ID: 902209969

View in Genome Browser
Species Human (GRCh38)
Location 1:14897886-14897908
Sequence GGGCTCACTCAGGAGCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902209962_902209969 9 Left 902209962 1:14897854-14897876 CCTCACTCAGAACCGCTTGCTGA 0: 1
1: 0
2: 0
3: 9
4: 104
Right 902209969 1:14897886-14897908 GGGCTCACTCAGGAGCTGTCTGG 0: 1
1: 0
2: 0
3: 21
4: 188
902209961_902209969 17 Left 902209961 1:14897846-14897868 CCAGCAGACCTCACTCAGAACCG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 902209969 1:14897886-14897908 GGGCTCACTCAGGAGCTGTCTGG 0: 1
1: 0
2: 0
3: 21
4: 188
902209965_902209969 -3 Left 902209965 1:14897866-14897888 CCGCTTGCTGAAACTAACCGGGG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 902209969 1:14897886-14897908 GGGCTCACTCAGGAGCTGTCTGG 0: 1
1: 0
2: 0
3: 21
4: 188
902209959_902209969 19 Left 902209959 1:14897844-14897866 CCCCAGCAGACCTCACTCAGAAC 0: 1
1: 0
2: 3
3: 16
4: 186
Right 902209969 1:14897886-14897908 GGGCTCACTCAGGAGCTGTCTGG 0: 1
1: 0
2: 0
3: 21
4: 188
902209960_902209969 18 Left 902209960 1:14897845-14897867 CCCAGCAGACCTCACTCAGAACC 0: 1
1: 0
2: 3
3: 20
4: 207
Right 902209969 1:14897886-14897908 GGGCTCACTCAGGAGCTGTCTGG 0: 1
1: 0
2: 0
3: 21
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902209969 Original CRISPR GGGCTCACTCAGGAGCTGTC TGG Intronic
900630041 1:3630013-3630035 GGGCTGCCTCAGAAGCTGGCTGG + Exonic
900769580 1:4529808-4529830 GGGCACATTCAGGAGCTCACAGG + Intergenic
900977704 1:6027365-6027387 CTGCTCACTCAGTAGCTGGCAGG - Intronic
902209969 1:14897886-14897908 GGGCTCACTCAGGAGCTGTCTGG + Intronic
902360870 1:15941983-15942005 GGGGACATTCAGGAGCTGTAGGG + Exonic
902527779 1:17070492-17070514 GGGGTCACTGAGGTGCTGTGTGG - Intronic
903462586 1:23530040-23530062 GGGCTATCTCAGGAGCTGGCTGG + Intronic
903930158 1:26857257-26857279 AGGTTTCCTCAGGAGCTGTCTGG + Exonic
905514670 1:38553609-38553631 GGGCTCACCCAGAAGCTGGAAGG - Intergenic
906640135 1:47436887-47436909 GGGTTCACTGAGGGGGTGTCGGG + Exonic
907377520 1:54056046-54056068 GGGCTCAATCAAGTGCTGTCTGG - Intronic
914704904 1:150162546-150162568 GGGCTGGCTCAGTAGCTGTGTGG + Intronic
917065879 1:171092703-171092725 GGCCTCCATCAGGAGCTGTCTGG + Exonic
917905507 1:179584071-179584093 GGTCTGACCCAGGAGCTCTCTGG + Intergenic
918051564 1:180977362-180977384 GGGCTCCCCCAGGGCCTGTCTGG - Intronic
918063635 1:181084347-181084369 GAGGTCACTCAGGCGCTATCTGG - Intergenic
920266982 1:204731281-204731303 GGACTCACTCTGGAGCTGCCAGG - Intergenic
920970865 1:210742702-210742724 GGGCTCAAGGAGAAGCTGTCTGG + Intronic
923007019 1:230058206-230058228 AGGCTCACTCAGGGGCAGCCTGG + Intronic
