ID: 902208437

View in Genome Browser
Species Human (GRCh38)
Location 1:14887024-14887046
Sequence CCTCACAACCACACTCGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902208437 Original CRISPR CCTCACAACCACACTCGTGG GGG (reversed) Intronic
900742285 1:4338028-4338050 GCCCATAACCACACTCGGGGTGG + Intergenic
900742746 1:4340560-4340582 CCTCCCATCCACATTGGTGGAGG + Intergenic
902208437 1:14887024-14887046 CCTCACAACCACACTCGTGGGGG - Intronic
904285920 1:29453247-29453269 CATGACCACCACACTCCTGGAGG + Intergenic
911414065 1:97548343-97548365 CCTCAAGACCACAGTCGTTGTGG + Intronic
913216946 1:116628572-116628594 CCTGCCACCCACACTCTTGGTGG - Intronic
915383068 1:155461536-155461558 CATCTGAACCACACTCGAGGAGG - Intronic
916356576 1:163916808-163916830 CCTGACAACCAGTCTGGTGGTGG - Intergenic
916925690 1:169518334-169518356 CCTCACTACCACAAACATGGAGG - Intronic
920036935 1:203072183-203072205 CCACACACCCACACTCCTGGAGG - Intronic
920501418 1:206487795-206487817 CCTCACAGCCACAGTTTTGGGGG - Intronic
1065115709 10:22480587-22480609 CCTGACACCCACCCCCGTGGTGG + Intergenic
1072846903 10:98841612-98841634 ACTCACAACCACATTTCTGGGGG - Intronic
1077211691 11:1374059-1374081 CCACACAACCAGCATCGTGGTGG - Intergenic
1077488920 11:2851546-2851568 CCTGACCACCACGCTGGTGGGGG - Intergenic
1083626276 11:64073715-64073737 CCTCCCAAACACACTCCTTGGGG + Intronic
1083735635 11:64678785-64678807 TCTCACAATCACACTCTCGGGGG - Intronic
1083988175 11:66230579-66230601 CGGCACAACCAGACTCGTGCTGG - Exonic
1089599159 11:119602914-119602936 CTTCACAACCACAGCCCTGGTGG + Intergenic
1089725252 11:120472123-120472145 CCACACACACACACACGTGGGGG + Intronic
1094317520 12:29149534-29149556 CCTCACACCCACCCTCCTCGAGG - Intronic
1105531441 13:21224291-21224313 CCTCAGAACCACAGTCGTTAGGG + Intergenic
1106544785 13:30721023-30721045 CCCCACAGCCACACACATGGGGG + Intronic
1112595851 13:100806216-100806238 GCTCACATTCACACTTGTGGGGG + Intergenic
1119956076 14:78799718-78799740 CCTCACAATCACAATCATGGCGG + Intronic
1122159691 14:99774088-99774110 CCTCTGAACCACACTTGGGGTGG + Intronic
1130608377 15:85338041-85338063 CCTCACAACCACTCAGCTGGTGG + Intergenic
1134383649 16:13751459-13751481 CCACACAACCACACTGGTTGGGG + Intergenic
1136280033 16:29203034-29203056 CCTCCCTACCACACACGAGGAGG - Intergenic
1141728347 16:85805635-85805657 CCCCAAAACCACACTTGTGAAGG - Intronic
1142084396 16:88168973-88168995 CCTCCCTACCACACACGAGGAGG - Intergenic
1144809456 17:17989420-17989442 CCTCAAATCCACCCTCATGGGGG - Intronic
1147242066 17:39097042-39097064 CCTCACAGCCTCACTCCTGGGGG - Intronic
1151069965 17:71197986-71198008 CCTCACATCCAGATTCTTGGGGG + Intergenic
1155900985 18:31389923-31389945 CCTCAAAACAACACTGGTGAAGG + Intronic
1157063501 18:44320857-44320879 CTTCACAACCACAGCCCTGGTGG + Intergenic
1159117204 18:64128462-64128484 CTTCACAACTACAGTCTTGGTGG + Intergenic
1160395070 18:78564723-78564745 CCTCACAAAGACACACGTGAGGG + Intergenic
925053381 2:834606-834628 CCTCACAACCACAGCCGGAGAGG + Intergenic
925738328 2:6983610-6983632 CCTCTCACCCACTCTCCTGGAGG + Intronic
927925732 2:27012331-27012353 CCACACCACCACACTGGTGCAGG - Intronic
929613603 2:43290716-43290738 CCACACAGCCACACTGATGGTGG - Intronic
936039712 2:109140992-109141014 CCTGACAACCAGACTCCTGTTGG + Intronic
938684539 2:133724871-133724893 ACACACAACCACACTCAAGGAGG - Intergenic
941417504 2:165240232-165240254 CCTCACATCCATACTGGGGGAGG - Intronic
942073662 2:172337397-172337419 CCTCACACCCTCCCTCTTGGTGG - Intergenic
942487054 2:176451047-176451069 CCTCACAACAACACTTCTGTTGG + Intergenic
1171349100 20:24489142-24489164 GCACACACCCACACTCATGGGGG + Intronic
1171475284 20:25403871-25403893 ACTCACAAACACACTCTTTGTGG + Intergenic
1175306032 20:57976230-57976252 CCTCACCACCACACTAGGAGTGG + Intergenic
