ID: 902205252

View in Genome Browser
Species Human (GRCh38)
Location 1:14863747-14863769
Sequence CAGGGGAAACTGAAGGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 359}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902205252 Original CRISPR CAGGGGAAACTGAAGGTGCA CGG Intronic
900302627 1:1985724-1985746 CAGGGGCCACTGAGGGTCCAGGG - Intronic
900832813 1:4977328-4977350 CAGGGAGTGCTGAAGGTGCAAGG - Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902521328 1:17018677-17018699 CAGGGGAATGTGAAGGTGCCAGG - Intergenic
902932435 1:19740923-19740945 CACGGGGCACTGAAGGTGCCTGG + Exonic
903365774 1:22804781-22804803 AAGAGGACACTGAAGGAGCAGGG - Intronic
903706497 1:25289646-25289668 CAGGGGAGACTGGATGTCCATGG + Intronic
903720742 1:25403712-25403734 CAGGGGAGACTGGATGTCCATGG - Intronic
904438303 1:30513602-30513624 CAGGGCCAACTAGAGGTGCAGGG + Intergenic
905132326 1:35770148-35770170 CTGGGGGAGCTGGAGGTGCACGG + Intergenic
905725589 1:40248885-40248907 CAGTGGAAACTTAAGGTGACAGG + Intronic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
906530506 1:46521075-46521097 CAGGGCAAAATGAAAATGCAGGG - Intergenic
907835922 1:58108220-58108242 CAGAGGAGACTGAAGCTGTAGGG + Intronic
908121928 1:60993988-60994010 CAGGGGCAAGTGGAGGTGGAAGG + Intronic
908983136 1:69983279-69983301 CATGGGAAGCTGAGGGAGCAGGG + Intronic
911110989 1:94185111-94185133 CTGGGCAAACTGCAGGTGGAAGG + Intronic
912048757 1:105495443-105495465 CTGGGGACACTGAAGAAGCAAGG - Intergenic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
912654798 1:111476725-111476747 CTGGGGAAACTTAAGCTGGAAGG + Intronic
912944973 1:114077380-114077402 CATGGAAAAGTGAAAGTGCATGG + Intergenic
913325264 1:117622828-117622850 CTGGGGAAACTGAAAGTGAGGGG - Exonic
913509688 1:119550450-119550472 CAGGAGAAAGAGAAGGCGCACGG + Intergenic
915267942 1:154732142-154732164 CAGGGGAAAGTGGAGATGGAGGG - Intronic
915334207 1:155131129-155131151 CAGGAGACAGTGATGGTGCAGGG + Intronic
915687886 1:157653593-157653615 CAGAGGAAACTGAAGCATCAAGG + Intergenic
916058549 1:161083993-161084015 CAGGGGATACTGATGGAGAAAGG - Intronic
916070421 1:161166720-161166742 TAGGGGAAACTAAGTGTGCACGG - Intronic
916578013 1:166084387-166084409 ATGAGGAAACTGAAGGTGAAAGG - Intronic
917001411 1:170365474-170365496 CAGGGGAATTTGAAGCTGAAAGG - Intergenic
917265572 1:173217194-173217216 CAGGGGAATATGAAGATGAATGG - Intergenic
917487029 1:175464843-175464865 GAGGGGACACTGAAAATGCAGGG + Intronic
919469169 1:197957586-197957608 CAGGGGAAGCTGATGATGCAGGG + Intergenic
919756566 1:201069730-201069752 CAGAGGACCCTGCAGGTGCAGGG - Intronic
921252050 1:213307427-213307449 CATGTGAAACTGAAGGCGTAAGG + Intergenic
922565284 1:226597584-226597606 AAGGGGAAACTCAGGGTTCAGGG + Intronic
922744497 1:228036669-228036691 CAGGGGACAGAGAAGCTGCACGG - Intronic
922935729 1:229420770-229420792 CAGGGGAAACCTAATGTGCTAGG + Intergenic
924226764 1:241928323-241928345 CAGTGCAAACTGAACATGCACGG - Intergenic
924710875 1:246529148-246529170 CAGGGGCAACTGAGGGTTCCTGG + Intergenic
1062944357 10:1449316-1449338 CACGGGGAAGTGAAGGGGCACGG - Intronic
1063382645 10:5595897-5595919 CAGGGGACCCTAAAAGTGCATGG + Intergenic
1066268014 10:33795157-33795179 GAAGTGAAACTGAAGGTGCTTGG + Intergenic
1066435550 10:35394085-35394107 GAGGGGAAACATAAGTTGCACGG - Intronic