1063983465 10:11475980-11476002 TCGCACACTCAGGAGTTGTCTGG - Intronic
1064330856 10:14392606-14392628 GGGATCCCTCAGAAGCAGTCTGG + Intronic
1067288454 10:44924343-44924365 GGACTCACCCAGGAGCTCTGGGG - Intronic
1067364744 10:45615252-45615274 AGGCTAACTTAGGAGCTGTGAGG - Intergenic
1067504832 10:46840544-46840566 GGGGTCCCACAGGAGCTGGCGGG + Intergenic
1067682657 10:48450538-48450560 GGGCTCACTCAGCAGCTGCACGG - Exonic
1068875094 10:61987190-61987212 GGGCTCCCTCATGGGCTGGCTGG - Intronic
1070147628 10:73786130-73786152 GGCCTCGCTCGGGAGCTGTCCGG + Intronic
1076340493 10:129741991-129742013 GGGCTCACTGAGGGGCTCTGGGG + Intronic
1076485109 10:130810837-130810859 GGGCGCACTCAGGTGCTTGCAGG - Intergenic
1077353012 11:2101420-2101442 GGGAACACACAGGAGCTGTGGGG - Intergenic
1084669521 11:70596767-70596789 GGGTACACTCAGGGGCTGTCTGG + Intronic
1085512473 11:77095350-77095372 GGGCTCAGTCAGGGGCTGAAGGG + Intronic
1089700472 11:120241092-120241114 GGGCTAAGGCAGGAGCTGCCAGG + Intronic
1090064549 11:123491775-123491797 GGGCTCACTCTGGAGCTGCGTGG - Intergenic
1090321053 11:125844286-125844308 GGGCCCACCCAGGAGCTGCATGG + Intergenic
1090469391 11:126966640-126966662 GGGCTCATTCTGGAGGTGGCTGG + Intronic
1091004149 11:131937381-131937403 GAGCTCACACAGGAGTTGTGTGG + Intronic
1091224945 11:133951510-133951532 GGGCTCCCCCAGCAGCTGTGAGG + Intronic
1091950680 12:4590638-4590660 GGGCCCTCTCTAGAGCTGTCAGG + Intronic
1092058091 12:5523637-5523659 GCACTCACTCAGGGGCTGGCGGG - Intergenic
1096480127 12:51934559-51934581 GTGCTCACCCAGGAGATGTCTGG - Intergenic
1098134228 12:67384832-67384854 GGTCTCACTCAGGAGATAGCAGG - Intergenic
1101212649 12:102549928-102549950 GGCCTCACTCAGGAACTCTGGGG + Intergenic
1102001425 12:109560146-109560168 GGGATCTCTAAGGAGCTATCTGG + Intronic
1102205614 12:111088932-111088954 CAGCTCACTCAGGAGCAGGCAGG - Intronic
1102245398 12:111352728-111352750 GGGCTGACTCAGGAGCTCCAGGG - Intergenic
1103008534 12:117439981-117440003 GGCCTCACTCAGGATCCGGCGGG - Intronic
1103041933 12:117702940-117702962 GGGCTCCCTGAGGAGCTGGCTGG - Intronic
1104436652 12:128762185-128762207 GGGTTCCTTCAGGAGCTGTGAGG + Intergenic
1105025174 12:132843602-132843624 GGCCTCAGTCAGGAGCCGGCAGG - Intronic
1105037097 12:132933493-132933515 AGGCTCACTCAGTGGCTGTTGGG - Intronic
1106885054 13:34175907-34175929 GGGCTGGCTCAGGAGCTGACTGG + Intergenic
1108422135 13:50261809-50261831 GAGCTCTTTCTGGAGCTGTCTGG + Intronic
1110238387 13:73240366-73240388 CGACTTACTCAAGAGCTGTCTGG + Intergenic
1113598122 13:111548562-111548584 GGGCTCACTCAGGAGACATCAGG - Intergenic
1113705033 13:112424721-112424743 GAGCTAAATCAGGAGCTGCCTGG - Intronic
1114416232 14:22546369-22546391 GGGCTGGCTCAGCAACTGTCGGG + Intergenic
1115731303 14:36272387-36272409 GGGTTCAAACAGCAGCTGTCTGG - Intergenic
1121109146 14:91300597-91300619 AGGCTCACCCAGGAGCTGCCAGG + Intronic
1121601593 14:95208909-95208931 TCACTCACTCAGTAGCTGTCTGG + Intronic
1122878561 14:104679739-104679761 GGGGTCACCCAGGAGCAGCCTGG - Intergenic
1122903382 14:104791130-104791152 GGGCTGACCCAGGAGATGCCAGG - Intronic
1123035301 14:105469530-105469552 GCGCTCACCCATGAGCTCTCTGG + Intronic
1123115393 14:105892089-105892111 GGGCTCACTGAGGGGCTTTTGGG + Intergenic
1123119646 14:105910807-105910829 GGGCTCACTGAGGGGCTTTTGGG + Intergenic
1124071269 15:26395065-26395087 GGGCTTACTCAGGCACGGTCAGG - Intergenic
1130894845 15:88161866-88161888 GGGCATATTCAGGAGCTGGCAGG + Intronic
1132882354 16:2168023-2168045 GGGCTCCCTCAGCAGATGTGGGG - Intronic
1133340809 16:5034619-5034641 GGGCTCACTCAGAAGGTCCCTGG - Intronic
1138514520 16:57528765-57528787 GCGCTCACCAAGGAGCTGGCGGG - Exonic
1139364244 16:66423985-66424007 GGCCTCTCTAAGGAGATGTCAGG + Intergenic
1139914170 16:70418036-70418058 GGAGCCACTGAGGAGCTGTCAGG + Intronic
1143009864 17:3860137-3860159 GGGCTGGCTCAGGAGGTGACCGG - Intergenic
1143660297 17:8320564-8320586 GGGATCACGCAGGACCTGACAGG + Intronic
1143863735 17:9909233-9909255 GGGCTCACTGCGGGGCTGTAAGG - Intergenic
1144431675 17:15198362-15198384 GGGCTTACCCAGGAGCTGCAAGG + Intergenic
1146586815 17:34089908-34089930 GAGCTGACTGAGGAGCTGTTTGG - Intronic
1147315059 17:39616125-39616147 GGGCTGACTCAAGAGATCTCTGG - Intergenic
1151226464 17:72651614-72651636 GAGCTGACTTAGGAGCTGTGGGG + Intronic
1151227141 17:72655867-72655889 GAGCTGACTTAGGAGCTGTGGGG + Intronic
1152216190 17:79034048-79034070 AGGCTTCCTCAGGAGCTGCCTGG + Intronic
1152444318 17:80332246-80332268 GGGCTCACTCAGCAACTCTGCGG - Exonic
1152881445 17:82818359-82818381 GGGCTGACTCAGGAGGTGACAGG + Intronic
1203169032 17_GL000205v2_random:130068-130090 GGGATCAATCAGGAGCTGAAGGG + Intergenic
1154123615 18:11671187-11671209 GTGCAGACTCAGGAGCTGTGGGG - Intergenic
1154325360 18:13387201-13387223 GGGCTCCCACAGGGGCTGCCAGG - Intronic
1155592654 18:27445693-27445715 GGGCTCTCTCGGGAGCTCTAGGG + Intergenic
1157545404 18:48542998-48543020 GGTCTCACTCAGGCCCTGCCTGG + Intronic
1160403732 18:78629958-78629980 CTGCTCACTCAGGAACTGTGGGG + Intergenic
1160657641 19:281711-281733 GGGAGCACTGAGGAGCTGACAGG + Intronic
1160673234 19:376152-376174 CGGCTCACTCAGGACCTCCCAGG + Intergenic
1160682857 19:419858-419880 AGCCTCACTCAGGAGCTGCTCGG - Intronic
1160892901 19:1388517-1388539 GGGCCCACGCTGGAGCTGCCGGG - Exonic
1161896506 19:7085899-7085921 TAGATCACTCAGGAGCTGTTTGG - Intronic
