ID: 902209959

View in Genome Browser
Species Human (GRCh38)
Location 1:14897844-14897866
Sequence GTTCTGAGTGAGGTCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 186}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902209959_902209963 -3 Left 902209959 1:14897844-14897866 CCCCAGCAGACCTCACTCAGAAC 0: 1
1: 0
2: 3
3: 16
4: 186
Right 902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG 0: 1
1: 0
2: 0
3: 3
4: 46
902209959_902209969 19 Left 902209959 1:14897844-14897866 CCCCAGCAGACCTCACTCAGAAC 0: 1
1: 0
2: 3
3: 16
4: 186
Right 902209969 1:14897886-14897908 GGGCTCACTCAGGAGCTGTCTGG 0: 1
1: 0
2: 0
3: 21
4: 188
902209959_902209964 -2 Left 902209959 1:14897844-14897866 CCCCAGCAGACCTCACTCAGAAC 0: 1
1: 0
2: 3
3: 16
4: 186
Right 902209964 1:14897865-14897887 ACCGCTTGCTGAAACTAACCGGG 0: 1
1: 0
2: 0
3: 4
4: 33
902209959_902209966 -1 Left 902209959 1:14897844-14897866 CCCCAGCAGACCTCACTCAGAAC 0: 1
1: 0
2: 3
3: 16
4: 186
Right 902209966 1:14897866-14897888 CCGCTTGCTGAAACTAACCGGGG 0: 1
1: 0
2: 0
3: 0
4: 24
902209959_902209970 20 Left 902209959 1:14897844-14897866 CCCCAGCAGACCTCACTCAGAAC 0: 1
1: 0
2: 3
3: 16
4: 186
Right 902209970 1:14897887-14897909 GGCTCACTCAGGAGCTGTCTGGG 0: 1
1: 0
2: 2
3: 15
4: 173
902209959_902209967 9 Left 902209959 1:14897844-14897866 CCCCAGCAGACCTCACTCAGAAC 0: 1
1: 0
2: 3
3: 16
4: 186
Right 902209967 1:14897876-14897898 AAACTAACCGGGGCTCACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902209959 Original CRISPR GTTCTGAGTGAGGTCTGCTG GGG (reversed) Intronic
902209959 1:14897844-14897866 GTTCTGAGTGAGGTCTGCTGGGG - Intronic
902917211 1:19645912-19645934 GTTGTTGGTGAGGTCTGCAGTGG + Intronic
904944927 1:34192289-34192311 GTTCTGTGTGGGGTCTGCCATGG + Intronic
905632142 1:39524809-39524831 GGGATGAGTGAGGGCTGCTGTGG + Intronic
906695480 1:47820541-47820563 GCTCTCAGTGAGGTCAGCAGCGG + Intronic
906792903 1:48674294-48674316 TTATTGAGTGATGTCTGCTGGGG + Intronic
907310677 1:53537269-53537291 GCTCTGAGTGTGGCTTGCTGAGG - Intronic
907367995 1:53978611-53978633 GCTCTGAGTGGGGTGTGCTTTGG + Intergenic
909835275 1:80246762-80246784 ATACTGAGAGATGTCTGCTGTGG - Intergenic
915099107 1:153485679-153485701 GGCCTCAGTGAGATCTGCTGTGG + Intergenic
915298254 1:154936945-154936967 GTTCTAAGTGAGTTCGGGTGGGG - Exonic
917103932 1:171473299-171473321 GTTGTGAGAGAGATCTGGTGGGG - Intergenic
918361270 1:183760666-183760688 CTCCTGAGTGAGGATTGCTGAGG - Intronic
920229977 1:204463797-204463819 GTCCTGAGCCAAGTCTGCTGTGG - Intronic
920990139 1:210929557-210929579 GTTCTGTGTGATGTTGGCTGTGG - Intronic
922328835 1:224556002-224556024 GAGCTGAGTGAAGACTGCTGAGG + Intronic