1068005402 10:51387403-51387425 CAGTGGAAAATGAAAATGCAGGG - Intronic
1068594216 10:58885274-58885296 AAGAGGAAACTGAAGCTCCATGG - Intergenic
1068769292 10:60803158-60803180 CAGTGCAAAATGAAAGTGCAGGG + Intergenic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1071986185 10:91053114-91053136 CAGTGGAACCTAAAGTTGCAGGG + Intergenic
1072874952 10:99162733-99162755 CTTGGTAAACTGAAGGGGCAGGG - Intronic
1072996445 10:100249050-100249072 CAGGGGCAGCTGGAGGAGCATGG - Intronic
1073347680 10:102796540-102796562 CAGTGGAAACTGAAGTCACATGG - Intronic
1074254070 10:111782893-111782915 GAGCAGAAACTGAAGTTGCATGG + Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075791054 10:125084671-125084693 CAGGGGACACAGAACGGGCAAGG - Intronic
1076606523 10:131693056-131693078 CTGGAGAAACTGAAGCTGCGGGG - Intergenic
1076760617 10:132604164-132604186 GAGGGGACCCTGACGGTGCAGGG - Intronic
1077779008 11:5304562-5304584 CAGGGGACACTGATTGTACAGGG - Intronic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1082997537 11:59265660-59265682 CAGGGGACTCTGAAGGGACAAGG - Intergenic
1083052964 11:59793254-59793276 GAGGGGGAGCTGCAGGTGCAGGG + Intronic
1084105716 11:66978968-66978990 CAGCGAAAACAGAAGCTGCAAGG - Intergenic
1089085661 11:115815026-115815048 CAGGGGGAACTGGAGGCTCAAGG + Intergenic
1089416445 11:118296159-118296181 CAGGGGGAACTGGAAGTTCAGGG - Intergenic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1090334767 11:125954937-125954959 CAGGGGGAACTGGATGAGCAGGG + Intergenic
1091301499 11:134510764-134510786 CAGGGGCAGCTGGAGGAGCAGGG - Intergenic
1091333108 11:134746075-134746097 CAAGGGCAACTGAAGGTCCTAGG - Intergenic
1091404745 12:202198-202220 CAGGGGGAAGAGCAGGTGCAGGG - Intronic
1092855221 12:12666877-12666899 CAGGTGAAACTGAAGCTACCAGG + Intronic
1094691800 12:32776696-32776718 CAGGGGAAACAGACAGTGAACGG + Intergenic
1097178323 12:57156437-57156459 CAGGGGAAGCTGAGGGGCCAGGG - Intronic
1097486181 12:60204671-60204693 CTGGGGAAACTTAAAGTCCATGG + Intergenic
1097625777 12:61998589-61998611 ATGGGGAAACTGAAGCTCCAAGG + Intronic
1098621508 12:72606318-72606340 AAGGGGAAAATGAATGTGCTGGG + Intronic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1099555833 12:84107499-84107521 TAAGGGAAACTGAAGGTGAGAGG + Intergenic
1099848301 12:88057914-88057936 AAGGGGACATTGGAGGTGCATGG + Intronic
1102633384 12:114301352-114301374 CAGAGAGACCTGAAGGTGCAGGG + Intergenic
1103413779 12:120730804-120730826 CAGGGAGATCTGAAGGTGCTTGG + Intronic
1104253605 12:127120317-127120339 TAGGGGAAAATGAAGTTCCAAGG - Intergenic
1105768803 13:23587743-23587765 AAGAGAAAACTGAAGGTCCAAGG - Intronic
1106192526 13:27466274-27466296 CAGGTCAGACTCAAGGTGCATGG - Intergenic
1106247792 13:27963651-27963673 CAAGGAAAACTGAAACTGCAAGG + Intronic
1107154400 13:37149605-37149627 CAGTGGGAACTTAAGCTGCAAGG + Intergenic
1107452277 13:40520615-40520637 CGAGGGAAACAGAATGTGCATGG + Intergenic
1107904519 13:45049965-45049987 AAGGGGTAACTGAGGGAGCAAGG - Intergenic
1110413959 13:75232295-75232317 CAGAGGGAACAGAAGGTGCATGG - Intergenic
1111624672 13:90769381-90769403 CAGGGGAAGCTGAAAGTGAAGGG + Intergenic
1111984126 13:95048591-95048613 CTGGGAAAAATGGAGGTGCAAGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118790128 14:69083461-69083483 CAGTGGAACCTAAAGTTGCAGGG + Intronic
