ID: 902209345 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:14893535-14893557 |
Sequence | GGGTGTGGAGGAAGGGAAGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 3084 | |||
Summary | {0: 1, 1: 2, 2: 15, 3: 306, 4: 2760} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
902209345_902209350 | -7 | Left | 902209345 | 1:14893535-14893557 | CCATCTTCCCTTCCTCCACACCC | 0: 1 1: 2 2: 15 3: 306 4: 2760 |
||
Right | 902209350 | 1:14893551-14893573 | CACACCCTAACCTTGACTGATGG | 0: 1 1: 0 2: 0 3: 5 4: 81 |
||||
902209345_902209359 | 29 | Left | 902209345 | 1:14893535-14893557 | CCATCTTCCCTTCCTCCACACCC | 0: 1 1: 2 2: 15 3: 306 4: 2760 |
||
Right | 902209359 | 1:14893587-14893609 | ACTGCTACTGCTCTCCCTACAGG | 0: 1 1: 0 2: 9 3: 12 4: 182 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
902209345 | Original CRISPR | GGGTGTGGAGGAAGGGAAGA TGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |