ID: 902209963

View in Genome Browser
Species Human (GRCh38)
Location 1:14897864-14897886
Sequence AACCGCTTGCTGAAACTAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902209960_902209963 -4 Left 902209960 1:14897845-14897867 CCCAGCAGACCTCACTCAGAACC 0: 1
1: 0
2: 3
3: 20
4: 207
Right 902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG 0: 1
1: 0
2: 0
3: 3
4: 46
902209958_902209963 15 Left 902209958 1:14897826-14897848 CCTGAAAGGCTCTCAGGACCCCA 0: 1
1: 0
2: 4
3: 20
4: 221
Right 902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG 0: 1
1: 0
2: 0
3: 3
4: 46
902209961_902209963 -5 Left 902209961 1:14897846-14897868 CCAGCAGACCTCACTCAGAACCG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG 0: 1
1: 0
2: 0
3: 3
4: 46
902209957_902209963 18 Left 902209957 1:14897823-14897845 CCTCCTGAAAGGCTCTCAGGACC 0: 1
1: 0
2: 2
3: 25
4: 193
Right 902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG 0: 1
1: 0
2: 0
3: 3
4: 46
902209959_902209963 -3 Left 902209959 1:14897844-14897866 CCCCAGCAGACCTCACTCAGAAC 0: 1
1: 0
2: 3
3: 16
4: 186
Right 902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG 0: 1
1: 0
2: 0
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902209963 Original CRISPR AACCGCTTGCTGAAACTAAC CGG Intronic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
906443614 1:45873740-45873762 AACAGCTTGATGATATTAACAGG - Intronic
910066039 1:83151781-83151803 AACCTCTTGCTAAAGCCAACTGG + Intergenic
911036253 1:93552125-93552147 CAACGCTTGCTGAAACTAATTGG - Intronic
919342002 1:196322414-196322436 AAACACAGGCTGAAACTAACCGG + Intronic
920654271 1:207864047-207864069 AACCACTTGCTGGAAGTAGCAGG - Intergenic
1063791331 10:9451554-9451576 AACCGTGTGCTGAAACTTGCTGG + Intergenic
1070106488 10:73437074-73437096 AACTGCTTGGTTAAACTAAATGG - Exonic
1079159566 11:17979309-17979331 CACTGCTTGCAGAAATTAACTGG + Intronic
1081276565 11:41156864-41156886 AAACTCATGCTGAAACTACCAGG + Intronic
1087748498 11:101978368-101978390 AACGAATTGCTGAAACTAAGCGG + Exonic
1102316609 12:111893513-111893535 GACTGCTTGCTGGAACTCACAGG + Intronic
1107206222 13:37792143-37792165 AAACCCTTGATGAAACTCACTGG - Intronic
1113134823 13:107077770-107077792 AACAGCTTGATAAAAATAACAGG - Intergenic
1122748180 14:103912601-103912623 CACGGCTTGCTGAAATTTACAGG + Exonic
1128955108 15:71932616-71932638 AACCCCTTCCAGAAATTAACTGG + Intronic
1129951367 15:79594685-79594707 AACCCATTTCTGAAACTTACTGG + Intergenic
1135962676 16:27010791-27010813 TGCCCCTTGCTGAAACTCACTGG - Intergenic
1141920655 16:87133438-87133460 AGCCACTTGCGGAAACTAAAAGG + Intronic
1144132840 17:12264729-12264751 AACCGCTTCATGAAACAATCTGG + Intergenic
1147992811 17:44345440-44345462 AACCGCTTACTGAAACTCCTTGG + Intronic
1152598199 17:81248505-81248527 AGCCGCTTGCGGCAAATAACTGG - Intronic
1155995048 18:32322186-32322208 AGCCACTGGCTGAAACTAAAAGG + Intronic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
1167021167 19:46877160-46877182 AATCGCTTGATGAAACCAAGAGG + Intergenic
934961824 2:98682497-98682519 AAATGCATGCTAAAACTAACAGG + Intronic
935837010 2:107065783-107065805 AACCTCTTGGTAAATCTAACCGG + Intergenic
938577219 2:132615959-132615981 AATCACTTGCTTAAAATAACTGG - Intronic
940619891 2:156098597-156098619 CTCTGCTTGCTTAAACTAACAGG + Intergenic
942769074 2:179494680-179494702 AACTGGTTGCTGAATCTAAGAGG - Intronic
959593488 3:108104070-108104092 AACTGCCAGCTGAAACTAGCAGG + Intergenic
961727155 3:128938953-128938975 AAAGCCTTGCTGAAACTCACTGG - Intronic
963326456 3:143868758-143868780 AAACACTTGCTTAAACAAACAGG + Intergenic
966225748 3:177596238-177596260 AACCTCTTGATGAAGCTAATAGG - Intergenic
970012146 4:11470881-11470903 AACGGCTTGCTGAAACCTGCTGG + Intergenic
971151321 4:24035129-24035151 AAACACTTGTTGAAACTAACAGG + Intergenic
972661857 4:41123874-41123896 AAACGATTGCTTAAACTAGCAGG + Intronic
984055835 4:174928381-174928403 AACCGCATCCTGTAACTGACTGG + Intronic
988839364 5:35068104-35068126 AAAGGCTGGCTGAAACTACCAGG + Intronic
996977131 5:129448435-129448457 AAGCGCGTGCTGAAACTCACGGG - Intergenic
1004921259 6:20378254-20378276 ACCAGCTTGCTGAAAATAAATGG + Intergenic
1008717203 6:54303320-54303342 AACCCCTTGTTGAAACCCACTGG + Intergenic
1013391909 6:109693774-109693796 AACCATTTGCTGAAACAAAGAGG - Intronic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1025990561 7:66493735-66493757 CACCGCCTGCTGACACTGACCGG - Intergenic
1027278070 7:76582994-76583016 AACCTCTTGCTAAAGCCAACGGG - Intergenic
1036178393 8:6561971-6561993 CACCGGTTGCTGGAACTGACGGG + Intronic
1041754591 8:61300072-61300094 ATCCGCTTGGTGAAACTTCCTGG - Exonic
1047066113 8:121284948-121284970 AACAACTTGATGAAACTCACTGG + Intergenic
1199455677 X:148025428-148025450 AACAGGTAGCTGAGACTAACAGG - Intronic