ID: 902209957

View in Genome Browser
Species Human (GRCh38)
Location 1:14897823-14897845
Sequence GGTCCTGAGAGCCTTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902209957_902209966 20 Left 902209957 1:14897823-14897845 CCTCCTGAAAGGCTCTCAGGACC 0: 1
1: 0
2: 2
3: 25
4: 193
Right 902209966 1:14897866-14897888 CCGCTTGCTGAAACTAACCGGGG 0: 1
1: 0
2: 0
3: 0
4: 24
902209957_902209967 30 Left 902209957 1:14897823-14897845 CCTCCTGAAAGGCTCTCAGGACC 0: 1
1: 0
2: 2
3: 25
4: 193
Right 902209967 1:14897876-14897898 AAACTAACCGGGGCTCACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 52
902209957_902209963 18 Left 902209957 1:14897823-14897845 CCTCCTGAAAGGCTCTCAGGACC 0: 1
1: 0
2: 2
3: 25
4: 193
Right 902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG 0: 1
1: 0
2: 0
3: 3
4: 46
902209957_902209964 19 Left 902209957 1:14897823-14897845 CCTCCTGAAAGGCTCTCAGGACC 0: 1
1: 0
2: 2
3: 25
4: 193
Right 902209964 1:14897865-14897887 ACCGCTTGCTGAAACTAACCGGG 0: 1
1: 0
2: 0
3: 4
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902209957 Original CRISPR GGTCCTGAGAGCCTTTCAGG AGG (reversed) Intronic
900954667 1:5879118-5879140 GATCCTGGAAGCCTTGCAGGAGG + Intronic
901530277 1:9848707-9848729 GGACCTGAGAGCATCTCAGGAGG - Exonic
902209957 1:14897823-14897845 GGTCCTGAGAGCCTTTCAGGAGG - Intronic
902368415 1:15991545-15991567 GGTCATCAGACCCCTTCAGGAGG - Intergenic
902658441 1:17885400-17885422 GGTCCAGGAAGCCCTTCAGGTGG + Intergenic
903790862 1:25891984-25892006 GGCTCTAAGAGCTTTTCAGGGGG - Intronic
904400496 1:30253627-30253649 GGGCCTGAGAGTCATGCAGGAGG + Intergenic
905484557 1:38286132-38286154 GGTCCTGGGAGCCGTTTGGGGGG + Intergenic
906450471 1:45942063-45942085 GTCCCTGAGACTCTTTCAGGAGG - Intronic
908199117 1:61776247-61776269 GGCTCTGAGAGCCTTGCAGGTGG + Intronic
909950276 1:81711801-81711823 GGTCCCTGGACCCTTTCAGGGGG - Intronic
915614028 1:157021225-157021247 TGTCCTTAGATGCTTTCAGGTGG + Intronic
919911555 1:202114094-202114116 TGTACTGAAAGCCTTTCATGTGG - Intergenic
921044496 1:211464881-211464903 GGTCCTAACACCCTTTCAAGGGG - Intergenic
922038574 1:221873731-221873753 GGTCATGAGAGACTTTATGGTGG - Intergenic
922149153 1:222982297-222982319 GTTCCTGAGACCCTTTCATGGGG - Intronic
923032037 1:230256905-230256927 GGTCAAGAGAACCTTTGAGGAGG + Intronic
923539988 1:234881590-234881612 GTCCTTGAGACCCTTTCAGGAGG - Intergenic
1062901752 10:1151940-1151962 GTTCACGAGAGCCTTCCAGGCGG + Intergenic
1064679228 10:17792720-17792742 GGCCATGTGAGCCTCTCAGGAGG + Intronic
1065888946 10:30104173-30104195 AGTCCTGAGAGGGTTGCAGGTGG + Intronic
1066478672 10:35773676-35773698 GGTCCTGCAAGGCTTCCAGGGGG + Intergenic
1072226049 10:93369993-93370015 GTCCCTGAGACCTTTTCAGGAGG + Intronic
