ID: 902209960

View in Genome Browser
Species Human (GRCh38)
Location 1:14897845-14897867
Sequence GGTTCTGAGTGAGGTCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 207}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902209960_902209970 19 Left 902209960 1:14897845-14897867 CCCAGCAGACCTCACTCAGAACC 0: 1
1: 0
2: 3
3: 20
4: 207
Right 902209970 1:14897887-14897909 GGCTCACTCAGGAGCTGTCTGGG 0: 1
1: 0
2: 2
3: 15
4: 173
902209960_902209969 18 Left 902209960 1:14897845-14897867 CCCAGCAGACCTCACTCAGAACC 0: 1
1: 0
2: 3
3: 20
4: 207
Right 902209969 1:14897886-14897908 GGGCTCACTCAGGAGCTGTCTGG 0: 1
1: 0
2: 0
3: 21
4: 188
902209960_902209967 8 Left 902209960 1:14897845-14897867 CCCAGCAGACCTCACTCAGAACC 0: 1
1: 0
2: 3
3: 20
4: 207
Right 902209967 1:14897876-14897898 AAACTAACCGGGGCTCACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 52
902209960_902209966 -2 Left 902209960 1:14897845-14897867 CCCAGCAGACCTCACTCAGAACC 0: 1
1: 0
2: 3
3: 20
4: 207
Right 902209966 1:14897866-14897888 CCGCTTGCTGAAACTAACCGGGG 0: 1
1: 0
2: 0
3: 0
4: 24
902209960_902209963 -4 Left 902209960 1:14897845-14897867 CCCAGCAGACCTCACTCAGAACC 0: 1
1: 0
2: 3
3: 20
4: 207
Right 902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG 0: 1
1: 0
2: 0
3: 3
4: 46
902209960_902209964 -3 Left 902209960 1:14897845-14897867 CCCAGCAGACCTCACTCAGAACC 0: 1
1: 0
2: 3
3: 20
4: 207
Right 902209964 1:14897865-14897887 ACCGCTTGCTGAAACTAACCGGG 0: 1
1: 0
2: 0
3: 4
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902209960 Original CRISPR GGTTCTGAGTGAGGTCTGCT GGG (reversed) Intronic
900143910 1:1149898-1149920 GGTGCTGAGTGTGGGCTGCAAGG + Intergenic
902209960 1:14897845-14897867 GGTTCTGAGTGAGGTCTGCTGGG - Intronic
902539184 1:17140439-17140461 GGTTCTGAGTCAGGTTTGAACGG + Intergenic
902574693 1:17370084-17370106 GGTACTGAGTGAAGCCTGTTCGG - Intergenic
903061524 1:20672001-20672023 GATTCTGCGTGAGTCCTGCTGGG - Exonic
903459151 1:23508730-23508752 GGGTCTGAGTGAGCTCTGAGGGG + Exonic
906615729 1:47231792-47231814 GCTTCTAAGTGTGGTCTTCTTGG - Intronic
906792902 1:48674293-48674315 GTTATTGAGTGATGTCTGCTGGG + Intronic
906923945 1:50094304-50094326 GGTTTTGTTAGAGGTCTGCTGGG + Intronic
906944460 1:50284016-50284038 CCTTCTGCGTGAAGTCTGCTGGG + Intergenic
908445167 1:64192735-64192757 GGTTCTAACTGAGGTCTGAGGGG - Intergenic
909039438 1:70631258-70631280 GGTTCTGATTGAGGTCTGAGGGG - Intergenic
910489600 1:87754386-87754408 CTTTCTCAGTGAGGTCTTCTTGG + Intergenic
917959689 1:180132348-180132370 GGTCCTGGGGGTGGTCTGCTGGG + Intergenic
918720206 1:187842738-187842760 GGTTCTAACTGAGGTCTGAGAGG + Intergenic
919913052 1:202123603-202123625 TGTTCTGTTTGAGCTCTGCTGGG + Intronic
920539378 1:206766648-206766670 GCTTCTGACTGCGGTCTGCTGGG - Intergenic
1063214495 10:3912173-3912195 GATTGTGAGTGGGGTCTGTTGGG + Intergenic
1063906212 10:10782766-10782788 GGTTCTTTGTGATGTCAGCTAGG + Intergenic
1064985277 10:21203883-21203905 TGCTCTGAGTCAGGTCTGGTAGG - Intergenic
