGAAGCCTGG + Intergenic
979653806 4:123167640-123167662 TAAGAAACACAGCTGTGGCCGGG - Intronic
981354695 4:143774573-143774595 CAAGAGAAAAAGCGGCAGCCAGG + Intergenic
983987594 4:174078997-174079019 CAAAAGAAACAGCTAGAGCGAGG - Intergenic
984688340 4:182696916-182696938 GAAGTGACAGAGCTGGAACCAGG - Intronic
984795546 4:183657210-183657232 CAAGAGAAACCTGTGGAGCCTGG - Intronic
985228437 4:187788821-187788843 AAAGAGACACAGGATGAGCCGGG + Intergenic
985519953 5:369533-369555 CAAGTGACACAGAGGGAGCCCGG - Intronic
985624351 5:977309-977331 CAAGAGCCCCAGCTGGAGGGTGG - Intergenic
985626298 5:990336-990358 CAGGGGACACAGCTCAAGCCTGG - Intergenic
986029350 5:3880874-3880896 ACAGAGGCACAGCTGGAGCTCGG + Intergenic
986348632 5:6856954-6856976 CAAGACAGAGTGCTGGAGCCCGG - Intergenic
986476263 5:8136852-8136874 CAAGCAACACAGCTGGTGACTGG - Intergenic
987130395 5:14854824-14854846 CCAGAGAGACAGCTGTGGCCTGG - Intronic
989317459 5:40099047-40099069 CCAGAGACACAGCAGCAGCTTGG - Intergenic
990307730 5:54509527-54509549 CAAGAGACACAGCTGCTCCAGGG + Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
992624438 5:78624480-78624502 CAAGAGACACATCCTCAGCCAGG + Intronic
992656567 5:78916248-78916270 TAAGAGACAAAGCTGTGGCCAGG + Intronic
993666888 5:90709994-90710016 CAAATCACACAGCTGGAGACTGG + Intronic
995807394 5:116068831-116068853 AAAGAGACATAGCAGGAGTCAGG - Intergenic
997024004 5:130036639-130036661 AAGGACTCACAGCTGGAGCCTGG - Intronic
997585195 5:135039684-135039706 CCAGAGCCAGAGCTGGATCCGGG - Intronic
997788125 5:136732414-136732436 CAAGAAAACCAGCTGGGGCCGGG + Intergenic
998167340 5:139851806-139851828 CGAGAGCCACACGTGGAGCCTGG - Exonic
998216442 5:140241478-140241500 CCAGAGACTCAGCTGGAGGCTGG - Intronic
998353287 5:141514661-141514683 CAAGAGACACAGGTACTGCCAGG + Intergenic
998420110 5:141977084-141977106 CAAGAGAGGCAGCTGGGGCTGGG - Intronic
999626042 5:153521341-153521363 TAAGAGGCAGAGCTGGAGTCAGG + Intronic
1000168312 5:158677144-158677166 CAACAAACAAAGCTGGAGGCTGG - Intergenic
1000850429 5:166333294-166333316 AAAGAGAAGCAGCAGGAGCCAGG + Intergenic
1001424813 5:171616166-171616188 TCAGAGACACAGGTGGGGCCAGG + Intergenic
1002034968 5:176461104-176461126 CAAGAGACATCGCTTGAACCTGG - Intronic
1002087027 5:176782412-176782434 CATGAGGCACAGCTGGATTCAGG + Intergenic
1002466445 5:179411140-179411162 CAAGAGAGCCAGCAGGAGCCTGG + Intergenic
1002547851 5:179963090-179963112 CATCACACACATCTGGAGCCTGG - Intronic
1003285603 6:4731445-4731467 GATGAGACACAGAGGGAGCCAGG - Intronic
1003315853 6:5011350-5011372 AAAGAGACACAGCAGGAGGAAGG + Intergenic
1004026025 6:11819287-11819309 CAAGAGAAAGATCTGCAGCCTGG - Intergenic
1005300554 6:24466046-24466068 CAAAAGAAACAGATGGAGGCTGG + Intronic
1005940301 6:30555670-30555692 CAACAGCCGCAGCGGGAGCCGGG - Exonic
1006424806 6:33957308-33957330 CAGGAGACAGAGCTTTAGCCAGG + Intergenic
1007423808 6:41734744-41734766 CAAGAGACCGAGCTGGAGGAAGG + Intronic
1007831414 6:44641624-44641646 CAATAGACAAAGCTGGAGTTTGG - Intergenic
1007925661 6:45647531-45647553 TTAGGGACACAGCTGCAGCCAGG + Intronic
1008497823 6:52151058-52151080 CAAGTGGCACAGCTGGAGAGTGG - Intergenic