1072531660 10:96325023-96325045 GGCCCTGCCAGGCTTTCAGGTGG - Intronic
1074492192 10:113947946-113947968 GGTGCTGAGTGGCCTTCAGGTGG + Intergenic
1076070770 10:127486707-127486729 GTCCCTGAGACCCTTTCAGGAGG + Intergenic
1076663139 10:132068733-132068755 GCTCCTGAGAGCCTTCCAGAGGG - Intergenic
1076796988 10:132803208-132803230 TGTCCTGGGGGCCTTTCAAGGGG - Intergenic
1077047828 11:554138-554160 TGTCCTGAGAGCCCTGGAGGTGG + Exonic
1077454165 11:2667951-2667973 GAGCCTGAGAGGCTTTCTGGGGG - Intronic
1080615267 11:33940123-33940145 GGGGCTGAGAGCCTGTCAGTGGG + Intergenic
1082056994 11:47826522-47826544 GTCCCTGAGACCATTTCAGGGGG + Intronic
1083068500 11:59950562-59950584 GGTCCTGGGAGCCGTGCAGGTGG + Intergenic
1083340442 11:61955573-61955595 GCTCCCGAGCGCCTTCCAGGAGG + Intronic
1084034058 11:66497321-66497343 GATCCTGAGAGTCTTGCTGGAGG + Exonic
1088813709 11:113407925-113407947 GGTCCTGAAGGACTCTCAGGTGG - Intergenic
1088907930 11:114168977-114168999 GGTTCTGGGAGCCTTGCAGGAGG + Intronic
1089281220 11:117375927-117375949 GGTCCTGACTGCCTTTCACGGGG + Intronic
1090051105 11:123380723-123380745 TGGCCTGAGATCCTTTCAGATGG + Intergenic
1090633464 11:128670949-128670971 GTTTCTGAGAACCTTGCAGGAGG - Intergenic
1091610252 12:2001287-2001309 GTTCCTTAGATCCTTTAAGGAGG + Intronic
1091725811 12:2845758-2845780 GGTCCTGAAAGCCTTTGGTGGGG - Intronic
1092283129 12:7112402-7112424 GGCCCTAAGATCCTTTCACGGGG + Intergenic
1092964604 12:13629513-13629535 GGCCCTGACAGCCTTTGAGAAGG - Intronic
1096268863 12:50147520-50147542 GATCCAGAGACCCTTTCAGTAGG + Intronic
1096324160 12:50643545-50643567 GGTCCTGCAATCCTATCAGGAGG + Intronic
1096876885 12:54636297-54636319 GGGCCTGGGAGCCTTGAAGGTGG + Intergenic
1096976087 12:55699902-55699924 GGTCCTGGGAGCCGGTCAGCAGG + Intronic
1097669758 12:62521498-62521520 GTCCCTGAGACCATTTCAGGTGG - Intronic
1098898195 12:76085562-76085584 GGTCCCCAGACCCTTTCATGGGG + Intergenic
1100622712 12:96294747-96294769 GCTCCTGAGACCCTTGTAGGAGG - Intronic
1100673616 12:96843314-96843336 AGTCCACAGAGCCCTTCAGGAGG + Intronic
1100889686 12:99111049-99111071 TGTCCTGATTGCCTTCCAGGGGG - Intronic
1104624289 12:130338987-130339009 GGACCTGAGAGCTCTGCAGGAGG + Intronic
1105776766 13:23669641-23669663 GGTCATAAGACCCTCTCAGGTGG + Intronic
1107503642 13:41007828-41007850 GATCCAGAGACCCTTTCAGGGGG + Intronic
1108098439 13:46929458-46929480 AGTCCTGAGAGCATTGAAGGTGG - Intergenic
1108510224 13:51148864-51148886 AGTCCTGGGAGCCTTTGAGGTGG - Intergenic
1109897928 13:68718851-68718873 GCTCCTGAAAACCTTTCAGTGGG + Intergenic
1114251625 14:20966649-20966671 GGTTCTTAGAAACTTTCAGGTGG - Intergenic
1115263533 14:31477363-31477385 GATCCTGAGAGCCTATAAGAAGG - Intergenic
1115857518 14:37646939-37646961 TGTCCTGAAAGACTTTCATGTGG - Intronic
1119703491 14:76770328-76770350 GGTCCTGAGTGACTTGCTGGTGG + Intronic