1118847291 14:69557294-69557316 CAGGGCAAAATGAAAATGCATGG - Intergenic
1120625926 14:86826432-86826454 AAGGAAAAACTGATGGTGCAGGG + Intergenic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1121777260 14:96598892-96598914 CAGGGGAAAGTGGAGCAGCAGGG - Intergenic
1122024882 14:98868436-98868458 GAGGGGAAATGGCAGGTGCAAGG + Intergenic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1122793093 14:104192667-104192689 CAGGGGAAAAGGAAGGGGCTGGG + Intergenic
1123668061 15:22625314-22625336 CAGGCATAACTGAAGGTGAAAGG - Intergenic
1124524035 15:30431751-30431773 CAGGCATAACTGAAGGTGAAAGG - Intergenic
1124534631 15:30534465-30534487 CAGGCATAACTGAAGGTGAAAGG + Intergenic
1124764018 15:32473134-32473156 CAGGCATAACTGAAGGTGAAAGG - Intergenic
1124774610 15:32575914-32575936 CAGGCATAACTGAAGGTGAAAGG + Intergenic
1129690105 15:77708357-77708379 CAGAGGAAACTGATGGAGCTGGG + Intronic
1130112529 15:80977501-80977523 AAGTGGAAACAGAAGGTACAGGG + Exonic
1130134979 15:81174882-81174904 CAAGGGAAACTGAATGTGTTTGG - Intronic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130822232 15:87507856-87507878 CAGCAGAAACTGCAGGTGCAAGG - Intergenic
1130924889 15:88377763-88377785 TGGGGGAAAATGAAGGTACATGG - Intergenic
1131789551 15:95949227-95949249 AGGAGGAAAGTGAAGGTGCATGG + Intergenic
1132295435 15:100730913-100730935 CAGGGCCCACTGAAGGTGCTGGG + Intergenic
1132738704 16:1400025-1400047 CAGGGGAGGCTGAGGGGGCAGGG + Intronic
1133184892 16:4088975-4088997 CTGGGGAAACTGAAGGGAAATGG - Intronic
1134033284 16:11009752-11009774 CAGGGGAAACTGAAGTACCAAGG - Intronic
1134252599 16:12584979-12585001 CATGAGAGACTGAAGGAGCAGGG - Intergenic
1134806625 16:17131482-17131504 CATGGGAACCTGGAGGTCCATGG - Intronic
1135028157 16:19014599-19014621 CAGGGGAAAGAGAAGGTGCTGGG - Intronic
1135582399 16:23639958-23639980 CAGGGGACGCTGAGGTTGCAGGG - Intronic
1135666251 16:24337902-24337924 CATGGGCAACTGAAGGGACATGG + Intronic
1135673176 16:24392065-24392087 CAGGGCACTCTGAAGGTTCAAGG + Intergenic
1136239624 16:28936252-28936274 CAGAGGAAACAGTAAGTGCAAGG - Intronic
1136317289 16:29461749-29461771 CAGGGGAACCCTCAGGTGCATGG + Exonic
1136349698 16:29698876-29698898 CTGGGGAAACTGAAGCCCCATGG + Intergenic
1136431864 16:30201092-30201114 CAGGGGAACCCTCAGGTGCATGG + Exonic
1136500336 16:30666976-30666998 CAGGAGAAAATGAAGGTACTGGG + Exonic
1137031525 16:35528568-35528590 CAGGGGAGACTCAGTGTGCATGG + Intergenic
1138369761 16:56517408-56517430 CAGAGGGATCTGCAGGTGCAAGG - Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1141375982 16:83531267-83531289 CAGGAGAAACTGAGGCTGAAAGG - Intronic
1141993379 16:87622666-87622688 CAGGAGGAGCTGAGGGTGCATGG + Intronic
1142850284 17:2701450-2701472 CCGGGGAACCGGAAGATGCACGG - Exonic
1143011192 17:3867146-3867168 CAGGGGAGGCTGAAGCTACAGGG + Intronic
1143779829 17:9223617-9223639 CAGGGGACACTGAAGACCCAGGG - Intronic
1144212095 17:13024302-13024324 GATGGGAAACTGAAGCTGAAAGG + Intergenic
1146725706 17:35154122-35154144 CAGGGGAATCTGAAGTTCCCAGG - Intronic
1147552600 17:41454859-41454881 CAGAGGAAACAGAATGTGCTAGG - Intergenic
1147671589 17:42179997-42180019 ATGGGGACACTGAAGGTGCCTGG + Intronic
1148129527 17:45254697-45254719 GAGGGGAGAATGAGGGTGCAGGG - Intronic
1149309648 17:55381772-55381794 CATGTGAGATTGAAGGTGCAGGG + Intergenic
