ID: 902209961

View in Genome Browser
Species Human (GRCh38)
Location 1:14897846-14897868
Sequence CGGTTCTGAGTGAGGTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 213}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902209961_902209966 -3 Left 902209961 1:14897846-14897868 CCAGCAGACCTCACTCAGAACCG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 902209966 1:14897866-14897888 CCGCTTGCTGAAACTAACCGGGG 0: 1
1: 0
2: 0
3: 0
4: 24
902209961_902209963 -5 Left 902209961 1:14897846-14897868 CCAGCAGACCTCACTCAGAACCG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG 0: 1
1: 0
2: 0
3: 3
4: 46
902209961_902209967 7 Left 902209961 1:14897846-14897868 CCAGCAGACCTCACTCAGAACCG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 902209967 1:14897876-14897898 AAACTAACCGGGGCTCACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 52
902209961_902209964 -4 Left 902209961 1:14897846-14897868 CCAGCAGACCTCACTCAGAACCG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 902209964 1:14897865-14897887 ACCGCTTGCTGAAACTAACCGGG 0: 1
1: 0
2: 0
3: 4
4: 33
902209961_902209969 17 Left 902209961 1:14897846-14897868 CCAGCAGACCTCACTCAGAACCG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 902209969 1:14897886-14897908 GGGCTCACTCAGGAGCTGTCTGG 0: 1
1: 0
2: 0
3: 21
4: 188
902209961_902209970 18 Left 902209961 1:14897846-14897868 CCAGCAGACCTCACTCAGAACCG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 902209970 1:14897887-14897909 GGCTCACTCAGGAGCTGTCTGGG 0: 1
1: 0
2: 2
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902209961 Original CRISPR CGGTTCTGAGTGAGGTCTGC TGG (reversed) Intronic
900786215 1:4652571-4652593 CCATTCTGAGAGAGGTCAGCAGG + Intergenic
901331227 1:8410303-8410325 CCGTTCTGGGTGAGGTCTTGTGG - Intronic
902209961 1:14897846-14897868 CGGTTCTGAGTGAGGTCTGCTGG - Intronic
902781878 1:18710239-18710261 GGGTTCTAATTCAGGTCTGCCGG + Intronic
903459150 1:23508729-23508751 GGGGTCTGAGTGAGCTCTGAGGG + Exonic
908445168 1:64192736-64192758 AGGTTCTAACTGAGGTCTGAGGG - Intergenic
909039439 1:70631259-70631281 AGGTTCTGATTGAGGTCTGAGGG - Intergenic
916918638 1:169438803-169438825 GGGTTCTGAGTTAAGTCTGCTGG + Intronic
917959688 1:180132347-180132369 CGGTCCTGGGGGTGGTCTGCTGG + Intergenic
919604647 1:199667032-199667054 AGGTTCTAACTGAGGTCTGAGGG + Intergenic
920539379 1:206766649-206766671 GGCTTCTGACTGCGGTCTGCTGG - Intergenic
921323577 1:213968093-213968115 AGGTTTTAAGTGAGGTCTGGTGG - Intergenic
924483105 1:244454117-244454139 GGGTTTTGAGTTAGGTCTGCTGG - Intergenic
924808901 1:247383995-247384017 GGGTTTTGAGTTAGGTCTGCTGG + Intergenic
1069579869 10:69558736-69558758 AGGTTCTCACTGAGGTCTGTGGG + Intergenic
1071359609 10:84832997-84833019 AGGTTCTGCGTGACGTCTTCTGG + Intergenic
1077551001 11:3200306-3200328 CTGCTCTGAGGGAGCTCTGCTGG - Intergenic
1077902064 11:6497624-6497646 AGGTTCAGAGTGAGCTCTGTCGG + Exonic
1079430972 11:20387899-20387921 AGGTGCTGAGTGAGGGCCGCGGG + Intronic
1080451649 11:32383170-32383192 CGGATGTCAGGGAGGTCTGCAGG - Intergenic
1085158909 11:74322963-74322985 CAGTTTTGACTGAGGTCAGCTGG - Intergenic
1088257696 11:107916496-107916518 CTGTTCTCAGTTAGGTCTGTAGG - Intronic
1089858397 11:121567308-121567330 CTGTTCTGAGTGAGGACTGAAGG - Intronic
1091668253 12:2434732-2434754 CCGTTCTGAATGAAGTCTGAAGG + Intronic
1093943897 12:25085648-25085670 CTGTTCTCACTTAGGTCTGCAGG + Intronic
1096550473 12:52368794-52368816 AGGTCCTGGGTGAGGTCAGCTGG - Intergenic
1104965367 12:132506645-132506667 CGGTTCCCAGTGAGCTCTGAGGG - Intronic
1105426087 13:20296203-20296225 CAGTCCTGAGTGAGGGCTCCGGG + Intergenic
1106448872 13:29861908-29861930 AGGGTCTGAGTGAGGTGTGAGGG - Intergenic
1108610952 13:52083385-52083407 TGGTTCTGAGTGAGCTCTGAAGG + Intronic
1111921508 13:94416554-94416576 AGCTTCTGAGTGTGGCCTGCAGG + Intergenic