1124683144 15:31754846-31754868 GTCCCTGAGAAGCTTTCAGGAGG - Intronic
1125854198 15:42933441-42933463 TGTTCTGAGATCCTTCCAGGAGG - Intergenic
1126778328 15:52118299-52118321 GTCCCTGAGACCCTTTCAGGGGG + Exonic
1127478003 15:59352781-59352803 AGACCTTAGAGCCTTTGAGGGGG - Intronic
1127544324 15:59976214-59976236 GATCCTGAGAGCCCTTCATGAGG - Intergenic
1129410607 15:75348402-75348424 GATCCTAAGACCCTTTCAGATGG + Intronic
1130151329 15:81313783-81313805 GCTCCTGGGACCCTTTCAAGGGG + Intronic
1132112187 15:99109770-99109792 TGACCTGAGAGGCCTTCAGGTGG + Intronic
1135055799 16:19231259-19231281 GGTTTTGAGTGCCTTTCAGAAGG - Intronic
1137408823 16:48210897-48210919 GGTCCTGAGAGCCTGGCAGCTGG + Intronic
1141572216 16:84941046-84941068 GGTCCTGGCCGCCTCTCAGGAGG - Intergenic
1142668335 17:1475089-1475111 GCTCCTGAGGCCCTTTCAGCAGG - Intronic
1144360545 17:14487557-14487579 GGTCTTAAGAGCCTTCCATGGGG - Intergenic
1145081173 17:19895618-19895640 GTCCCTGAGACCCTTTCTGGAGG - Intergenic
1146579839 17:34027258-34027280 GGTACTGAGATATTTTCAGGTGG - Intronic
1147753949 17:42755864-42755886 GGGCCTGACTACCTTTCAGGGGG - Intergenic
1149610305 17:57954724-57954746 GGAGCCGAGCGCCTTTCAGGGGG - Intronic
1151115591 17:71731598-71731620 TTTCCTTAGAGCGTTTCAGGTGG + Intergenic
1153478130 18:5518772-5518794 GGCCCTGTGTGCCTGTCAGGAGG - Intronic
1154073429 18:11176637-11176659 AATCCTGAGAGCCTTACAGAGGG - Intergenic
1155491302 18:26404538-26404560 GGTCCTGTGGGCCATGCAGGAGG + Intergenic
1155909825 18:31494793-31494815 GGTCCTCTGAGCTATTCAGGAGG + Intergenic
1157522292 18:48353649-48353671 GGTTCTCAGGGCCTTTCTGGGGG + Intronic
1157559619 18:48637250-48637272 GGTCCTGAGAGGCTTGTGGGTGG + Intronic
1157720396 18:49918930-49918952 GTTCCTGTGAGCCTTTGAGAAGG - Intronic
1158580075 18:58672930-58672952 GTTCCTGAGACCCTTTCGCGGGG - Intronic
1158954551 18:62525302-62525324 GGTCCAGTGAGTCTTTGAGGAGG + Intronic
1163662956 19:18589394-18589416 CTTCCTGGGGGCCTTTCAGGTGG + Exonic
1164401168 19:27903289-27903311 GGTCCTGAGAGGTCTCCAGGGGG + Intergenic
1165142128 19:33705861-33705883 AGTCCTGAGAGCATTCAAGGAGG + Intronic
1166380919 19:42354786-42354808 GGTCCTGAGCCCACTTCAGGTGG - Intronic
1167044377 19:47041144-47041166 GGCCCTGAGTGCCCTGCAGGAGG - Intronic
1167119405 19:47507685-47507707 GGTCTCGAGAGCCGTGCAGGAGG - Intronic
1167210788 19:48133026-48133048 GGTCCTGAAACGCTTTGAGGAGG - Exonic
1167272705 19:48515052-48515074 GTCCCTGAGACCCTTTCAAGGGG + Intergenic
1168104177 19:54156578-54156600 GGTCCTGACACCCTTTCCCGGGG - Intronic
925844283 2:8021160-8021182 GAGCCTGAGAGGCTGTCAGGAGG + Intergenic
926350966 2:11994175-11994197 GGTCCAGAGGGCGTTCCAGGAGG + Intergenic
926382260 2:12302393-12302415 GGACCTGTGAGCTTTTCATGGGG + Intergenic