922436043 1:225607661-225607683 ATTCTGAGGGAGGTATGATGGGG + Intronic
922538887 1:226404099-226404121 GTTCTTAGTGAGGGGAGCTGTGG - Intronic
922690744 1:227687828-227687850 GTTATTAGTGAGGTGAGCTGGGG - Intergenic
922791279 1:228312405-228312427 GGTCTGGGTGATGTCTGCTCTGG + Intronic
1063214496 10:3912174-3912196 ATTGTGAGTGGGGTCTGTTGGGG + Intergenic
1064985276 10:21203882-21203904 GCTCTGAGTCAGGTCTGGTAGGG - Intergenic
1067060561 10:43076129-43076151 GTTCTGGGTGAGGTTGGATGTGG - Intergenic
1069773374 10:70913114-70913136 TTTCTGGGAGGGGTCTGCTGGGG + Intergenic
1069836214 10:71309982-71310004 GTTATGAGTGAGGATAGCTGGGG + Intergenic
1069851726 10:71409655-71409677 GTTCTGAGTGCTGTCAGCAGGGG + Intronic
1070994381 10:80763128-80763150 CTTCTGCGTGAAGTCTTCTGGGG + Intergenic
1071166826 10:82816733-82816755 CTTCTGAGTTGGGGCTGCTGAGG - Intronic
1072571243 10:96659060-96659082 GTGCTGAGTGAGGGTTGCTTGGG - Intronic
1077614203 11:3663430-3663452 GATCAGAGTGGGATCTGCTGTGG - Intronic
1078614019 11:12847995-12848017 GTTTTGAGATAGGTCTGATGTGG + Intronic
1078934052 11:15936805-15936827 GTTCTGAGTCAGGTGGGCTTAGG + Intergenic
1080371766 11:31655629-31655651 GTTTTGTGTGAGAGCTGCTGTGG - Intronic
1080700667 11:34641409-34641431 GTTCTGAGTAAGGCCTATTGGGG - Intronic
1084534538 11:69748852-69748874 CTTCTGAGGGGGGTGTGCTGCGG - Intergenic
1087218011 11:95515608-95515630 ATTCAGAGTGAGGTCAGCTTAGG - Intergenic
1088670388 11:112134774-112134796 GTAGTGTGTGAGGTCTGGTGGGG + Intronic
1088722501 11:112606839-112606861 GTTCACAATGTGGTCTGCTGCGG + Intergenic
1089397802 11:118147056-118147078 GTTCTGATTCAGGTCTGGAGTGG + Intronic
1091084845 11:132711585-132711607 GTTGTCAGTGAGGTCTTTTGAGG + Intronic
1091587906 12:1826728-1826750 GTTCTAACTGAGCACTGCTGTGG + Intronic
1100643735 12:96507495-96507517 ATTTTGAGTGAGGACTGCTGAGG + Intronic
1101010017 12:100439560-100439582 GTTCTGGGTAAGATTTGCTGTGG + Intergenic
1101891057 12:108715694-108715716 CTTCTGAGTCTGGTCTCCTGTGG - Intronic
1103008741 12:117441493-117441515 GTGCTCAGTGAGTTCTTCTGTGG - Intronic
1103382455 12:120505015-120505037 GAATTGAGTGAGGTCTACTGAGG - Intronic
1105615763 13:22010688-22010710 TTCCTGAGTGAGCTCTGGTGAGG + Intergenic
1106136842 13:26979881-26979903 TTTCTGAGTGTGCTCTGCAGAGG + Intergenic
1107680764 13:42847748-42847770 GTTATGAGTGAGGTCCTTTGAGG + Intergenic
1110766298 13:79283253-79283275 CTTCTGAGTTAAGTCTGCAGAGG - Intergenic
1112733715 13:102394786-102394808 GTTCCGAGTGTGGACTGCTTCGG - Intronic
1113287211 13:108864065-108864087 TTTCTGAATGAGTTTTGCTGGGG + Intronic
1113449792 13:110399845-110399867 GATTTGAGTGAGGTTTGCTTTGG + Intronic