1149656694 17:58313050-58313072 CAGGTGACACTCAAGCTGCAAGG + Intronic
1151455688 17:74224529-74224551 TAGGGAAAACTCAAGGTGGAAGG + Intronic
1152099161 17:78291102-78291124 CAGTGCAAAATGAAGATGCAGGG - Intergenic
1152994462 18:393574-393596 CAGGGCAACATGAAAGTGCATGG - Intronic
1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG + Intergenic
1156479124 18:37425178-37425200 CTGGGCAACCTGAAGGTGCTCGG + Intronic
1156586412 18:38436022-38436044 CAGGGGCAGCTGCAGGTGTAAGG - Intergenic
1157315020 18:46579735-46579757 CAGGTGAACTTGAAGGTGCTGGG - Intronic
1157718727 18:49907159-49907181 CTGGGGGAACTGAAGGTGATTGG + Intronic
1158556815 18:58482114-58482136 AAGGGAAAACTAATGGTGCATGG + Intronic
1158846651 18:61450354-61450376 CAGAGGAAAATGAAGATGAAAGG + Intronic
1158958076 18:62561369-62561391 CAGGAGAAACTGGAGGTGAGTGG - Intronic
1159058749 18:63492732-63492754 CAGAGGAGAATGAAGGAGCAGGG - Intronic
1159075781 18:63680264-63680286 AAGAGGAGACTGAAGGTGAAAGG + Intronic
1159555002 18:69936377-69936399 AATGGGAAACTGAAAGTGGATGG - Intronic
1159796512 18:72850942-72850964 CTGGGGAATCTGAATGTGCATGG + Intronic
1160176804 18:76601566-76601588 CGGGGGAGTCTGAAAGTGCAGGG + Intergenic
1161356973 19:3824577-3824599 CAGGGAACCCTGTAGGTGCAGGG + Intronic
1161849581 19:6731549-6731571 CAGGGGAGACTGAGGGTGGGAGG + Intronic
1161954156 19:7483497-7483519 CAAGGGACACTCGAGGTGCAAGG + Intronic
1162024862 19:7888252-7888274 CTGGGGAAACTGAGGGAGCTGGG - Intergenic
1162073878 19:8171751-8171773 CAGGGGAAACTGAGGCAGCCTGG - Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG + Intronic
1164859778 19:31553826-31553848 CAGGGCAAAGTGAGGCTGCATGG + Intergenic
1165426188 19:35746681-35746703 CATGGGAAACAGAAGCTGGAAGG - Intronic
1165821508 19:38679311-38679333 CCGGGCACACTGGAGGTGCATGG - Intronic
1166822577 19:45589574-45589596 CAGAGGGAACTGCAGGTGCAAGG - Intronic
1167339720 19:48907960-48907982 CAGGGGAGATGGAAGGTCCATGG - Intronic
1167410351 19:49340427-49340449 CAGGGGAATGTGAAGGCGGAGGG - Exonic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1168485129 19:56755006-56755028 AAGGGGAAAATGAAGGAGAAAGG + Intergenic
925379809 2:3416916-3416938 CAGGGCACAGTGAAGGGGCAGGG - Intronic
926670694 2:15574599-15574621 CGGAGGAAACTGAAGCTGCCAGG - Intergenic
927692060 2:25215504-25215526 CAGGGCAGACTGAAGCTGCAAGG - Intergenic
927904239 2:26846180-26846202 CGGCAGAAACTGAAGGAGCAAGG + Intergenic
929005678 2:37390656-37390678 CAGGGGAAACTCCAGGTGGGAGG + Intergenic
929393097 2:41494298-41494320 CAGGGGCAACTGAGGGTTCCTGG + Intergenic
929824424 2:45299271-45299293 CAATGGTCACTGAAGGTGCAGGG - Intergenic
930209319 2:48617961-48617983 AGGGGGAAACAAAAGGTGCAGGG - Intronic
930525248 2:52520854-52520876 GAGGAGAAACTGCAGGGGCAAGG + Intergenic
930907018 2:56582215-56582237 CAGAGGAAACTGAATTTGGATGG + Intergenic
932055056 2:68434936-68434958 CAGAGGAAACTGCAAGTGCACGG + Intergenic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932905938 2:75751269-75751291 CAGGTGATACTGATGGTTCAGGG - Intergenic
934523242 2:95032985-95033007 CAGCGGGAAGAGAAGGTGCAGGG + Intronic
935217856 2:100988812-100988834 CAGGGGGACCTGGAGGAGCAGGG - Intronic
936082809 2:109446508-109446530 CAGGGGAGGCTGAGGCTGCAGGG + Intronic
936674528 2:114699787-114699809 CAGAGGAACCAGAAGGGGCAAGG + Intronic