1014222232 6:118809396-118809418 AGAAAGTCACAGCTGGAGCCAGG + Intergenic
1015708482 6:136113830-136113852 CAGGAGACAGAGCTGTAGACGGG - Intronic
1016300222 6:142622302-142622324 CCAGAGAGACAGATGGAGACTGG + Intergenic
1016622773 6:146131928-146131950 GAAGAGACAGAGCTGAAACCTGG + Intronic
1016800024 6:148158991-148159013 GCAGAGACACCTCTGGAGCCAGG + Intergenic
1017468412 6:154716550-154716572 CAAGAGAGCAAGTTGGAGCCGGG + Intergenic
1018154987 6:160977404-160977426 GAAGAGACACAGCTGCAGACAGG + Intergenic
1019011434 6:168846814-168846836 CAAGAGAAACAGCCGGACCCCGG - Intergenic
1019011505 6:168847146-168847168 CAACAGAAACAGCCGGACCCCGG - Intergenic
1019011520 6:168847219-168847241 CAAGAGAAACAGCTGGCCCCCGG - Intergenic
1019011590 6:168847552-168847574 CAAGAGAAACAGCTGGCCCCCGG - Intergenic
1019011635 6:168847773-168847795 CAACAGAAACAGCCGGACCCCGG - Intergenic
1019058088 6:169237092-169237114 GAGCAGCCACAGCTGGAGCCGGG - Intronic
1019511638 7:1420529-1420551 CAAGAGAAATAGATGGGGCCGGG - Intergenic
1019516497 7:1442504-1442526 CATCAGGCACAGCTGGATCCAGG + Intronic
1019572812 7:1720921-1720943 TAAGGGACACAGCTGGGACCTGG - Intronic
1019593184 7:1845972-1845994 CAAGAGACTCAGTTGGTGCCAGG + Intronic
1020383967 7:7577464-7577486 GAGGAGACAAATCTGGAGCCGGG + Intronic
1021625546 7:22589719-22589741 CAAGCCACACAACGGGAGCCTGG - Intronic
1021665948 7:22980082-22980104 CAAGGGTCAGACCTGGAGCCAGG + Intronic
1022863557 7:34393175-34393197 CAAGAGACACAGCTAGACTAGGG - Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023181775 7:37492111-37492133 CCAGAGCCAGAGCTAGAGCCAGG + Intergenic
1024181626 7:46901105-46901127 TTAGAGAGACAGCTGGAACCTGG + Intergenic
1024518432 7:50282062-50282084 CAAGAGGCCAAGCTTGAGCCTGG - Intergenic
1024656992 7:51459285-51459307 TCAGAAACACAGCTGGAGCCTGG - Intergenic
1024675250 7:51632277-51632299 CCAGGAACACAGCTGGAGCAGGG + Intergenic
1025021184 7:55481365-55481387 CCAGAGTCACAGCAGGAGCCAGG - Intronic
1025282746 7:57639959-57639981 CCAGACACCCAGCTGGACCCAGG - Intergenic
1025301971 7:57825458-57825480 CCAGACACCCAGCTGGACCCAGG + Intergenic
1026023777 7:66729685-66729707 CAGGAGACCCACCTGGAGACTGG - Intronic
1026671188 7:72392035-72392057 CAAGAGAAACAGATGGAACCCGG - Intronic
1026888406 7:73967947-73967969 CAGGAGACCCACCTGGAGGCTGG - Intergenic
1029347054 7:99986328-99986350 TAAGAGGCAGAGCTGCAGCCAGG + Intergenic
1030871536 7:114762313-114762335 AGAGAGACACAGGTGGATCCTGG - Intergenic
1032177777 7:129646608-129646630 GAAGAGGCACAGCTGGAGTTGGG + Intronic
1032422445 7:131793535-131793557 CAAGAGACACTGAAGGATCCTGG - Intergenic
1032442079 7:131949733-131949755 CCACAGAGACACCTGGAGCCTGG + Intergenic
1032640452 7:133760561-133760583 CAAGAGAAAGAGCAGGTGCCAGG - Intronic
1034702994 7:153113089-153113111 CAAGAGAATCGGCTTGAGCCAGG - Intergenic
1034848484 7:154470953-154470975 CGAAAAACACAGCTGCAGCCGGG + Intronic
1035311669 7:157973559-157973581 CATGAGACACAGCCACAGCCGGG + Intronic
1035660309 8:1342919-1342941 AAAGAGAAACAGCTGGTGCCTGG - Intergenic
1035757692 8:2046429-2046451 CAGGAGAGTCAGCTGGCGCCTGG + Intronic
1036634362 8:10538738-10538760 CAGGGGACAGAGCAGGAGCCAGG - Exonic