1069321741 10:67180168-67180190 TTTTCTAAGTGAGTTCTGCTTGG - Intronic
1069836213 10:71309981-71310003 GGTTATGAGTGAGGATAGCTGGG + Intergenic
1070994380 10:80763127-80763149 GCTTCTGCGTGAAGTCTTCTGGG + Intergenic
1072571244 10:96659061-96659083 TGTGCTGAGTGAGGGTTGCTTGG - Intronic
1073596708 10:104807866-104807888 GGTTTTGAGTGAGGGCTGGAAGG + Intronic
1074035272 10:109732404-109732426 GGTTCTGACTTATCTCTGCTGGG - Intergenic
1077310958 11:1888974-1888996 GGTGCTGAGGGAAGTCTGCATGG - Intronic
1077551000 11:3200305-3200327 TGCTCTGAGGGAGCTCTGCTGGG - Intergenic
1077818314 11:5709889-5709911 GGTTCTTTCTGAGGTCTGCAAGG + Exonic
1079248784 11:18772519-18772541 GGGTCTGAGTGTTCTCTGCTTGG + Intronic
1083172030 11:60928814-60928836 GGTACTGCGGGGGGTCTGCTGGG - Exonic
1083330759 11:61897407-61897429 GGTCCTGAGTGGGCTCTGATGGG + Exonic
1084857291 11:71997393-71997415 GGTTCTGAGAGGGGGCTTCTAGG + Exonic
1089499603 11:118924710-118924732 GCTTCTGAGTGATGTGGGCTTGG - Intronic
1089858396 11:121567307-121567329 TGTTCTGAGTGAGGACTGAAGGG - Intronic
1091991041 12:4956023-4956045 GGTTCTGAGTGAGCTTGGCTTGG - Intergenic
1097289118 12:57899084-57899106 GGTTCTGAGTCACGACTGCTTGG + Intergenic
1101252092 12:102946494-102946516 GGTGCTGACTGAGTTCTGCCTGG + Intronic
1103447702 12:121004907-121004929 GGTCCTGACTGGAGTCTGCTTGG + Intronic
1104275233 12:127320881-127320903 GGTCCTGAGTGAGACCTGTTGGG + Intergenic
1105604043 13:21912003-21912025 GGTTCTGAGTGCTGCCTGCATGG + Intergenic
1107559859 13:41549413-41549435 GCTTCTGAGTGAGGCATTCTGGG + Intergenic
1107649797 13:42533957-42533979 GGTTCTGAGTTTGTTTTGCTGGG - Intergenic
1107987649 13:45789029-45789051 AGTTGGGAGTCAGGTCTGCTAGG + Intronic
1108548523 13:51520375-51520397 GGTGCTGGGTGAGGTGAGCTAGG + Intergenic
1111947774 13:94683433-94683455 GGGACTGAATGAGGTCAGCTGGG + Intergenic
1115297843 14:31850087-31850109 GGTTCTAATGGATGTCTGCTGGG + Intronic
1115945004 14:38649886-38649908 GTTTCTGAGTTAGTTCTGTTAGG + Intergenic
1118817282 14:69322442-69322464 GGTTCAGAGTCAGGTAAGCTGGG - Intronic
1119230229 14:72973685-72973707 GCTTGTAAGTGAGGTCAGCTTGG + Intronic
1121782703 14:96632101-96632123 GGTGCATAGTGAGGTCTGCTGGG - Intergenic
1122973318 14:105161079-105161101 GGGTCTGAGTGAGGTCTGTTCGG + Intronic
1122973326 14:105161109-105161131 GGGTCCGAGTGAGGTCTGTTGGG + Intronic
1122973332 14:105161131-105161153 GGGTCTGAGTGAGGTCTGTTGGG + Intronic
1124135379 15:27030816-27030838 GGTTCTGAGTGTGACCTGCTTGG + Intronic
1125175807 15:36820284-36820306 GATTCTGAGTCAGCTCTCCTAGG + Intergenic
1128725650 15:69986697-69986719 TGTTCTGGGTCAGGGCTGCTGGG - Intergenic
1131144719 15:90003178-90003200 GGGTCTGAGGGAGGCCTGCCGGG + Intronic
1138309457 16:56011076-56011098 GGTTCAGAGTGAGCTCTGCTTGG - Intergenic
1138348001 16:56331644-56331666 GGTGATGGGGGAGGTCTGCTGGG + Intronic
1138827849 16:60342273-60342295 GGTTCTCAGGGAGGTCTTCTTGG - Intergenic
1139650278 16:68358928-68358950 GGTGCTGAGGGAGGTGTGCGGGG + Exonic
1141991318 16:87612076-87612098 GGTGCTGATTGAGGTCCTCTGGG + Intronic