938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG + Intronic
939872378 2:147539902-147539924 ATGGGGAAACTGAAGCTTCAAGG - Intergenic
939956189 2:148529453-148529475 AAGGAGAGGCTGAAGGTGCACGG - Intergenic
941110402 2:161414745-161414767 CCCGGGAGACTGAAGGAGCAAGG - Intergenic
941666395 2:168247391-168247413 CTGGGGAAGCTGGACGTGCACGG + Exonic
942114178 2:172712153-172712175 CAGGGGAAACTGAAAACCCATGG - Intergenic
942869714 2:180720355-180720377 CAACGTAAACTGAAGGTGTAAGG - Intergenic
943571913 2:189583337-189583359 CAGAGGAAACTGAGGATGCCTGG - Intronic
944128156 2:196317579-196317601 CAGGGGAAGCTGCAGGAGCGGGG - Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
948917074 2:241039797-241039819 CAGGGGCAAATGGGGGTGCATGG - Intronic
1168756432 20:321618-321640 CAGAGGAAACAGCAAGTGCAAGG - Intergenic
1168850745 20:975221-975243 CAGGGGACACTGAGGTTCCAGGG + Intronic
1169933537 20:10858692-10858714 CAGTGGAAACTGCAAGAGCAGGG + Intergenic
1170137805 20:13094482-13094504 CAGGGAAAAATGAAGGGGAAGGG - Intronic
1171801129 20:29619017-29619039 GAGGGAAAACTAAAGGTGAATGG + Intergenic
1172039751 20:32035475-32035497 CAGGGGAGCTTGAAGGAGCATGG + Intergenic
1172791201 20:37506673-37506695 CAGAGGAAAATGAAAGGGCAAGG - Intronic
1174251872 20:49225982-49226004 CAGAGGGAACAGAAAGTGCAAGG - Intronic
1174286742 20:49479461-49479483 CAGCGGAAACAGCAAGTGCAAGG + Intronic
1175324202 20:58111134-58111156 CAGGGGACACTGACAGTCCAGGG - Intergenic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1176166941 20:63679343-63679365 GAGGGGACCCTGAGGGTGCAGGG - Intronic
1177333606 21:19694704-19694726 CAGGGGCAACAGAAGTAGCATGG + Intergenic
1178581759 21:33844319-33844341 CAGGGAAAATGGAATGTGCAGGG + Intronic
1179255813 21:39714326-39714348 CAAGGGAAACAGTAGATGCAAGG - Intergenic
1180065393 21:45409721-45409743 GAGGGGAAACTGAGGCAGCAAGG - Intronic
1180802040 22:18636523-18636545 CAGGGTCATCTGAGGGTGCAGGG + Intergenic
1180853277 22:19032075-19032097 CAGGGTCATCTGAGGGTGCAGGG + Intergenic
1181068606 22:20319061-20319083 AGGTGGAAACTGATGGTGCAGGG + Intronic
1181084848 22:20435137-20435159 CAGGGAAGACTCAGGGTGCAAGG - Intronic
1181219682 22:21358736-21358758 CAGGGTCATCTGAGGGTGCAGGG - Intergenic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1183217466 22:36490192-36490214 CAGGGGTACCTGAGGATGCAGGG - Exonic
1183313636 22:37125151-37125173 CAGGGAAAACTGAAGCTGAGAGG - Intergenic
1184149430 22:42629675-42629697 CAGGGGTACCTGAGGGTGCTGGG + Intronic
1184344855 22:43907133-43907155 GTGGGGAAACTGAAGCAGCAAGG + Intergenic
1184893947 22:47396373-47396395 CTGTGGAAACTGAAGGTCAAGGG - Intergenic
1185390794 22:50560747-50560769 AAAGGGCAACTGATGGTGCAGGG + Intronic
953055003 3:39381041-39381063 CATGGGAAGCTGGAGGTGAATGG - Intergenic
953409606 3:42683016-42683038 CAAGTGAAACGGAAGGCGCATGG - Intergenic
953704841 3:45223406-45223428 AAGGGGCAGCTGAAGCTGCAGGG + Intergenic
954403575 3:50332423-50332445 CAGGGGCAACTGAAGGCACATGG + Intronic
955556898 3:60147915-60147937 CAGTGGAAAATCAAGGTGGAAGG + Intronic
958822576 3:98992464-98992486 CAGAGGAAACTGAAGGGAGAGGG - Intergenic
959450608 3:106494677-106494699 CAGTGGCAACACAAGGTGCAAGG + Intergenic
960454945 3:117859626-117859648 GAGAGGAAACTGAGGGTGTAAGG - Intergenic
960713565 3:120555078-120555100 CAGGGGAAAATTAAGCAGCAAGG - Intergenic