1113700959 13:112388069-112388091 GGGTTCTGAGTTAGGCCTGCTGG + Intronic
1115456731 14:33612608-33612630 AGGTTCAGAGTGAGGGGTGCTGG + Intronic
1117295690 14:54377167-54377189 TGATTTTGACTGAGGTCTGCTGG + Intergenic
1118817283 14:69322443-69322465 CGGTTCAGAGTCAGGTAAGCTGG - Intronic
1120244130 14:81986029-81986051 ATGTTCTGAGTGAGGCATGCTGG - Intergenic
1121782704 14:96632102-96632124 TGGTGCATAGTGAGGTCTGCTGG - Intergenic
1122973325 14:105161108-105161130 GGGGTCCGAGTGAGGTCTGTTGG + Intronic
1122973331 14:105161130-105161152 GGGGTCTGAGTGAGGTCTGTTGG + Intronic
1123985762 15:25644449-25644471 CGGGACTGAGTGAGGGCGGCAGG - Intergenic
1129878515 15:78992525-78992547 TGGATCTGAGTGAGGGATGCTGG + Intronic
1130016718 15:80193148-80193170 GGGTCCTGACTGAGGTCTGTTGG + Intergenic
1131144718 15:90003177-90003199 TGGGTCTGAGGGAGGCCTGCCGG + Intronic
1131162270 15:90114542-90114564 TGGGTCTGAGTGAAGTCAGCTGG - Intergenic
1132736265 16:1387650-1387672 TGGTTCTGAGTGATAGCTGCTGG - Intronic
1133715234 16:8441178-8441200 CTGTTCTTACTTAGGTCTGCAGG - Intergenic
1137716424 16:50601137-50601159 CAGCTCTGAGTGGAGTCTGCGGG + Intronic
1139650277 16:68358927-68358949 TGGTGCTGAGGGAGGTGTGCGGG + Exonic
1142530572 17:576919-576941 AGGTTCTGAGGGAGGTTTTCTGG - Intronic
1142531649 17:583424-583446 AGGTTCTGAGAGAGGTCTCTGGG - Intronic
1144667617 17:17112578-17112600 CGGTCCTGAGTGAGCCCTGCAGG - Intronic
1147220533 17:38926474-38926496 AGGCTCTGAAAGAGGTCTGCTGG - Intergenic
1148717763 17:49728002-49728024 AGGCTCTGAGGGTGGTCTGCTGG + Intronic
1152237132 17:79144441-79144463 AGCTTCTGAGTGAGGCCTGCAGG - Intronic
1152237970 17:79148300-79148322 AGTTTCTGAGTGAGGCCTGCAGG - Intronic
1162372431 19:10287499-10287521 AGCCTCTGAGTGAGGTCCGCGGG - Intronic
1162494692 19:11017145-11017167 CGGCTCTGAGTGAGGACCACAGG + Intronic
1166636606 19:44456875-44456897 AGGATCTCAGTGAGGTCTGTGGG + Intergenic
1167679083 19:50908585-50908607 CGTTTCTGGCTGGGGTCTGCTGG - Exonic
925984523 2:9205898-9205920 CGGTTTTGTGTGAGGTTGGCTGG + Intergenic
928329814 2:30349013-30349035 CAGTTCTGACTGTGGTCAGCTGG + Intergenic
931461391 2:62453280-62453302 CAGTGATGAGTGTGGTCTGCAGG + Intergenic
937064133 2:119004498-119004520 AGGTTTTGACTGAGGTCTGAGGG + Intergenic
937815581 2:126247269-126247291 CGGTTCTGACTGCCCTCTGCAGG - Intergenic
939057736 2:137383834-137383856 AGGTTCTAACTGAGGTCTGAGGG - Intronic
946382555 2:219358815-219358837 CGATCCTGAGGGAGGGCTGCGGG - Intergenic
948662987 2:239518192-239518214 CAGTTCTGGGTGAAGTCTCCCGG + Intergenic
1168750722 20:279315-279337 CGCTCCTGAGCGAGGTCTGCGGG + Exonic
1169778413 20:9281994-9282016 AGGCTCTGAGTGAGGGCAGCTGG - Intronic
1170920604 20:20675562-20675584 CAGTTCTGAGTGTGTTCTCCAGG + Intronic
1176269020 20:64225828-64225850 CGGGCCTTAGTGAGGACTGCAGG + Intronic
1183454348 22:37913611-37913633 CGGTTCTGAGTGAGGTCACTGGG + Intronic
1184980587 22:48093085-48093107 CAATTCTGACTGAGGACTGCTGG - Intergenic
1185013150 22:48327624-48327646 CGGCTCTGAATGAGGTCTGCAGG + Intergenic
1185156746 22:49197625-49197647 CGGTGCTGAGTGCGGACAGCAGG + Intergenic
954631257 3:52048801-52048823 TGGTTCTGCTTGGGGTCTGCTGG - Intergenic
961136769 3:124518764-124518786 CTGTTCTGAGTGGGATCTGGGGG - Exonic
970591711 4:17565660-17565682 CGATGCTGAGTGAGGTTTCCTGG - Intergenic
971308646 4:25505463-25505485 AGGTGCTGATTGAGGGCTGCAGG + Intergenic
971814276 4:31466597-31466619 GGGTTCTGAGTTAGGCCTGCTGG + Intergenic
976342971 4:83965071-83965093 AGGTTCTAACTGAGGTCTGAGGG + Intergenic
985636769 5:1039514-1039536 CGGTGCTGGGTGGGGTCTGTGGG + Intergenic
986838731 5:11672035-11672057 CCGCTCTGAGGCAGGTCTGCTGG + Intronic
988843182 5:35103044-35103066 AGGTTCTGAGTGATGACTGAAGG + Intronic
990810026 5:59713554-59713576 AGGTTCTAACTGAGGTCTGAGGG - Intronic
992655683 5:78907387-78907409 TGGTTCAGAGTGAGGACTGGAGG + Intronic