1142530394 17:575797-575819 GGTCCTGAGGGAAGTCTTCTGGG - Intronic
1142530417 17:575955-575977 GGTTCTGAGTGAAGTTCTCTGGG - Intronic
1142530424 17:576019-576041 GGTTGTGAGGGAGGTTTTCTGGG - Intronic
1142530438 17:576114-576136 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142530454 17:576209-576231 GGTTCTGAGAGAGGTTCTCTGGG - Intronic
1142530543 17:576756-576778 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142530555 17:576821-576843 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142530561 17:576854-576876 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142530571 17:576918-576940 GGTTCTGAGGGAGGTTTTCTGGG - Intronic
1142530577 17:576951-576973 GGTTCTGAGGGAGGTTCTCTAGG - Intronic
1142530595 17:577080-577102 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142530606 17:577143-577165 GGTTCTGAAGGAGGTTTTCTGGG - Intronic
1142530615 17:577208-577230 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142530624 17:577271-577293 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142530751 17:578079-578101 GGTTCTGAGGGAGGTTGCCTGGG - Intronic
1142530789 17:578368-578390 GGTTCTGAGGGAGGTTCTCTAGG - Intronic
1142530803 17:578465-578487 GGTTCTGAGAGAGGTTCTCTGGG - Intronic
1142530821 17:578594-578616 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142530837 17:578691-578713 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142530900 17:579046-579068 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142530917 17:579143-579165 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142530928 17:579207-579229 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142530934 17:579239-579261 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142530992 17:579595-579617 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531003 17:579659-579681 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531069 17:580015-580037 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531087 17:580112-580134 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531093 17:580144-580166 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531119 17:580304-580326 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531149 17:580467-580489 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531161 17:580531-580553 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531175 17:580596-580618 GGTTCTGAGGGAGGTTCCCTGGG - Intronic
1142531204 17:580789-580811 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531210 17:580821-580843 GGTTCTGAGGGAGGTTCTCTTGG - Intronic
1142531215 17:580853-580875 GGTTCTGAGGGAGGTTCTCTTGG - Intronic
1142531326 17:581520-581542 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531378 17:581843-581865 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531413 17:582038-582060 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531434 17:582167-582189 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531440 17:582198-582220 GGTTCTGAGTGATGTTCTCTGGG - Intronic