1113806393 13:113112190-113112212 GTCCTGTGTGAGGTGTCCTGTGG - Intronic
1115465927 14:33714045-33714067 CTTCTCAGTGAGGTCTTCTCTGG + Intronic
1115536385 14:34377137-34377159 GTTCTGAGTGAGGCCTGGCCTGG - Intronic
1118761232 14:68881368-68881390 GAGGTGAGTGAGGTCTGCCGAGG - Intronic
1118817281 14:69322441-69322463 GTTCAGAGTCAGGTAAGCTGGGG - Intronic
1122309567 14:100785929-100785951 GTTCTGAGTGACTTCATCTGCGG - Intergenic
1122914540 14:104852051-104852073 CTCCTGAGTGAGGCCTGCTGCGG - Intergenic
1122973319 14:105161080-105161102 GGTCTGAGTGAGGTCTGTTCGGG + Intronic
1122973327 14:105161110-105161132 GGTCCGAGTGAGGTCTGTTGGGG + Intronic
1122973333 14:105161132-105161154 GGTCTGAGTGAGGTCTGTTGGGG + Intronic
1124682026 15:31740121-31740143 CTTCTCAGTGAGGCCTGCTCCGG - Intronic
1129273457 15:74431484-74431506 GTTTTGAGTCAGGACAGCTGTGG - Intronic
1129409198 15:75339507-75339529 CTTGTCACTGAGGTCTGCTGTGG + Intronic
1130955371 15:88623677-88623699 GTCCTGAGTCAGGGCTACTGTGG + Intronic
1131435250 15:92416816-92416838 GTTCAGAGCGGGGCCTGCTGGGG - Intronic
1138309456 16:56011075-56011097 GTTCAGAGTGAGCTCTGCTTGGG - Intergenic
1138348002 16:56331645-56331667 GTGATGGGGGAGGTCTGCTGGGG + Intronic
1138827848 16:60342272-60342294 GTTCTCAGGGAGGTCTTCTTGGG - Intergenic
1139650279 16:68358929-68358951 GTGCTGAGGGAGGTGTGCGGGGG + Exonic
1142313116 16:89325653-89325675 GTTCTAAGTGAAGGCTGCGGAGG + Intronic
1143152581 17:4816648-4816670 GTTGTGAGAGAGGTCTGGGGTGG - Exonic
1143429784 17:6872638-6872660 GTTCTGAGTGAGGGATGCCAAGG + Intergenic
1146375071 17:32288291-32288313 GTTCAGAGTGATGGTTGCTGTGG - Intronic
1146675102 17:34767934-34767956 GTCCAGAGTCAGGCCTGCTGGGG - Intergenic
1150543636 17:66130159-66130181 GTTCTAAGTAATGACTGCTGAGG + Intronic
1151290911 17:73149205-73149227 GTTCTGTTTGGGTTCTGCTGAGG - Intergenic
1153897587 18:9580788-9580810 GTCCTGAGTGAGAGCAGCTGAGG + Intronic
1156452242 18:37273517-37273539 GTGCTAAGTGAGTTCTGCAGAGG - Intronic
1157000549 18:43518353-43518375 GTTCTGGGTGTGTTCTGCTCTGG + Intergenic
1158985412 18:62810660-62810682 GTTCTGACTCAGGTTGGCTGTGG + Intronic
1160245748 18:77158266-77158288 GATCTGAGTAAGGTCTGTGGAGG - Intergenic
1161108362 19:2455595-2455617 GTCCTGAGTGAGGGCTGCAGAGG - Intronic
1161453860 19:4360780-4360802 GTCCCGTGTGAGGTGTGCTGGGG + Exonic
1162352311 19:10158224-10158246 GGTGTGAGTGAGGTGTGCTGTGG - Intronic
1165812284 19:38618754-38618776 GTTCCGAGGGAGGTGTTCTGAGG - Intronic
1166326894 19:42056580-42056602 GATCTGAGTGAGGTCTGAAAGGG + Intronic
1167798670 19:51726788-51726810 GGTCTGAGGGAGGGGTGCTGGGG - Intergenic
925353088 2:3216287-3216309 GTTATAAGTGAGATCTGCTGGGG - Intronic
925426945 2:3757723-3757745 GGGCTGGGTGAGGTCTGCTAGGG - Intronic