1038262393 8:26007675-26007697 CAAACCACAGAGCTGGAGCCAGG + Intronic
1040285847 8:46099998-46100020 CAAGAGACACAGAGGCACCCTGG - Intergenic
1041390958 8:57347227-57347249 CAGGAGAGACAGCTGGCGGCAGG - Intergenic
1042661590 8:71160551-71160573 CAAGATAGAGAGCTGGAGCTGGG - Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1045295754 8:100870518-100870540 AAAGGCACACAGCTGGAGGCTGG + Intergenic
1047233219 8:123015470-123015492 CGGGAGACACAACTGGGGCCAGG - Exonic
1047904059 8:129453945-129453967 CAAGGGAGACTGATGGAGCCTGG - Intergenic
1048288091 8:133158094-133158116 AAAGACACACAGCTTGAGCCTGG + Intergenic
1049211067 8:141386652-141386674 CAAGAGGCAGAGCCGCAGCCGGG - Intergenic
1049660937 8:143819449-143819471 CAAAGCAGACAGCTGGAGCCAGG + Intronic
1049720753 8:144114465-144114487 CAAGGGGCACACCTGGAGGCTGG - Exonic
1049999223 9:1058473-1058495 CAAGAGGCTGAGGTGGAGCCTGG - Intergenic
1053006877 9:34610839-34610861 CGAGGGCCACAGCTGGAGCTGGG + Exonic
1055626225 9:78179635-78179657 CAGGGAACAAAGCTGGAGCCTGG - Intergenic
1056743393 9:89279692-89279714 CAGGAGACACGGCAGGAGCTAGG - Intergenic
1058078410 9:100674274-100674296 CAAGAGACACATTTCGAGCTGGG + Intergenic
1058169130 9:101657871-101657893 AAAGAGACACAGATGCAGGCAGG - Intronic
1059063592 9:111059199-111059221 CAAGAGATACACCTTGATCCAGG - Intergenic
1059452821 9:114381372-114381394 CAGGAGACAGAGCTGCTGCCAGG + Exonic
1060104927 9:120867768-120867790 CAAGTTACCCAGCTGGAGCTTGG + Intronic
1060475684 9:123984890-123984912 CAAGTCACCCAGCTGGAGACTGG + Intergenic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060917129 9:127397966-127397988 CAAGAGGCTCAGCTTGCGCCCGG - Exonic
1061047487 9:128174450-128174472 TAAGAGATACAGCTGGACCCAGG - Intronic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1061502894 9:131013859-131013881 CAGGAGACCCAGCTGGCTCCAGG - Intronic
1061754047 9:132800275-132800297 CAACAGAAACACCTGGCGCCAGG - Intronic
1061868150 9:133506058-133506080 CTAGAGCCCCGGCTGGAGCCAGG - Intergenic
1062114054 9:134798084-134798106 CAGGTGACACAGCCGGTGCCAGG - Intronic
1062536546 9:137023617-137023639 CTAAAGGCACAGCTGGTGCCTGG - Intronic
1203633776 Un_KI270750v1:93243-93265 CCAGACACCCAGCTGGACCCAGG - Intergenic
1188156750 X:26750136-26750158 CAAAAGCCACAGCTGAAGACTGG + Intergenic
1190213998 X:48468295-48468317 CAAGAGAGACAGCGTGAGTCTGG - Intronic
1190369951 X:49730975-49730997 CTAGAGATACAGCTGGGGCAGGG + Intergenic
1190446242 X:50527354-50527376 CAAGTGAAACAGCAGGAGCTAGG - Intergenic
1192257164 X:69471358-69471380 CTACAGACACAGCTAGACCCAGG - Intergenic
1193080830 X:77404487-77404509 CAAGAGCCAGAGCTTGAGCCAGG - Intergenic
1196042256 X:111217548-111217570 CCAGAGACAGAGCTGCACCCAGG + Intronic
1196044285 X:111240549-111240571 AAGGAGACACAGCTCGTGCCAGG - Intergenic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1198433423 X:136590920-136590942 CAAGATACTCAACTGCAGCCTGG + Intergenic
1199616554 X:149660311-149660333 TAAGGGACACAGCTGGAAGCAGG + Intergenic
1199626087 X:149742937-149742959 TAAGGGACACAGCTGGAAGCAGG - Intergenic
1201668400 Y:16487033-16487055 CAGGAGACTCAGTTTGAGCCAGG - Intergenic