1142531443 17:582230-582252 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531460 17:582326-582348 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531525 17:582680-582702 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531574 17:583002-583024 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531605 17:583196-583218 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531617 17:583262-583284 GGTTCTGAGGGAGGTTCTCTGGG - Intronic
1142531674 17:583585-583607 GGTTCTGAGGGAGGTTATCTGGG - Intronic
1142531733 17:583910-583932 GGTTCTGAGGGAGGTTCCCTGGG - Intronic
1144804924 17:17958712-17958734 GGTTTTGGGTGAGGTGTGCCAGG - Intronic
1146675103 17:34767935-34767957 GGTCCAGAGTCAGGCCTGCTGGG - Intergenic
1147220532 17:38926473-38926495 GGCTCTGAAAGAGGTCTGCTGGG - Intergenic
1152524545 17:80880044-80880066 GGTTCTGAGTGAGTGCTGGATGG + Intronic
1152873545 17:82772547-82772569 GGTTCTGAGAGGGGTTTGTTTGG + Intronic
1153985774 18:10349980-10350002 GGCTCTGAGTGGGGTTTGGTGGG - Intergenic
1159337300 18:67086019-67086041 GCTTATAAGTGAAGTCTGCTTGG - Intergenic
1159995467 18:74960391-74960413 GGTCCTGAGTGAGGACTGGGTGG + Intronic
1159995543 18:74960751-74960773 GGTCCTGAGTGAGGACTGCATGG + Intronic
1159995582 18:74960931-74960953 GGTCCTGAGTGAGGACTGGGTGG + Intronic
1159995599 18:74961003-74961025 GGTCCTGAGTGAGGACTGGGTGG + Intronic
1159995608 18:74961039-74961061 GGTCCTGAGTGAGGACTGGGTGG + Intronic
1161453859 19:4360779-4360801 GGTCCCGTGTGAGGTGTGCTGGG + Exonic
1161589854 19:5124424-5124446 GGTTCTCAGTGGGGCCTCCTGGG + Intronic
1164399143 19:27890860-27890882 GGCAGTGAGTGAGGTTTGCTTGG + Intergenic
1164668772 19:30061379-30061401 GGTCCTGAGTGAGGGACGCTTGG - Intergenic
1165289850 19:34874299-34874321 GGTTCTCACTGAGGTCTGCACGG + Intergenic
1166326893 19:42056579-42056601 TGATCTGAGTGAGGTCTGAAAGG + Intronic
1167798671 19:51726789-51726811 GGGTCTGAGGGAGGGGTGCTGGG - Intergenic
925353089 2:3216288-3216310 AGTTATAAGTGAGATCTGCTGGG - Intronic
925426946 2:3757724-3757746 AGGGCTGGGTGAGGTCTGCTAGG - Intronic
929449440 2:42027034-42027056 GCCCCTGAGTGAGGTCTTCTAGG - Intergenic
932354994 2:71061065-71061087 GGTGCTGAGTGAGAGCTTCTGGG - Intergenic
933967434 2:87441678-87441700 CCTTCTGAGTGAGGGTTGCTGGG - Intergenic
935812831 2:106816981-106817003 GGTTCTGGCTGAGTTCTGCCCGG - Intronic
936326362 2:111508818-111508840 CCTTCTGAGTGAGGGTTGCTGGG + Intergenic
936949076 2:117959025-117959047 GGTGCTGAGAGAGGTCAGGTAGG + Intronic
937064134 2:119004499-119004521 GGTTTTGACTGAGGTCTGAGGGG + Intergenic
938389307 2:130892721-130892743 GGGTCTGTGTGTGGTTTGCTGGG - Intronic
939057735 2:137383833-137383855 GGTTCTAACTGAGGTCTGAGGGG - Intronic
941743916 2:169066136-169066158 GGTTCTGTGTGAGGCCTATTTGG - Intronic
944878300 2:203985327-203985349 GGTTCTCCATGAAGTCTGCTTGG - Intergenic
947767217 2:232645425-232645447 GGTGCTCAGTGAGGGGTGCTGGG - Intronic
948668083 2:239548739-239548761 GGGTCTGAGTCAGGTCTGAGAGG + Intergenic