925462470 2:4075321-4075343 CTTCTGAGTGAGGGCTGTCGGGG + Intergenic
926071454 2:9896526-9896548 GTTTTGTGTGTGGGCTGCTGGGG + Intronic
926571175 2:14531408-14531430 GTTCTGGGTTAGGTCTCCAGTGG + Intergenic
927339001 2:21959325-21959347 GTTCTGAAGGATCTCTGCTGAGG + Intergenic
927423092 2:22953365-22953387 GCTCAGAGTGAGATCTGATGTGG - Intergenic
928359807 2:30654095-30654117 GTGCTGGGTGAGCTCTGCTGTGG + Intergenic
933598885 2:84309450-84309472 GTCATGGGTGAGGACTGCTGGGG + Intergenic
933658500 2:84907634-84907656 GTCCTGACTCTGGTCTGCTGTGG - Intergenic
934122372 2:88852844-88852866 CATCAGAGTGAGGTCTTCTGTGG - Intergenic
935249940 2:101252659-101252681 GTTCAGGGTTAGGTCTGCCGAGG - Intronic
935703648 2:105836989-105837011 GGTGTGAATGTGGTCTGCTGTGG + Intronic
937874065 2:126807492-126807514 GTTCTGGGTGAGAACTGCTGTGG - Intergenic
938389306 2:130892720-130892742 GGTCTGTGTGTGGTTTGCTGGGG - Intronic
940832678 2:158484970-158484992 GAACTGAGTGAGGTATACTGAGG - Intronic
941911830 2:170771254-170771276 GGTCTGGGGGTGGTCTGCTGTGG - Intergenic
943623299 2:190173416-190173438 GGACAGAGTGAGTTCTGCTGTGG - Intronic
943905838 2:193500772-193500794 ATTAGGAGTGAGGTCTGATGAGG + Intergenic
946331351 2:219010736-219010758 GGTCAGAGGGAGGCCTGCTGAGG + Intronic
947767216 2:232645424-232645446 GTGCTCAGTGAGGGGTGCTGGGG - Intronic
947884828 2:233559832-233559854 GCTGTCAGTGAGGTCTGCTGTGG + Exonic
948662989 2:239518194-239518216 GTTCTGGGTGAAGTCTCCCGGGG + Intergenic
1171489542 20:25507280-25507302 CTCCTGAGTGAGGTGTGCGGAGG - Intronic
1171936349 20:31278400-31278422 GTACAGAGTCTGGTCTGCTGGGG + Intergenic
1172508710 20:35484219-35484241 GTTCTGAGGAAGGTTTTCTGTGG + Intronic
1176672336 21:9746129-9746151 GTTCTGTGTGGTGTCTGCGGAGG - Intergenic
1180872063 22:19151751-19151773 TCTGTGAGGGAGGTCTGCTGAGG - Intergenic
1181457477 22:23067838-23067860 GTTCAGTGTACGGTCTGCTGTGG - Intronic
1181490569 22:23258555-23258577 GATCTGACTGAGGTCAGCTCAGG - Intronic
1182875108 22:33684911-33684933 GTGATGAATGATGTCTGCTGAGG + Intronic
1185276521 22:49952287-49952309 CTTCTGTGTCAGCTCTGCTGAGG - Intergenic
950787809 3:15450447-15450469 TTTCTACTTGAGGTCTGCTGTGG + Exonic
952162212 3:30705384-30705406 GTTTTCAGTGAAGCCTGCTGGGG - Intergenic
954662300 3:52232554-52232576 GTCCTGAGGGGAGTCTGCTGCGG - Intronic
954801887 3:53191995-53192017 GTTCTGGGTGAGGACAGCTCTGG + Intronic
955227867 3:57075911-57075933 GGGTGGAGTGAGGTCTGCTGTGG - Intronic
960766550 3:121136390-121136412 GTTCTGAGTCTGCTTTGCTGGGG - Intronic
960856096 3:122103637-122103659 GTTCTGAATGAGGTATACTTAGG + Exonic
961118224 3:124350010-124350032 TTTCTAAGTGAGGAATGCTGAGG - Intronic