993734451 5:91459265-91459287 TGGTTCTGAGTGAGGAGTGGAGG - Intergenic
994981234 5:106876588-106876610 AGGTTCTAACTGAGGTCTGAGGG + Intergenic
1001006665 5:168057828-168057850 AGGTTCTAACTGAGGTCTGAGGG + Intronic
1003619443 6:7685065-7685087 TTTTGCTGAGTGAGGTCTGCAGG + Intergenic
1004750127 6:18553987-18554009 AGGTTCAGAGTGAAGTCAGCAGG + Intergenic
1005644044 6:27824541-27824563 TGGTTCTGAGTCAGTTCTGGGGG + Intergenic
1007415268 6:41687919-41687941 CGCTTCTGGGTCAGGTCCGCAGG + Exonic
1009681292 6:66896844-66896866 AGGTTCTAACTGAGGTCTGAGGG - Intergenic
1011113850 6:83867970-83867992 AGGTTCTAACTGAGGTCTGAGGG - Intronic
1012763392 6:103332312-103332334 CTGTTCTTACTTAGGTCTGCAGG - Intergenic
1015596373 6:134871411-134871433 AGGTTCTAACTGAGGTCTGAGGG + Intergenic
1015596990 6:134875319-134875341 AGGTTCTAACTGAGGTCTGAGGG + Intergenic
1019816696 7:3206177-3206199 AGGCTCTGAGTAAGGGCTGCAGG + Intergenic
1019879546 7:3846512-3846534 CTGTTGAGAGTGAGGTGTGCAGG - Intronic
1024186207 7:46950750-46950772 GGGTTCTGAGCCAGGTCTGCTGG - Intergenic
1024677902 7:51654481-51654503 TGGTTCTGAGTAACGTCTGAGGG - Intergenic
1025023911 7:55500358-55500380 CAGGACTGAGTGTGGTCTGCAGG + Intronic
1029280641 7:99433320-99433342 CGGTGCTGATTGGGGGCTGCGGG - Exonic
1032943831 7:136827075-136827097 CAGTTTTGAGTGAGGGCTTCAGG - Intergenic
1034885963 7:154799090-154799112 CGGGTCTCCCTGAGGTCTGCAGG - Intronic
1035363593 7:158330083-158330105 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035363597 7:158330129-158330151 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363604 7:158330175-158330197 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363609 7:158330221-158330243 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035363613 7:158330267-158330289 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363618 7:158330313-158330335 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363631 7:158330449-158330471 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363641 7:158330541-158330563 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363662 7:158330771-158330793 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363667 7:158330817-158330839 TGGATGTGAGTGACGTCTGCGGG - Intronic
1035363676 7:158330909-158330931 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035363682 7:158331001-158331023 TGGATGTGAGTGACGTCTGCGGG - Intronic
1035363687 7:158331047-158331069 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035363691 7:158331093-158331115 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363696 7:158331139-158331161 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363704 7:158331231-158331253 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363709 7:158331277-158331299 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363733 7:158331461-158331483 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363743 7:158331553-158331575 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363772 7:158331875-158331897 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363803 7:158332197-158332219 TGGATGTGAGTGATGTCTGCAGG - Intronic
1035363825 7:158332427-158332449 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035363839 7:158332565-158332587 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035363847 7:158332657-158332679 TGGGTGTGAGTGATGTCTGCAGG - Intronic
1035363872 7:158332934-158332956 TGGGTGTGAGTGATGTCTGCAGG - Intronic
1035363877 7:158332980-158333002 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035363881 7:158333026-158333048 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035363889 7:158333118-158333140 TGGGTGTGAGTGATGTCTGCAGG - Intronic
1035363894 7:158333164-158333186 TGGGTTTGAGTGACGTCTGCAGG - Intronic