930022207 2:47008249-47008271 GGTCCTGGACTCCTTTCAGGAGG + Intronic
930835217 2:55785626-55785648 GGGTCTGAGAGCCATTAAGGAGG - Intergenic
931268091 2:60678329-60678351 GTTCCTAAGACCTTTTCAGGAGG - Intergenic
936234911 2:110733862-110733884 GGACCCAAGAGCATTTCAGGCGG + Intronic
937265178 2:120610829-120610851 AGTCATGAGACCCTTTCTGGAGG + Intergenic
938240357 2:129738332-129738354 GGTGCTGTGAGGCTTTCAGCTGG - Intergenic
945663852 2:212718060-212718082 GGATCAGAGAGCCTTTCTGGGGG - Intergenic
946035074 2:216735258-216735280 GGCCATAAGACCCTTTCAGGGGG + Intergenic
947193423 2:227535884-227535906 GTACCTGAGACCCTTTCATGGGG + Intronic
947379707 2:229533262-229533284 CTCCCTGAGATCCTTTCAGGAGG + Intronic
948910588 2:241000382-241000404 GGTCCAGAGGGACTTTCAGGGGG - Intronic
1169342176 20:4804914-4804936 GGTCCTGGGGGGCTTTCTGGAGG + Intronic
1170937867 20:20825349-20825371 GGGCCTGGGAGCCTCTCTGGTGG + Intergenic
1170982842 20:21230927-21230949 CGTGCTCAGAGCCTTTCAGCTGG + Intronic
1171030127 20:21669516-21669538 GGTGCTGCCAGCCTTACAGGGGG + Intergenic
1176072386 20:63234067-63234089 GGGCCTGGGGCCCTTTCAGGAGG - Intergenic
1177493249 21:21855434-21855456 GTTCCTGGGAGCCTTTTAAGGGG + Intergenic
1178311799 21:31535998-31536020 GGTCCTGGGAGGCTTTCTAGAGG + Intronic
1178563553 21:33661968-33661990 AGTCCTAAGACCCTTTCATGGGG - Intronic
1178869507 21:36361171-36361193 GTTACTAAGAGCCTTTCAGGTGG + Intronic
1178954590 21:37010804-37010826 GGTGCAGAGAGGCTTTCAGTGGG - Intronic
1181261263 22:21599528-21599550 GGTCTTAAGTGCCTTGCAGGTGG - Intronic
1182280586 22:29215819-29215841 GGTCCTGAGAGTCTCCCAAGAGG - Intronic
1183896549 22:40973974-40973996 GTACCTGAAACCCTTTCAGGGGG + Intergenic
1184520791 22:44992796-44992818 GGTCCCGAGAGCCTCTCTGGGGG - Intronic
1185340964 22:50290915-50290937 GCACTTGAGAGCCTTTCTGGGGG - Intronic
949923200 3:9020641-9020663 TGGACTGAGAGCCTTGCAGGAGG - Intronic
951705559 3:25540882-25540904 GGTCATGACAGCCATTAAGGAGG - Intronic
952082339 3:29774600-29774622 GTTCCTAAGATCCTTTCTGGTGG + Intronic
952329156 3:32347860-32347882 GGTGATGAGAGCCTTTAACGTGG + Intronic
954137027 3:48586626-48586648 GGTCATGGGAGCCATTCAGTGGG + Exonic
954408182 3:50356995-50357017 GTCCCTCAGAGCCATTCAGGTGG - Intronic
955363982 3:58296436-58296458 GTTCCTGGCAGTCTTTCAGGGGG - Intergenic
955700682 3:61679288-61679310 GATCTTGACAGCCTGTCAGGAGG + Intronic
956425104 3:69126130-69126152 GGAACTGAGAGACTTTTAGGTGG + Intergenic
958857613 3:99405334-99405356 GTCCCTAAGACCCTTTCAGGGGG + Intergenic
958862265 3:99458175-99458197 GGTCCTGAGAGCATCTCTGTGGG - Intergenic
962024230 3:131530045-131530067 GTCCCTGAGACTCTTTCAGGGGG + Intergenic
965933811 3:174080713-174080735 GCTCCTGAGATCTTATCAGGAGG + Intronic
966769250 3:183489379-183489401 AGTCTTGATTGCCTTTCAGGGGG - Exonic
