ID: 902209345

View in Genome Browser
Species Human (GRCh38)
Location 1:14893535-14893557
Sequence GGGTGTGGAGGAAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3084
Summary {0: 1, 1: 2, 2: 15, 3: 306, 4: 2760}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902209345_902209350 -7 Left 902209345 1:14893535-14893557 CCATCTTCCCTTCCTCCACACCC 0: 1
1: 2
2: 15
3: 306
4: 2760
Right 902209350 1:14893551-14893573 CACACCCTAACCTTGACTGATGG 0: 1
1: 0
2: 0
3: 5
4: 81
902209345_902209359 29 Left 902209345 1:14893535-14893557 CCATCTTCCCTTCCTCCACACCC 0: 1
1: 2
2: 15
3: 306
4: 2760
Right 902209359 1:14893587-14893609 ACTGCTACTGCTCTCCCTACAGG 0: 1
1: 0
2: 9
3: 12
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902209345 Original CRISPR GGGTGTGGAGGAAGGGAAGA TGG (reversed) Intronic
Too many off-targets to display for this crispr