1161910864 19:7192800-7192822 GTGCTCACCCAGGAGCTTTTGGG - Intronic
1162199464 19:9010228-9010250 GGGCTCACTGAGGAGCTGGACGG - Intergenic
1162396900 19:10422569-10422591 GGCCTCACTCAGGAGCTCCAGGG - Intronic
1162417793 19:10548581-10548603 GGAGTCACTGAGGACCTGTCAGG + Intronic
1164245042 19:23421306-23421328 GGGGGCACTCAGGAGGTATCTGG - Intergenic
1165074877 19:33275244-33275266 GGGCTCACTCAGCGTCTCTCAGG - Intergenic
1166126101 19:40716272-40716294 CGGCTGACTCAGGAGCTGGGTGG + Intronic
1168015017 19:53565988-53566010 GGGGTGTGTCAGGAGCTGTCAGG + Intronic
1168439049 19:56347772-56347794 AGGCTCTCTAAGGTGCTGTCTGG - Intronic
925157195 2:1657367-1657389 GGTCTCAGTCAGGAGTTGGCAGG - Intronic
926224962 2:10961061-10961083 GGGCTCAGTCAGCAGCTCCCCGG - Intergenic
929276263 2:40028111-40028133 CGGCTTCCTCAGCAGCTGTCAGG - Intergenic
929823216 2:45289931-45289953 GGGCTCACTGACCAGCTTTCTGG + Intergenic
932180040 2:69638700-69638722 GGGGTTACTCAGGACCTCTCAGG - Intronic
932581353 2:72994579-72994601 GGGACCAGTCAGGAGCTGCCTGG - Intronic
932773700 2:74515014-74515036 GGGCCCACTCCGGAGCTGCCGGG - Exonic
934158224 2:89222939-89222961 GGGCTCACTCACCAGGTGCCAGG - Intergenic
934209040 2:89959485-89959507 GGGCTCACTCACCAGGTGCCAGG + Intergenic
934979760 2:98829986-98830008 GGCCTCCCTCCGGAGCTGTGGGG + Intronic
935777772 2:106487669-106487691 GGCCTCAGTCAGGGGCTCTCCGG - Intergenic
936682604 2:114791432-114791454 TGTCTCACTCAGGAGCTGCTGGG + Intronic
938241070 2:129742595-129742617 GGGCTCCATCAGGGGCTGTGTGG + Intergenic
939597841 2:144149285-144149307 GTGCTCAAGCAGCAGCTGTCAGG - Intronic
940883437 2:158968941-158968963 GGGCACACCCGGGAGCTTTCCGG + Intronic
943009640 2:182431783-182431805 GGGGTCACTCAGGATCTTTCTGG + Intronic
943396940 2:187350841-187350863 TGTCTCACTCAGCTGCTGTCTGG + Intronic
945714004 2:213336066-213336088 GGGCCCACCCAAGAGCTGTGTGG + Intronic
947100698 2:226618223-226618245 GGCCCCACTCAGGAGCAGTGGGG + Intergenic
948852846 2:240716817-240716839 GGCCGCAGTGAGGAGCTGTCTGG - Exonic
949049206 2:241888285-241888307 GGTCTCACTCAGTGGGTGTCAGG + Intergenic
1168982119 20:2014136-2014158 CTACTCACTCAGGAGCTGACAGG + Intergenic
1169353132 20:4886124-4886146 GGGCCCACCCTGGAGCTGCCTGG - Intronic
1171419123 20:25006096-25006118 GAGCTCACCAAGGAGCAGTCAGG + Intergenic
1174114242 20:48215862-48215884 GAGCTGCCTCAGGAGCTGTGAGG - Intergenic
1174752609 20:53126638-53126660 GGTATCATTCAGGAGCTGGCAGG + Intronic
1175297714 20:57920653-57920675 GTGCTGGGTCAGGAGCTGTCTGG + Intergenic
1175448581 20:59043240-59043262 GGGCTGACCCAGGAGGTGGCTGG - Intergenic
1175715291 20:61251581-61251603 GTGCCCAGACAGGAGCTGTCAGG - Intergenic