1175663891 20:60841993-60842015 CCTCACAATCACAATCATGGTGG + Intergenic
1178960758 21:37062557-37062579 CATCACACACACACTAGTGGAGG + Intronic
1180818297 22:18806955-18806977 CCTGCCACCCACACTCTTGGTGG - Intergenic
1181204520 22:21241410-21241432 CCTGCCACCCACACTCTTGGTGG - Intergenic
1181455223 22:23055669-23055691 CCACAGAACCACCCTTGTGGAGG + Intergenic
1183671710 22:39276678-39276700 CCTCACAACCACACGGTTGGAGG - Intergenic
1183741266 22:39669908-39669930 CCTCACAGCCACCTTCCTGGAGG + Intronic
1184217846 22:43079233-43079255 CCTCACACCCACAGACATGGGGG + Intronic
1185253843 22:49820802-49820824 CCTCACAACCACCCCAGAGGTGG + Intronic
1203222405 22_KI270731v1_random:54005-54027 CCTGCCACCCACACTCTTGGTGG + Intergenic
1203268425 22_KI270734v1_random:32809-32831 CCTGCCACCCACACTCTTGGTGG - Intergenic
953647197 3:44766482-44766504 CCTCTCAACCACACTTGTCTGGG + Intronic
959962867 3:112320324-112320346 CCTCAAAAACACACACATGGAGG + Intergenic
961571953 3:127805577-127805599 CCTCACAACAACCCTAGTGGGGG - Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
967142684 3:186574824-186574846 TTTCAAAACCACACTCATGGTGG - Intronic
968171297 3:196512117-196512139 CCTCATAACCACAATCTAGGTGG - Intronic
969358977 4:6649294-6649316 CCTCATAACGACAATAGTGGTGG - Intergenic
969921091 4:10540441-10540463 CCCCACACCCACACTCTTGCTGG + Intronic
971954636 4:33400605-33400627 CTTCACAACCACAGCCCTGGTGG - Intergenic
972233445 4:37101801-37101823 CCTCAAAACCACACTGGTTTTGG - Intergenic
973017526 4:45159700-45159722 ACTCTCAACCACACTCAAGGGGG + Intergenic
975851906 4:78581173-78581195 TGACACAACCACACTCCTGGGGG - Intronic
981010283 4:139918330-139918352 CTTCACCACCACACTCCAGGTGG + Intronic
981360537 4:143840464-143840486 CCTCAGAAACACACTTTTGGGGG - Intergenic
981371303 4:143961529-143961551 CCTCAGAAACACACTTTTGGGGG - Intergenic
987802650 5:22719024-22719046 CCTCACAACCACCATCGGGTGGG - Intronic
987899892 5:23997860-23997882 CCTCTCAACCACTATCTTGGTGG + Intronic
989203551 5:38789480-38789502 CCTAACAACCACAGTCAAGGAGG - Intergenic
994320738 5:98392130-98392152 CCTCACAACCACGCCCCTCGTGG + Intergenic
1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG + Intronic
1007424454 6:41737681-41737703 CCTCCCAACCCCAATCATGGTGG + Intronic
1007451860 6:41946187-41946209 CCTCACAACCACTCTGTGGGGGG - Intronic
1012478809 6:99645130-99645152 CCTCACAATCACAATCATGGTGG + Intergenic
1012963717 6:105649834-105649856 CCTCACAACATCTCTCTTGGAGG - Intergenic
1014757182 6:125314324-125314346 CCTCACATCAACGCTGGTGGAGG + Intergenic
1015539140 6:134297056-134297078 CTTCACAACCACAGCCCTGGTGG + Intronic
1017456611 6:154606615-154606637 CCTCCCACGCAGACTCGTGGGGG + Intergenic
1018090226 6:160340312-160340334 CCTCAGAACCACACTGATGGGGG - Intergenic
1020127068 7:5539024-5539046 ACTCACAACCACTCTCCTAGAGG + Intronic
1024588638 7:50862145-50862167 CCTCACAACCACCCATGAGGTGG - Intergenic
1025959017 7:66204748-66204770 CCTCCCAACCACAGAGGTGGGGG - Intergenic
1026803069 7:73411933-73411955 TCTCCCACCCACACTCGGGGAGG + Intergenic
1033412248 7:141128677-141128699 CCTCCCTACCACACTCATCGTGG - Intronic
1033726568 7:144124581-144124603 CCTTACAACCCCACTGCTGGAGG + Intergenic
1034860286 7:154589104-154589126 CCTCACAAGCATACTTGTGCAGG - Intronic
1038172789 8:25153037-25153059 CCCAACAACCACACACGTGGAGG + Intergenic
1038495654 8:28000203-28000225 CCTCATAACCACCCTTGAGGTGG - Intergenic
1040575508 8:48647950-48647972 CCTCCCACCCACACCCGTGCAGG - Intergenic
1047747097 8:127853368-127853390 CCCCTCAAACTCACTCGTGGGGG - Intergenic
1057273462 9:93663969-93663991 CCTCACACCCACACTACAGGTGG - Intronic
1057943720 9:99306529-99306551 CCTCACAACCACGGCCCTGGTGG - Intergenic
1199619148 X:149683842-149683864 CCTTACAACCACATTGATGGTGG + Intergenic
1200045542 X:153398980-153399002 CCTCACCCCCACACACGTAGGGG - Intergenic