1035363916 7:158333348-158333370 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035363921 7:158333394-158333416 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035363969 7:158333853-158333875 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363974 7:158333899-158333921 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363989 7:158334056-158334078 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035363995 7:158334102-158334124 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364014 7:158334305-158334327 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364026 7:158334414-158334436 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364039 7:158334525-158334547 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364050 7:158334617-158334639 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035364056 7:158334663-158334685 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364066 7:158334751-158334773 TGGGTGTGAGTGATGTCTGCGGG - Intronic
1035364077 7:158334842-158334864 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364097 7:158335026-158335048 TGGATGTGAGTGACGTCTGCGGG - Intronic
1035364102 7:158335072-158335094 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364117 7:158335210-158335232 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364122 7:158335256-158335278 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364138 7:158335394-158335416 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364146 7:158335487-158335509 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364171 7:158335764-158335786 TGGGTGTGAGTGATGTCTGCAGG - Intronic
1035364176 7:158335810-158335832 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364180 7:158335856-158335878 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364188 7:158335945-158335967 TGGGTGTGAGTGATGTCTGCAGG - Intronic
1035364193 7:158335991-158336013 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364215 7:158336221-158336243 TGGGTGTGAGTGATGTCTGCGGG - Intronic
1035364220 7:158336286-158336308 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035364226 7:158336332-158336354 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364233 7:158336424-158336446 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364260 7:158336688-158336710 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035364265 7:158336734-158336756 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035364271 7:158336780-158336802 TGGATGTGAGTGACGTCTGCAGG - Intronic
1035364285 7:158336916-158336938 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035364290 7:158336981-158337003 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035364300 7:158337073-158337095 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035364356 7:158337579-158337601 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364366 7:158337671-158337693 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364370 7:158337717-158337739 TGGTTGTGAGTGACGTCTGCGGG - Intronic
1035364385 7:158337875-158337897 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364395 7:158337967-158337989 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035364401 7:158338013-158338035 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364411 7:158338101-158338123 TGGGTGTGAGTGATGTCTGCGGG - Intronic
1035364422 7:158338192-158338214 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364436 7:158338330-158338352 TGGATGTGAGTGACGTCTGCGGG - Intronic
1035364441 7:158338376-158338398 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364456 7:158338514-158338536 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364461 7:158338560-158338582 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364482 7:158338791-158338813 TGGGTGTGAGTGATGTCTGCAGG - Intronic