1176043588 20:63081070-63081092 GGGCTCCCTCTGGAGCTGCTTGG - Intergenic
1179545054 21:42108106-42108128 GAGCTCGCTTGGGAGCTGTCTGG + Intronic
1179982206 21:44901422-44901444 GGGCTCTGTCAGGCGCTGTGTGG - Intronic
1180002520 21:45001777-45001799 GGGCTGACTCAGTAGCTGCACGG - Intergenic
1180101629 21:45590436-45590458 GGCCTCACTCTGGAGCCGGCGGG + Intergenic
1180588552 22:16915538-16915560 GGGCTCACTCATCAGGTGCCAGG - Intergenic
1183290440 22:36998849-36998871 GTGAGCACTCAGTAGCTGTCAGG - Intronic
1184218821 22:43085884-43085906 GGGCTGGCTCAGGAGCGGGCTGG + Intronic
950151559 3:10691489-10691511 GGCCCCACAGAGGAGCTGTCTGG - Intronic
950628341 3:14264944-14264966 GGGCTTCCTCAGGGCCTGTCTGG - Intergenic
950676907 3:14559689-14559711 GGTCCCACTGAGGAGCTGCCTGG + Intergenic
951094642 3:18614525-18614547 AAGCTCACTCAGGGCCTGTCAGG + Intergenic
952574459 3:34758660-34758682 GGGCCCAACCAGGAGCTGTATGG + Intergenic
953055677 3:39385447-39385469 GTGCTCACACAGGTGCTGTGTGG - Intronic
954314672 3:49794729-49794751 GGGCTCTCTCAGGCCCTGGCTGG - Intronic
955703479 3:61705004-61705026 GGGTTCTCCCAGGAGCTGCCTGG - Intronic
960511337 3:118552995-118553017 GGGCTTATTCAGGAGCTGCCAGG + Intergenic
961509580 3:127392685-127392707 GGGCTCTCTCAGGATCTCCCTGG + Intergenic
962414851 3:135172919-135172941 TGGATCACTGAGGAGCTGTTGGG - Intronic
963103352 3:141625392-141625414 GGGCGCACTCCTGGGCTGTCTGG - Intergenic
964500980 3:157347950-157347972 GGGCGCACTCCAGAGATGTCTGG - Intronic
966252278 3:177879449-177879471 GGTTGCACACAGGAGCTGTCAGG - Intergenic
968443603 4:636814-636836 GGGCTGCCTCAGGGGCAGTCTGG + Intronic
968524616 4:1049652-1049674 GGGCACACTGAGGAGCAGACAGG - Intergenic
969577282 4:8043820-8043842 GGGCTCACTGAGGCGCTGCCTGG - Intronic
970057233 4:11988761-11988783 GGGCTCCCTCAGGATCTGTGTGG - Intergenic
972403386 4:38725358-38725380 GTGCGCACACAGAAGCTGTCAGG + Intergenic
972931030 4:44071927-44071949 GGGCTCACTGAGCAGATGTTGGG - Intergenic
973637949 4:52877273-52877295 GGGCTCAGCCAGAGGCTGTCTGG + Intronic
974165502 4:58196026-58196048 GTGCTCCCTCAGGAGATGACAGG - Intergenic
976396408 4:84560456-84560478 AGGCTCACTCAGGAGGTGGGAGG + Intergenic
980108218 4:128608522-128608544 GGGCTCATCCAGGAGCAGTGGGG + Intergenic
982485312 4:155959033-155959055 GGGCTGACTCTGCAGGTGTCTGG - Intergenic
993489667 5:88531713-88531735 GGGCACACTCTGCAGATGTCTGG + Intergenic
999308247 5:150534755-150534777 GAGCCCACCCAGGAGCTGCCTGG - Intronic
1000102058 5:158025722-158025744 GGTCCCGCTCAGGATCTGTCAGG + Intergenic
1000455717 5:161446248-161446270 GTGCTCACTCAGGACTTGACTGG + Intronic