961632762 3:128313301-128313323 CAGGGCAAAATGGAGATGCAAGG + Intronic
962168680 3:133077695-133077717 AAAGGAAGACTGAAGGTGCAGGG - Intronic
962672569 3:137724186-137724208 CAGGGGAAACTGTGGCTGTACGG - Intergenic
963596728 3:147337002-147337024 CAGGAGAAGCTGCAGCTGCATGG + Intergenic
964464930 3:156981352-156981374 CAGGGTAGACTGGAGATGCAGGG + Intronic
964767735 3:160195087-160195109 CCTGGGAAACTGAAGGTTCAAGG - Intergenic
965127056 3:164644402-164644424 CATAGGAAACTAAAGGTGCAAGG - Intergenic
967124759 3:186413613-186413635 CAGGGAGAACTGTAGCTGCAGGG + Intergenic
967992884 3:195144687-195144709 CAGGGGAAACTGAAACAGAAAGG - Intronic
968432292 4:566107-566129 CAAGGGTCACTGAAGCTGCACGG - Intergenic
970060311 4:12026081-12026103 CAGGTGAAACTGAAGTTACTGGG - Intergenic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
970566855 4:17340015-17340037 CAGGGGAAACTTAGGGGGAAAGG + Intergenic
972313244 4:37900640-37900662 CAGGAGAGACTGAAGATCCAGGG + Intronic
972636757 4:40891125-40891147 CTGGGGAAACTGAGGCTGAAAGG + Intronic
976104159 4:81599102-81599124 AAAGGGAAACTGAAGGAGCCAGG - Intronic
976502769 4:85811446-85811468 CAGGAGAAACTTAATATGCAAGG + Intronic
979150275 4:117304485-117304507 CAGGTGAAAGAGAAGGTGAAAGG + Intergenic
979580024 4:122347129-122347151 CATGGGAAACAGAAGATGCTGGG + Intronic
981026950 4:140086269-140086291 CAGGGGACGCTGATGGGGCAGGG - Intronic
981613631 4:146623054-146623076 CAGGGGCATCTGAAGATTCAGGG - Intergenic
982062229 4:151616134-151616156 CAGTGGAAACTGAATTTGTACGG + Intronic
982411227 4:155079829-155079851 CAGGGGAAATTATAGCTGCATGG + Intergenic
984565435 4:181324481-181324503 CAGTGGAAATTGCAGGGGCAGGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985008713 4:185560531-185560553 CTGGGAGACCTGAAGGTGCAGGG - Intergenic
985122353 4:186656605-186656627 CAGGGTAAACTGATGATGAATGG + Intronic
985200139 4:187476166-187476188 CAGGGGAAATTGAGGGTGCAGGG + Intergenic
985790890 5:1926387-1926409 CAGGGGAAGGGGAAGGCGCAGGG - Intergenic
986230369 5:5859075-5859097 CAGGTGGAATTGAAGGTGCTTGG - Intergenic
986308856 5:6536334-6536356 CAGGGAAAACAGCAGGTCCAGGG - Intergenic
986927675 5:12777779-12777801 CCGGGGAGGCTGAAGTTGCAAGG - Intergenic
987709611 5:21491425-21491447 CAGGGCCAGCTGAAGGTGCTGGG + Intergenic
988750002 5:34182741-34182763 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
989193375 5:38692567-38692589 CAGAGGAAAATTATGGTGCAAGG - Intergenic
991004856 5:61817977-61817999 CACGGGAAACTGCAGTTCCAAGG + Intergenic
991738262 5:69645943-69645965 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
991759931 5:69910479-69910501 CAGGGCCAGCTGAAGGTGCTGGG + Intergenic
991787400 5:70207619-70207641 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
991789838 5:70225669-70225691 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
991817722 5:70522062-70522084 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
991839161 5:70785542-70785564 CAGGGCCAGCTGAAGGTGCTGGG + Intergenic
991879846 5:71208004-71208026 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
991882286 5:71226028-71226050 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
992614493 5:78535529-78535551 CAGGGGACACTAAAGGGGCCAGG + Intronic
993001720 5:82387831-82387853 CTGGGGGAGCTGACGGTGCATGG - Intergenic