961490538 3:127254082-127254104 GATCTGTGCGAGGGCTGCTGAGG - Intergenic
963895575 3:150682191-150682213 GTTCTAAGTCAGGTTTACTGTGG - Intronic
965075286 3:163967615-163967637 GTTCAGTGTGATGTCAGCTGTGG - Intergenic
967709463 3:192688162-192688184 GAGCTGTGTGAGGTCTGCTATGG - Intronic
968297743 3:197590663-197590685 GTTCTGAGAGAGGCCTGCAGAGG + Intergenic
968800906 4:2742797-2742819 CTTCTCAGTCAGGTCTCCTGGGG - Intronic
968976416 4:3824467-3824489 GTGCTGAGGGAGGTGAGCTGGGG - Intergenic
969605336 4:8199573-8199595 GCTCTGAGTGGGGTCTGCTGAGG - Intronic
975179377 4:71326458-71326480 GTTCTCAGGGAGGACTGCTTGGG + Intronic
975527281 4:75364335-75364357 GTTCTCAGGGAGGACTGCTTGGG + Intergenic
975969515 4:80016576-80016598 GTTCTGAGAGAGGTCTGGATTGG - Intronic
978347643 4:107788553-107788575 GTTCTGGGTAGAGTCTGCTGTGG - Intergenic
980694730 4:136339894-136339916 GTTTTGAGTGAAGTGTTCTGTGG - Intergenic
983356315 4:166662497-166662519 GTTCTGTCTGAGGTCAGTTGGGG - Intergenic
983371182 4:166860744-166860766 GTTCTGAGTGAGGAATGTAGTGG - Intronic
984589819 4:181604743-181604765 GATCTGACTGAGATCTGGTGTGG + Intergenic
985402393 4:189605719-189605741 GTTCTGTGTGGTGTCTGCGGAGG + Intergenic
985726873 5:1521041-1521063 GATCTTAGTGAGTTCAGCTGAGG - Intronic
986228403 5:5838842-5838864 GCGCTGAGTGATGGCTGCTGAGG - Intergenic
986566102 5:9116146-9116168 GTTTTGATTGAAGCCTGCTGAGG + Intronic
987617313 5:20293024-20293046 GTTCAGAGTGAGGCCAGGTGCGG + Intronic
988788347 5:34584608-34584630 GTTTTCAGTGATGTCTCCTGTGG + Intergenic
990670446 5:58123548-58123570 CTTCTCAATGAGGTCTTCTGTGG - Intergenic
992210422 5:74474339-74474361 GAGCAGAGTTAGGTCTGCTGTGG - Intergenic
992296493 5:75331998-75332020 GTTCTGAGTGAGGTATACACAGG - Intergenic
996110198 5:119556478-119556500 GCTCTCAGTGAGATGTGCTGAGG - Intronic
996663510 5:126031305-126031327 GTTCTGTATGATGTTTGCTGTGG - Intergenic
997424576 5:133794482-133794504 CACCTGAGTGTGGTCTGCTGTGG - Intergenic
998647535 5:144079733-144079755 GTTCAGTATGAGGTTTGCTGTGG - Intergenic
999493182 5:152071541-152071563 GTCCTGAGAGAGGTGTGGTGTGG + Intergenic
1000637394 5:163659757-163659779 TTTCTGAGTGTGGGTTGCTGTGG + Intergenic
1002570096 5:180135301-180135323 AGCCTGAGTGATGTCTGCTGTGG + Intronic
1003374000 6:5557450-5557472 GATGTGAGGGAAGTCTGCTGAGG - Intronic
1003619445 6:7685067-7685089 TTGCTGAGTGAGGTCTGCAGGGG + Intergenic
1013591860 6:111625616-111625638 TTTCTGAGTGAGACATGCTGTGG - Intergenic
1015657342 6:135533670-135533692 GTCCTGAGTGAGACTTGCTGAGG + Intergenic
1016902871 6:149119047-149119069 CTTCTCAGTGAGGCCTGGTGGGG - Intergenic
1019074027 6:169372516-169372538 GTTGTGTGTGTGGTGTGCTGTGG - Intergenic