1035364487 7:158338837-158338859 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364491 7:158338883-158338905 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364499 7:158338975-158338997 TGGGTGTGAGTGATGTCTGCAGG - Intronic
1035364504 7:158339021-158339043 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364524 7:158339205-158339227 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364541 7:158339390-158339412 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364565 7:158339667-158339689 TGGGTGTGAGTGATGTCTGCAGG - Intronic
1035364570 7:158339713-158339735 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364574 7:158339759-158339781 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364582 7:158339851-158339873 TGGGTGTGAGTGATGTCTGCAGG - Intronic
1035364587 7:158339897-158339919 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364607 7:158340081-158340103 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364646 7:158340449-158340471 TGGATGTGAGTGACGTCTGCGGG - Intronic
1035364651 7:158340495-158340517 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364662 7:158340587-158340609 TGGGTGTGAGTGATGTCTGCGGG - Intronic
1035364667 7:158340652-158340674 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035364673 7:158340698-158340720 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364682 7:158340788-158340810 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364702 7:158341007-158341029 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364712 7:158341095-158341117 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364718 7:158341158-158341180 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035364765 7:158341591-158341613 TGGGTGTGAGTGATGTCTGCGGG - Intronic
1035364784 7:158341774-158341796 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364789 7:158341820-158341842 TGGGTGTGAGTGACGTCTGCTGG - Intronic
1035364800 7:158341909-158341931 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364804 7:158341955-158341977 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035364810 7:158342001-158342023 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364821 7:158342093-158342115 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364837 7:158342250-158342272 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035364842 7:158342295-158342317 TGGGTGTGAGTGACGTCTGCGGG - Intronic
1035364847 7:158342341-158342363 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364854 7:158342433-158342455 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1035364858 7:158342479-158342501 TGGGTTTGAGTGACGTCTGCAGG - Intronic
1035364862 7:158342525-158342547 TGGGTGTGAGTGACGTCTGCAGG - Intronic
1038357523 8:26843205-26843227 CGGTTCTGAGCTAAGTCTTCTGG - Intronic
1038663595 8:29518476-29518498 AGGTTCTGTCTCAGGTCTGCTGG + Intergenic
1042844580 8:73157574-73157596 CTGTCCTCAGTCAGGTCTGCTGG - Intergenic
1043198427 8:77330416-77330438 GTGTTCTGGGTGAGGTCTGCTGG - Intergenic
1044751674 8:95422584-95422606 TGGTTCAGAGTCAGATCTGCAGG - Intergenic
1045109105 8:98922541-98922563 AGGTTCTGAGCTAGGTGTGCAGG - Intronic
1047694912 8:127393851-127393873 CTCTTCTGAGTGAGGCTTGCAGG - Intergenic
1049651525 8:143771952-143771974 CGGTGCTGAAGGAGGTCAGCGGG + Intergenic
1052688989 9:31791148-31791170 AGGTTCTAACTGAGGTCTGAGGG - Intergenic
1055336709 9:75239106-75239128 AGGTTCTAACTGAGGTCTGAGGG + Intergenic
1055663705 9:78532491-78532513 GGATTCTGAGTGAGCTCTACAGG + Intergenic
1056126907 9:83543582-83543604 GGGTGCTGAGGGATGTCTGCAGG - Intergenic
1057552126 9:96059147-96059169 AGGTAGTGAGTGAGGTCTCCTGG + Intergenic
1062371930 9:136244273-136244295 CAGTTCTGAGTCAGGTCAACAGG + Intronic
1062556683 9:137115997-137116019 CGGTCCTGGGTGAGGGTTGCTGG - Intergenic
1195799896 X:108696293-108696315 CGTTTCTGACTGAGGTTTACTGG - Exonic