993060499 5:83032898-83032920 CAGGGCAAACTTAAGGAGTAGGG - Intergenic
994345380 5:98679465-98679487 CAGCGGAACCTAAAGTTGCAGGG + Intergenic
994421735 5:99532733-99532755 CAGGGCCAGCTGAAGGTGCTGGG + Intergenic
994461108 5:100067828-100067850 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
994485257 5:100381272-100381294 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
994988526 5:106968651-106968673 CAGGGGCAATGGAAGATGCATGG - Intergenic
997410063 5:133684264-133684286 CAGAGGAAGGTGAGGGTGCAGGG - Intergenic
999588316 5:153116086-153116108 GAGAGGAAAGTGAAGGTGAAAGG - Intergenic
1000759658 5:165206634-165206656 GAATGGAAACTGCAGGTGCAAGG + Intergenic
1000852709 5:166360100-166360122 TAGGGGACACTGAAGGTTTAAGG - Intergenic
1001084436 5:168690550-168690572 CAGGGAAGAATGAAGGGGCAAGG - Intronic
1002310511 5:178310951-178310973 AAGGGGAAACTGAGGCTGCAAGG + Intronic
1002395805 5:178953183-178953205 CAGGAGTCACTGAAGGGGCAGGG - Intronic
1003940350 6:11018639-11018661 CAGGTGATACTGAAGCTGCTGGG + Intronic
1005367003 6:25088795-25088817 AAGTGGAAACCGAAGATGCAGGG + Intergenic
1005548066 6:26889071-26889093 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
1005585153 6:27269092-27269114 GAGCGGAAACTGCAGTTGCACGG - Intergenic
1007391373 6:41551403-41551425 CAGGAGAGAAGGAAGGTGCAGGG - Intronic
1008488716 6:52063346-52063368 CATGAGAAAATGAAGATGCAAGG - Intronic
1008632991 6:53381750-53381772 GAGGGATACCTGAAGGTGCAGGG - Intergenic
1009018826 6:57930165-57930187 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
1011220422 6:85049125-85049147 TAGAAGAAACTGAAGCTGCATGG + Intergenic
1011519978 6:88194533-88194555 CAGGGCAAGCTGAAGGTGCTGGG + Intergenic
1011714873 6:90094785-90094807 CAGGGGAACCAGAAGTGGCATGG - Intronic
1012280161 6:97319133-97319155 GAGGGAAAAAGGAAGGTGCAAGG - Intergenic
1015626627 6:135185665-135185687 CAGGGGAATAGGAAGGTGCCAGG + Intronic
1015879068 6:137852594-137852616 CAGGGGAAACTGATTGCCCAGGG - Intergenic
1016932159 6:149422184-149422206 CTGGGGAAATCGAAGCTGCAGGG - Intergenic
1017159245 6:151349907-151349929 CAGGAGAGAATGAAGGTGCAGGG + Exonic
1017950838 6:159133317-159133339 CTGGAGAAAATGAAGGTGTAAGG - Intergenic
1018042098 6:159933830-159933852 CAGGGGAAGCTGATGGGGAATGG + Intergenic
1018096784 6:160394522-160394544 CAGGGAAAACTGCAGGCCCAAGG - Intronic
1020256157 7:6504025-6504047 GCGGGGAATCTGAAGGGGCAGGG + Intronic
1022301308 7:29105244-29105266 CAGCTGAGACTGAAGGTGCTGGG - Intronic
1022438015 7:30408713-30408735 CAGGGGGCACTGATGGTACAGGG - Intronic
1022636545 7:32141655-32141677 CAGGGGAAACTTAAAGAACAAGG + Intronic
1022789668 7:33674189-33674211 CAGGGCGAACTCAAGGGGCAAGG + Intergenic
1023103783 7:36744843-36744865 CAGGTTAAACTGCAAGTGCATGG - Intergenic
1023332998 7:39139095-39139117 CAGTGCAAAATGAAGCTGCAGGG - Intronic
1024178472 7:46864085-46864107 CAGGGCACAGTGAAGGTGGAGGG - Intergenic
1025025185 7:55510814-55510836 CATGGGAGCATGAAGGTGCAGGG - Intronic
1025251143 7:57352426-57352448 AAGGGGAAAATCAAGGTGCGGGG + Intergenic
1025928278 7:65976076-65976098 CAGGGCCAACTTAAGGTGCCAGG - Exonic
1027729164 7:81847930-81847952 CAGAGGACACTGCATGTGCAAGG + Intergenic
1029138934 7:98395992-98396014 CAAGGGAAACCTAATGTGCATGG + Intronic
