ID: 902209967

View in Genome Browser
Species Human (GRCh38)
Location 1:14897876-14897898
Sequence AAACTAACCGGGGCTCACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902209960_902209967 8 Left 902209960 1:14897845-14897867 CCCAGCAGACCTCACTCAGAACC 0: 1
1: 0
2: 3
3: 20
4: 207
Right 902209967 1:14897876-14897898 AAACTAACCGGGGCTCACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 52
902209958_902209967 27 Left 902209958 1:14897826-14897848 CCTGAAAGGCTCTCAGGACCCCA 0: 1
1: 0
2: 4
3: 20
4: 221
Right 902209967 1:14897876-14897898 AAACTAACCGGGGCTCACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 52
902209961_902209967 7 Left 902209961 1:14897846-14897868 CCAGCAGACCTCACTCAGAACCG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 902209967 1:14897876-14897898 AAACTAACCGGGGCTCACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 52
902209957_902209967 30 Left 902209957 1:14897823-14897845 CCTCCTGAAAGGCTCTCAGGACC 0: 1
1: 0
2: 2
3: 25
4: 193
Right 902209967 1:14897876-14897898 AAACTAACCGGGGCTCACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 52
902209959_902209967 9 Left 902209959 1:14897844-14897866 CCCCAGCAGACCTCACTCAGAAC 0: 1
1: 0
2: 3
3: 16
4: 186
Right 902209967 1:14897876-14897898 AAACTAACCGGGGCTCACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 52
902209962_902209967 -1 Left 902209962 1:14897854-14897876 CCTCACTCAGAACCGCTTGCTGA 0: 1
1: 0
2: 0
3: 9
4: 104
Right 902209967 1:14897876-14897898 AAACTAACCGGGGCTCACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902209967 Original CRISPR AAACTAACCGGGGCTCACTC AGG Intronic
902209967 1:14897876-14897898 AAACTAACCGGGGCTCACTCAGG + Intronic
905921102 1:41719456-41719478 AAACTCACTAGGGCTCACTAGGG - Intronic
906484878 1:46226492-46226514 GAACTAACCTGGGTTCTCTCTGG + Intergenic
906609117 1:47190016-47190038 AAATCAACCTGGGCTCAGTCTGG + Exonic
907774597 1:57501394-57501416 GACTTAACCTGGGCTCACTCAGG - Intronic
909900352 1:81127059-81127081 AAACAAACCAGGCCTCACACTGG + Intergenic
915647771 1:157286075-157286097 GGACTAACCTGGGCTCTCTCAGG - Intergenic
922804793 1:228379714-228379736 AAAACAACCGGGCCTCATTCTGG - Intergenic
1064603445 10:17015609-17015631 AATGTAACCGGGGCTCAATAAGG + Intronic
1065950307 10:30645492-30645514 ACGCAAACCGCGGCTCACTCTGG + Intergenic
1073222575 10:101888094-101888116 AGACTAACCAGAGCTCACTGTGG + Intronic
1075102573 10:119516705-119516727 AAACTAACCGAGGCTGGCTCAGG + Intronic
1076567735 10:131410438-131410460 AAACTAGCAGAGCCTCACTCGGG - Intergenic
1087086237 11:94221388-94221410 AAACTAGCTGAGGCTCACCCAGG - Intergenic
1090497772 11:127231459-127231481 AAACAAACCAGAGCTCACTGTGG + Intergenic
1094567873 12:31616489-31616511 AAAGTTCCCGGGGCTCCCTCCGG - Intergenic
1110947816 13:81445297-81445319 AAACTATCTTGAGCTCACTCAGG + Intergenic