1170449863 20:16471529-16471551 GTTTCTGTTTGAGGTCTGCAAGG - Intronic
1176694608 21:9959405-9959427 AGTTCTGAGTGTTGACTGCTTGG - Intergenic
1181003601 22:19999255-19999277 GGGTCAGAGTGAGGTCAACTCGG - Intronic
1184980586 22:48093084-48093106 AATTCTGACTGAGGACTGCTGGG - Intergenic
1185013151 22:48327625-48327647 GGCTCTGAATGAGGTCTGCAGGG + Intergenic
1185091744 22:48779435-48779457 GGATCTGAGGGAGGCCTGCTTGG - Intronic
949917267 3:8974801-8974823 ATTTCTGAGTGAGGTGGGCTTGG - Intergenic
950449035 3:13055239-13055261 GGGTCTCAGTGAGGTCTTCCTGG + Intronic
950566632 3:13773222-13773244 GGTTTTGAGTGTGGGCTGCCAGG + Intergenic
956638397 3:71390203-71390225 GGTCCTGACTTAGGGCTGCTGGG - Intronic
957935630 3:86937911-86937933 TGTTCTGAGTGTTGTCTGATGGG - Intergenic
960544693 3:118900884-118900906 GGTTCTGAGTGTAGCCTTCTTGG + Exonic
961040693 3:123676062-123676084 GGTTGTGAAAGAGGTGTGCTGGG + Intronic
962481043 3:135799122-135799144 GGTTCTGAGTAGGGTCTGTTTGG - Intergenic
962919998 3:139942112-139942134 GGCTCTGAGTGAGGTCAGAGAGG + Intronic
963875785 3:150472909-150472931 TGTTCTGATTGAAGTCTGTTTGG - Intergenic
966496232 3:180584462-180584484 GGCTTTGAGTGAAGTCTGCATGG - Intergenic
967762541 3:193241521-193241543 GCTTGAGAGTGAGGTGTGCTGGG + Exonic
969710302 4:8839408-8839430 GGTGCTGGCTGAGGGCTGCTGGG - Intergenic
970591710 4:17565659-17565681 GATGCTGAGTGAGGTTTCCTGGG - Intergenic
974506545 4:62781395-62781417 GCGTCTGAGTTAGGTCTCCTAGG - Intergenic
974698448 4:65405941-65405963 GTTTCTGAGTGAAGTCTGGATGG - Intronic
975179376 4:71326457-71326479 GGTTCTCAGGGAGGACTGCTTGG + Intronic
975527280 4:75364334-75364356 GGTTCTCAGGGAGGACTGCTTGG + Intergenic
980367232 4:131819630-131819652 AGTTCTGAGTGTTGACTGCTTGG - Intergenic
983207808 4:164929813-164929835 GGTTCAGCGTAAGGTCTGTTAGG + Intergenic
985130650 4:186735185-186735207 GGGTCTGGGTGTGGTCGGCTGGG - Intergenic
986878111 5:12135690-12135712 GGTCCTGGGTGATGTTTGCTTGG - Intergenic
987275789 5:16361200-16361222 GGTTAGAAGTGAGGCCTGCTGGG - Intergenic
988929046 5:36017528-36017550 GGTTCTAAGTGAGGTTTCATAGG - Intergenic
990810025 5:59713553-59713575 GGTTCTAACTGAGGTCTGAGGGG - Intronic
991015840 5:61931455-61931477 GGTTGTGGTTGAGGGCTGCTAGG - Intergenic
994981235 5:106876589-106876611 GGTTCTAACTGAGGTCTGAGGGG + Intergenic
1001006666 5:168057829-168057851 GGTTCTAACTGAGGTCTGAGGGG + Intronic
1001517116 5:172363737-172363759 GGTTCTGAGTGAGGTCCCCGAGG + Intronic
1003619444 6:7685066-7685088 TTTGCTGAGTGAGGTCTGCAGGG + Intergenic
1004013652 6:11712516-11712538 GTTTCTGAGGGTGGTGTGCTGGG - Intronic
1005389401 6:25318149-25318171 GGGCAAGAGTGAGGTCTGCTTGG + Intronic
1005644045 6:27824542-27824564 GGTTCTGAGTCAGTTCTGGGGGG + Intergenic
1006330180 6:33384817-33384839 GGTGCTGAGTGATGTCTCCCTGG + Intergenic
1006359170 6:33577894-33577916 GGGTCCCAGTGAAGTCTGCTGGG + Intronic
1007515981 6:42411734-42411756 GGTTCTCTGTGGGGTCTGTTGGG - Intronic
1009681291 6:66896843-66896865 GGTTCTAACTGAGGTCTGAGGGG - Intergenic