1029189466 7:98761487-98761509 CAGGGGAAACAGCCAGTGCAAGG + Intergenic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029897456 7:103999174-103999196 CAGGAAAAAATGAAGGAGCATGG - Intergenic
1030313540 7:108091819-108091841 GAGCGGAAAATGAAGGTGTAGGG + Intronic
1031482904 7:122300161-122300183 CAGGGGACACTGCAGGGGCGCGG - Intergenic
1031546677 7:123059361-123059383 CAGGGGGAACTGTAGGATCAGGG - Intergenic
1033018753 7:137699781-137699803 CAGGTGAAATTGAAGGGGGAAGG - Intronic
1033192370 7:139293353-139293375 CAAGGGAAACTGGAAGGGCATGG - Exonic
1033662960 7:143415598-143415620 AAGGGGAAGCTGAAGTTGAAGGG + Intergenic
1034405607 7:150900702-150900724 CAGAGGAATCAGAAGATGCAAGG - Intergenic
1034695452 7:153049155-153049177 CAGGGGAAGCTGAATTTCCAAGG - Intergenic
1035071510 7:156148329-156148351 AAGGTGATACGGAAGGTGCAGGG - Intergenic
1035601143 8:897628-897650 CAGAGGGAACAGAAGATGCAGGG - Intergenic
1037635933 8:20701089-20701111 GAGGGGAAAACTAAGGTGCAGGG - Intergenic
1038145141 8:24888391-24888413 CAGGGGAAACAGCAGGTGATGGG + Intergenic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1039944517 8:42118067-42118089 GAGCGAAAACTCAAGGTGCAGGG + Intergenic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1046528509 8:115413534-115413556 GAGGAGAAATTGAAGGTCCAGGG - Exonic
1046541692 8:115591710-115591732 CAAAGGAAACAGAAAGTGCAGGG + Intronic
1047635468 8:126756868-126756890 CAGAGGAAACAGCACGTGCAGGG - Intergenic
1049052565 8:140210349-140210371 CAGAGGAAACTCCAGGCGCAGGG + Intronic
1049340119 8:142107685-142107707 GATGAGAACCTGAAGGTGCACGG - Intergenic
1049401655 8:142430337-142430359 CAGGGGAAACACAGGTTGCAGGG - Intergenic
1049583572 8:143423180-143423202 CAGGGGAGACTGGCGGGGCAGGG - Intronic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1051903511 9:22068432-22068454 TAGGGGAAATTGAAGGATCAGGG + Intergenic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1052755491 9:32536821-32536843 CAGGTGAAGCTGAAGGTGACTGG - Intergenic
1057080766 9:92172914-92172936 CAGGGGCACCAGCAGGTGCAAGG - Intergenic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1058670643 9:107358053-107358075 CAGTGCAAAATGAAAGTGCAAGG + Intergenic
1058939785 9:109802363-109802385 CAGGGCAAAATGAAAATGCAGGG - Intronic
1059408741 9:114118722-114118744 CTGGGGACACTGGAGGTGCTGGG + Intergenic
1059466719 9:114473401-114473423 CAGGGGACACTGAAGGGACCAGG + Intronic
1061415633 9:130445495-130445517 CAGGGTAAACTGAGGCTGCGGGG - Intronic
1185954321 X:4472740-4472762 CAGAGGAAACTGCAGGTGCTGGG - Intergenic
1187412351 X:19062346-19062368 CAGGGGAAACTGAAAGCAGAGGG - Intronic
1188264078 X:28048906-28048928 CAGTGGTAACTGAAAGTGCATGG - Intergenic
1188965394 X:36545352-36545374 CTGGGGAAAATGAAAGTGTAGGG - Intergenic
1190789033 X:53682789-53682811 CAGGGGAAATGGAAGAGGCAGGG + Intronic
1192778361 X:74268589-74268611 CAAAGGAAACTGAAGCTGAAAGG + Intergenic
1196779891 X:119374461-119374483 CAGAAGAAACTGCATGTGCAAGG + Intergenic
1198108971 X:133485800-133485822 AAGGGGAAACTGAGGGGGCAGGG + Intergenic
1198310579 X:135423923-135423945 CAGAGGAAACTGAGGCTTCAGGG + Intergenic
1198618101 X:138480350-138480372 CAGGGCTGACTGAAGGGGCAGGG - Intergenic
1200092584 X:153642793-153642815 CAGGAGACACGGGAGGTGCACGG - Intronic
1202378903 Y:24259946-24259968 CAAGGGAAACGGATGGTGGAAGG - Intergenic
1202491879 Y:25410175-25410197 CAAGGGAAACGGATGGTGGAAGG + Intergenic