1019121485 6:169808395-169808417 GTGCTGAGGGAGCTGTGCTGGGG - Intergenic
1019441560 7:1050057-1050079 GTTCAGAGTGGGGCCCGCTGAGG - Intronic
1019909765 7:4092709-4092731 GATGTCAGAGAGGTCTGCTGGGG + Intronic
1022033353 7:26512514-26512536 GTTCTGGGTGAGGTCCCCTATGG + Intergenic
1023858813 7:44204066-44204088 GTGCTGGCTCAGGTCTGCTGGGG - Intronic
1025863929 7:65362118-65362140 GTTCTGACTGAGGTCAAATGAGG - Intergenic
1028545786 7:91998162-91998184 GATCTCTGTGAGATCTGCTGCGG - Intronic
1030953058 7:115816769-115816791 TTTCTGAGTAAGGACTGCCGTGG - Intergenic
1032637351 7:133724266-133724288 GGTCTGACTGAGGTCTCCTTTGG - Intronic
1035651965 8:1273299-1273321 GCTCTGAGAGAGCCCTGCTGGGG + Intergenic
1036982586 8:13487031-13487053 CCTCTGAGGGAAGTCTGCTGCGG + Intronic
1037768465 8:21785789-21785811 ATTCTGAGTGAGGTCTGGGCTGG - Intronic
1038500722 8:28041349-28041371 GCACTGAGTGAGGTCTTATGGGG - Intronic
1038854688 8:31318639-31318661 GTTCAGAGTGAGGTCTGTGCAGG - Intergenic
1039725780 8:40214764-40214786 GTGCTGGGTGAGGTCAGCTCGGG + Intergenic
1043817035 8:84813551-84813573 AATGTGAGTGAGGTGTGCTGTGG - Intronic
1046717020 8:117579175-117579197 TTTCTCAGTGAGGTCTTCTCTGG - Intergenic
1050620732 9:7449688-7449710 TTTGTGAGTGAAGTCTGATGTGG + Intergenic
1053199896 9:36145165-36145187 GTTCTGAGTGAGGGCCACAGAGG - Intronic
1053398458 9:37797188-37797210 GTTCAAAATGAGGCCTGCTGTGG - Intronic
1053411865 9:37921001-37921023 GAGCTGGGAGAGGTCTGCTGGGG - Intronic
1055663707 9:78532493-78532515 ATTCTGAGTGAGCTCTACAGGGG + Intergenic
1056126905 9:83543580-83543602 GTGCTGAGGGATGTCTGCAGGGG - Intergenic
1057306823 9:93917133-93917155 GCTCTGAGTGAGCTCTGATTGGG - Intergenic
1057552128 9:96059149-96059171 GTAGTGAGTGAGGTCTCCTGGGG + Intergenic
1058361717 9:104155297-104155319 GTTCTGAGTTAGGTCTGTTGTGG - Intergenic
1059331301 9:113537381-113537403 GAGCTGAGTGTGGACTGCTGGGG + Intronic
1059444082 9:114327549-114327571 GGCCTGAGTGAAGGCTGCTGTGG + Intergenic
1059445289 9:114334328-114334350 GGCCTGAGTGAAGGCTGCTGTGG + Exonic
1061874787 9:133538309-133538331 GCTCGGAGTGAGGGCTGCAGAGG - Intronic
1185784027 X:2874786-2874808 ATTTTGAGTGATGTCAGCTGGGG - Intronic
1186023805 X:5286403-5286425 TTTGTGAGTGGGGTCTTCTGGGG - Intergenic
1188153611 X:26712422-26712444 GTTCTGAGTGAGCACTGTTGTGG + Intergenic
1193723617 X:85016324-85016346 GCTCTCAGTGAGATCTGCTGAGG + Intronic
1196038013 X:111168009-111168031 GTTTTGAGTGGGGAATGCTGAGG - Intronic
1197292376 X:124674643-124674665 GTTCTGAGTAAGGTATGGTATGG + Intronic
1197814251 X:130480390-130480412 GCCCTGAGCCAGGTCTGCTGTGG + Intergenic
1200069901 X:153523405-153523427 CTTATGCGTGAGCTCTGCTGAGG + Intronic