1114937875 14:27566691-27566713 AGACTAATCTGGGCTCACTCTGG + Intergenic
1118330690 14:64813485-64813507 AAACAAAGCATGGCTCACTCTGG - Intronic
1127876009 15:63111966-63111988 AAACTAACAGCTGCTCTCTCTGG + Intergenic
1131411338 15:92210516-92210538 AAACTTACCCGGGCTCAGTGAGG - Intergenic
1132701429 16:1223825-1223847 AAACTAACCAGGGCTCCCGGAGG + Intronic
1132771115 16:1564080-1564102 CAAACAGCCGGGGCTCACTCTGG + Exonic
1141228416 16:82140892-82140914 AAACTAACAGCGGATCTCTCGGG + Intergenic
1146251155 17:31345447-31345469 AAAGTTCCCGGGGCTCCCTCCGG + Intronic
1146680174 17:34801459-34801481 AAAGTGACCAGGGATCACTCAGG + Intergenic
1158656141 18:59336261-59336283 AAAGGAACCAGGGCTCACTGAGG + Intronic
925238464 2:2299456-2299478 AAACTAACTGGTGCACACTCAGG - Intronic
925309873 2:2874961-2874983 ACACTGACCGGGGCTGGCTCTGG - Intergenic
925412234 2:3646514-3646536 AAACAAACCAGGGACCACTCAGG - Intergenic
929765827 2:44843467-44843489 AAACTGACCCCGGCTCACTGTGG + Intergenic
946211823 2:218153336-218153358 AACCTAAACTGGGCTCACTCTGG - Intergenic
947115812 2:226768946-226768968 AAAGTAACCAGAGCTCACTGAGG + Intronic
948749338 2:240121884-240121906 AAACAAACCGAAGCTCCCTCTGG - Intergenic
1173169541 20:40712961-40712983 TAATGAACCAGGGCTCACTCTGG + Intergenic
1173495364 20:43514327-43514349 AAACTAACACAGGCCCACTCAGG - Intronic
950772432 3:15323160-15323182 AAATAAAGCAGGGCTCACTCAGG + Intronic
957786279 3:84886769-84886791 AGACTAACAGGGGCTCTATCAGG + Intergenic
964291405 3:155185132-155185154 AAATTAACCAGGGCTATCTCTGG + Intergenic
966311744 3:178601807-178601829 AAACTAACAGTGGCACTCTCAGG + Intronic
979659737 4:123239466-123239488 AGACTAACAGCGGCTCTCTCGGG + Intronic
980137975 4:128878967-128878989 AAACAAAAAGAGGCTCACTCGGG + Intronic
982531237 4:156546631-156546653 AAACTAAACAGAGCTCACTGTGG + Intergenic
987336567 5:16902656-16902678 AAATTAGCCGGGCCTCTCTCCGG - Intronic
990412225 5:55552604-55552626 AAAATTCCCGGGGCTCCCTCCGG - Intergenic
992279115 5:75155203-75155225 AAATTAACCACGGCTGACTCAGG - Intronic
1004812339 6:19274443-19274465 AATGTACCCGGGGCTCACTGAGG - Intergenic
1010792288 6:80078411-80078433 AAACTCTCTGGGGCTCCCTCTGG - Intergenic
1012069449 6:94594187-94594209 AAAATGACAGGGGCTCAATCAGG - Intergenic
1033372738 7:140726001-140726023 AAACTAACTGGTGGTCACTAGGG + Intronic
1045448667 8:102295874-102295896 AAATTAACAAGGGCTCTCTCTGG - Intronic
1048307267 8:133293063-133293085 AAAGAAACCTGGGCTCCCTCGGG - Intronic
1049437364 8:142593709-142593731 TGACCAAGCGGGGCTCACTCAGG - Intergenic
1050633418 9:7584147-7584169 ATTCTAACCAGGGCTCACTTTGG + Intergenic
1053108403 9:35434641-35434663 AAACTAACAGTGGTTCCCTCAGG - Intergenic
1057521709 9:95765484-95765506 AAAGTAACCTGGGCTAACACAGG - Intergenic
1196050378 X:111297957-111297979 AAAATAACCTGGTCTCACTGTGG - Exonic