966818827 3:183909358-183909380 GGTGCTGAGTGGCTTCCAGGTGG - Intergenic
969056905 4:4407890-4407912 GGGCCTGAGCGGCTTGCAGGGGG + Intronic
969394683 4:6912461-6912483 GTCCCTGAGAGCCTTCCAGATGG - Intronic
971760157 4:30755550-30755572 TGTCCTGAGAGCTTTACAAGGGG + Intronic
972610355 4:40650494-40650516 TGTCCGCAGAGCCTTTCAGAAGG - Intergenic
972758855 4:42081501-42081523 GGTCCTGAGACCTTTTTAGGGGG - Intronic
972802565 4:42492495-42492517 GGTCCTTAAAGCATTTCTGGAGG + Intronic
973234882 4:47889802-47889824 GTTCTTGAGACCCTTTCAGGAGG + Intronic
975300565 4:72785485-72785507 GTACCTAAGAGCCTTTCAGGGGG + Intergenic
978580878 4:110229916-110229938 GCTCCTGAGTGACTTACAGGTGG - Intergenic
978631001 4:110744516-110744538 GCCCCTGAAAGCTTTTCAGGTGG - Intergenic
980208633 4:129755864-129755886 GCTCCTGAGACCATTCCAGGAGG - Intergenic
983351672 4:166598247-166598269 ACTCCTAAGAGACTTTCAGGAGG + Intergenic
984329598 4:178297921-178297943 GGTCCTGAGATCTTATCAAGAGG + Intergenic
986124784 5:4874927-4874949 TGTCCTGAGAGCCAGGCAGGAGG + Intergenic
986492378 5:8306400-8306422 GATTCTTAGAGCCTTTCAGCTGG + Intergenic
986754935 5:10826684-10826706 AGTCATGAGAACCTTGCAGGAGG - Intergenic
987580260 5:19781730-19781752 AGTCCAGAGAGAATTTCAGGTGG + Intronic
988557917 5:32254217-32254239 GGTCTCAAGATCCTTTCAGGTGG + Intronic
988575990 5:32425277-32425299 GTTCCTGAGACCCTTTCAGGAGG + Intronic
988827977 5:34959070-34959092 GGTCCCGAGACCCATTCAGTGGG - Intergenic
989018338 5:36968222-36968244 GGTCCTGTGAGCCTTTTAATAGG + Intronic
991154213 5:63411510-63411532 GACCCTGAGACTCTTTCAGGAGG + Intergenic
992768081 5:80021181-80021203 GTACCTGAGACCATTTCAGGGGG + Intronic
994928057 5:106145324-106145346 GTCCCTGAGATCCTTTCAGGAGG + Intergenic
995730662 5:115237868-115237890 GGGCTTGAGAGCCCTTCAGCTGG - Exonic
997601959 5:135146273-135146295 GGCCCTGAAGCCCTTTCAGGAGG - Intronic
998019201 5:138755280-138755302 AGTCCAGAAAGGCTTTCAGGAGG + Intronic
1002418153 5:179131636-179131658 GGTCCTGAGAGCCTCCCGCGTGG + Intronic
1003091535 6:3107859-3107881 GGTTCTGAGATGCTTTCAGTGGG + Intronic
1003931949 6:10932568-10932590 GAGCATGAGAGCCCTTCAGGTGG - Intronic
1004674686 6:17830189-17830211 GTCTCTGAGAACCTTTCAGGAGG + Intronic
1005689355 6:28287259-28287281 CATCGTGAGAGCCATTCAGGTGG + Intronic
1006429574 6:33987556-33987578 GTTCCTAAGACCCTCTCAGGGGG - Intergenic
1006742266 6:36317606-36317628 GGTCCTGGGAGCCTTCCAGGAGG - Intronic
1007789531 6:44301161-44301183 GGTGCTGTGTGCCTGTCAGGTGG - Exonic
1008061754 6:47005114-47005136 GGCACTGAGGGCCTTTCAGAAGG - Intronic
1008097522 6:47354687-47354709 GGTCCTTAGAGCATTTCATGGGG - Intergenic
1008518494 6:52340747-52340769 AGCCCTGAGGGCTTTTCAGGAGG - Intergenic
1010705812 6:79109019-79109041 AATCCTGAGACCCTTTCAGGGGG + Intergenic