1011113849 6:83867969-83867991 GGTTCTAACTGAGGTCTGAGGGG - Intronic
1015596374 6:134871412-134871434 GGTTCTAACTGAGGTCTGAGGGG + Intergenic
1015596991 6:134875320-134875342 GGTTCTAACTGAGGTCTGAGGGG + Intergenic
1019816697 7:3206178-3206200 GGCTCTGAGTAAGGGCTGCAGGG + Intergenic
1019990425 7:4686548-4686570 GGTTCTGATTCAGCTTTGCTTGG + Intronic
1020474322 7:8577971-8577993 GTTTCTGTCTGAGGTCCGCTGGG - Intronic
1021194393 7:17659194-17659216 GGATCTGAGTGAAGTCCACTAGG - Intergenic
1022124385 7:27341433-27341455 GTTTCTGAGGCAGGTCTTCTTGG + Intergenic
1023284178 7:38602222-38602244 GGCTCTGAGAGAGGGCTGCCAGG - Intronic
1026972076 7:74474559-74474581 GCTTCAAAGTGAAGTCTGCTGGG - Intronic
1029381083 7:100215219-100215241 GGTTCTCACTGTGGTCTCCTAGG + Intronic
1029400457 7:100342168-100342190 GGTTCTCACTGTGGTCTCCTAGG + Intronic
1032673422 7:134106653-134106675 TGTGCTGAGTGAGGTCTTCATGG - Intergenic
1034282067 7:149861506-149861528 GGATCTGAATGCGGTCCGCTGGG + Exonic
1035310316 7:157963715-157963737 GCTTCTCAGTGAGGTCCCCTTGG + Intronic
1036568285 8:9957006-9957028 GCTTCTGATTGAGGTATTCTGGG - Intergenic
1038629778 8:29230734-29230756 GGTGCTGATTCAGGTCTTCTTGG - Intronic
1039108688 8:34018578-34018600 GGTAATGAGTCAGCTCTGCTTGG - Intergenic
1039725779 8:40214763-40214785 AGTGCTGGGTGAGGTCAGCTCGG + Intergenic
1042706888 8:71673199-71673221 GGTTATGATATAGGTCTGCTTGG - Intergenic
1042844579 8:73157573-73157595 TGTCCTCAGTCAGGTCTGCTGGG - Intergenic
1044472233 8:92583514-92583536 GGTTGTGTGTGAGGTCTCCAAGG - Intergenic
1052226184 9:26090279-26090301 GTTTCTTATTGAGGTATGCTGGG + Intergenic
1052688988 9:31791147-31791169 GGTTCTAACTGAGGTCTGAGGGG - Intergenic
1053631578 9:39945345-39945367 AGTTCTGAGTGTTGACTGCTTGG - Intergenic
1053774184 9:41518185-41518207 AGTTCTGAGTGTTGACTGCTTGG + Intergenic
1054212309 9:62305353-62305375 AGTTCTGAGTGTTGACTGCTTGG + Intergenic
1054312677 9:63543479-63543501 AGTTCTGAGTGTTGACTGCTTGG - Intergenic
1055336710 9:75239107-75239129 GGTTCTAACTGAGGTCTGAGGGG + Intergenic
1055663706 9:78532492-78532514 GATTCTGAGTGAGCTCTACAGGG + Intergenic
1056126906 9:83543581-83543603 GGTGCTGAGGGATGTCTGCAGGG - Intergenic
1057306824 9:93917134-93917156 GGCTCTGAGTGAGCTCTGATTGG - Intergenic
1057552127 9:96059148-96059170 GGTAGTGAGTGAGGTCTCCTGGG + Intergenic
1060131177 9:121101048-121101070 AGTTCTGTATTAGGTCTGCTTGG - Intronic
1061369753 9:130191685-130191707 GGTGCTGACTGCGGTCTGCCCGG - Intronic
1061433828 9:130548056-130548078 GGTTCCCAGTGAGATCAGCTTGG + Intergenic
1062300449 9:135864737-135864759 GGGTCTGAGTTAGGTCAGCCTGG - Intronic
1062383588 9:136299326-136299348 GTTTCTCCGTGAGGTCTGGTTGG - Intronic
1185784028 X:2874787-2874809 GATTTTGAGTGATGTCAGCTGGG - Intronic
1195799895 X:108696292-108696314 GTTTCTGACTGAGGTTTACTGGG - Exonic
1199187645 X:144935966-144935988 GATTCTGACTTAGGTCTGTTGGG - Intergenic
1200066556 X:153506822-153506844 GGGTCTCAGGGAGGTCTGCCAGG - Exonic
1200409625 Y:2848398-2848420 GTTTCTGAGGGAGGCCAGCTGGG + Intronic