1012999508 6:106008452-106008474 GGTACTGAAAGGCTTTAAGGAGG - Intergenic
1013219203 6:108062253-108062275 GCTCCTGAGTGCCTCACAGGAGG + Intronic
1015208697 6:130671523-130671545 TGACCTGAGCGACTTTCAGGAGG + Intergenic
1015649880 6:135444892-135444914 AGTTCTGAGTCCCTTTCAGGGGG - Intronic
1016098808 6:140071700-140071722 GGTCATGAGAGGCTTTCTGTGGG + Intergenic
1018929567 6:168231932-168231954 GGTCCCGAGGCCCCTTCAGGGGG - Intergenic
1019504845 7:1385651-1385673 GGTTCTGAGAGGCTGGCAGGAGG - Intergenic
1021395448 7:20142315-20142337 TGTCCTTAGAGCCTTTTATGTGG - Intronic
1022002334 7:26237759-26237781 GGTTCTGAGTGTCTTTCATGAGG - Intergenic
1022389929 7:29934749-29934771 GCTCCTGGCAGCCTCTCAGGAGG - Intronic
1022864575 7:34404653-34404675 GGTCCTGAGTGCCATACATGAGG + Intergenic
1023223639 7:37946676-37946698 GGCCCTGACAGCCTTCCAGTGGG + Intronic
1023318906 7:38972599-38972621 GTTCATGAGGCCCTTTCAGGGGG - Intergenic
1026831929 7:73615614-73615636 GACCCTGACAGCCTTTTAGGGGG - Intronic
1026944701 7:74308107-74308129 GGTCCTGAGAGACTTCCTGGAGG + Intronic
1031017725 7:116593763-116593785 GTGCCTCAGAGCCTTTCAAGGGG + Intergenic
1032724604 7:134579118-134579140 GGTCCTGAGCCCTTTTCCGGTGG + Intronic
1033430087 7:141281323-141281345 TGTTCTGTGAGGCTTTCAGGAGG - Intronic
1035387500 7:158484213-158484235 GGTACTGAGAGGCTCTGAGGTGG - Intronic
1045996436 8:108367317-108367339 GGCCCTGGGTGCATTTCAGGTGG + Intronic
1046701525 8:117406140-117406162 GGTCCTGAGAGACATACAGCAGG - Intergenic
1049182513 8:141230330-141230352 TGTCCTGAGAGGCTTTCTGATGG - Intronic
1049612517 8:143562107-143562129 GGCCCTGCGAGCCTTGGAGGAGG + Exonic
1051451814 9:17205609-17205631 GGTCCTCTGAGCTATTCAGGAGG + Intronic
1053381847 9:37655368-37655390 CCTCCTTAGAGCCTTTCAGTGGG + Intronic
1053515600 9:38728078-38728100 GGTCCAGAGAGCTATTCTGGAGG + Intergenic
1058985899 9:110208029-110208051 GCTGCTCAGAGCCCTTCAGGGGG + Exonic
1059551424 9:115233022-115233044 GGTCCGGAAAGGCTTCCAGGAGG - Intronic
1060846662 9:126842739-126842761 GGAGCTGAGATCCTGTCAGGCGG - Intergenic
1061920842 9:133781538-133781560 TCTCCTGAGAGCCTTTCCTGTGG - Intronic
1062522501 9:136964099-136964121 TGTCCTGTGACCCTTCCAGGGGG + Intergenic
1185656537 X:1690112-1690134 GGCCCTGAGAGTGTTTCATGAGG - Intergenic
1186200973 X:7154279-7154301 GGAACTCAGAGCCTTGCAGGTGG - Intergenic
1187986618 X:24820314-24820336 GTTCCTGATATCCTTTCAGGGGG - Intronic
1189031482 X:37455918-37455940 TTCCTTGAGAGCCTTTCAGGGGG + Exonic
1196178707 X:112667762-112667784 GGTCCAGAGAGCCTTCCACTGGG - Intronic
1197607198 X:128597920-128597942 TGTCCTGTGTGGCTTTCAGGTGG + Intergenic
1198718006 X:139582998-139583020 GTTCCTGAGACCCTTTCAAGGGG + Intronic
1201623646 Y:15988586-15988608 GGTCATGAGTGTGTTTCAGGTGG - Intergenic