1002847722 6:962645-962667 CGGCTCACGAAGGAGCTGTGGGG - Intergenic
1003871780 6:10410022-10410044 GGGCTGCCTCACCAGCTGTCGGG - Exonic
1006522607 6:34580495-34580517 GGGCACACTCAGGAGCTGCTGGG + Intergenic
1008401087 6:51063987-51064009 GGGTTATCTCAGGAGCTGTGGGG - Intergenic
1013211681 6:107992366-107992388 GGGCTCAGTTATGAGCTGTTTGG + Intergenic
1014583693 6:123170809-123170831 TTGCTCACTAAGGAGCTTTCTGG - Intergenic
1017648658 6:156562108-156562130 GGGCGCACTCAGGAGCGGGAGGG + Intergenic
1017878605 6:158544264-158544286 GGCCTAGCTCAGGAGCTGTTGGG + Intronic
1018663728 6:166114075-166114097 TGGCTCCCTCAGCAGCTCTCGGG - Intergenic
1021845376 7:24757699-24757721 GGACTCACCCGGGAGATGTCGGG + Exonic
1023020067 7:36003951-36003973 GGGCTCAGTCAAGAGGTGACTGG + Intergenic
1023875807 7:44285763-44285785 GGGCTGCCTCAGGAGATGTGGGG + Intronic
1027648620 7:80836824-80836846 GGGCACAATCTGGGGCTGTCTGG - Intronic
1032601706 7:133303915-133303937 GTGAGCACTCAGGAGCTGCCAGG + Intronic
1034226846 7:149490995-149491017 GGGAACACTCAGGACCTGGCGGG + Intronic
1034241988 7:149617753-149617775 GGGAACACTCAGGACCTGGCGGG + Intergenic
1034350511 7:150411972-150411994 GGGCTCACACCGGACCTGTTCGG - Intronic
1036295177 8:7529103-7529125 GGACTCACCCAGGGGCTGGCGGG + Intergenic
1037435732 8:18861323-18861345 GGGCTCACACAGGAGCACTTGGG - Intronic
1037822630 8:22142267-22142289 AGGCTCAGTCAGGAGCTGGAAGG + Intergenic
1037916210 8:22774971-22774993 GGTGTCACCCAGGAGCTGGCAGG - Intronic
1039558535 8:38494876-38494898 GGGCAGACTGGGGAGCTGTCGGG + Intergenic
1044986579 8:97761360-97761382 GGGCTGCCTCAGGAGCTGCAGGG + Intergenic
1049443422 8:142619418-142619440 GGGCTCTCACAGAGGCTGTCGGG - Intergenic
1049808782 8:144553884-144553906 GGGCTCCCTCTGGACCTGGCGGG - Intronic
1049879819 8:145054010-145054032 GGGCTGAATAAGCAGCTGTCGGG - Exonic
1056080312 9:83086360-83086382 GGGCTCAAGCAGAAACTGTCTGG + Intergenic
1057171139 9:92963920-92963942 GGGCTCACTCTGGGCTTGTCTGG + Intronic
1057705323 9:97391537-97391559 GTGCTCACTGAGGAGCAGCCAGG - Intergenic
1060942343 9:127550135-127550157 AGGGTCACTCAGCAGCAGTCAGG - Intronic
1062308155 9:135921239-135921261 GGGCAAACCCAGGAGGTGTCTGG - Intergenic
1062398089 9:136360583-136360605 GGCCTCAGGCAGGAGCTGGCGGG + Intronic
1062478871 9:136742431-136742453 CGGCTCACTCAGCAGGTGCCCGG + Intronic
1202800905 9_KI270719v1_random:174780-174802 GGGCACGCTCAGGAGTTGCCTGG - Intergenic
1203437102 Un_GL000195v1:148625-148647 GGGATCAATCAGGAGCTGAAGGG - Intergenic
1186446050 X:9629895-9629917 GGGCTCAGTGGGGAGCTTTCTGG + Intronic
1187704676 X:21998005-21998027 GGACTCATTCAGCAGCTGCCTGG + Intergenic
1194819504 X:98488589-98488611 TGGATCACTCATCAGCTGTCTGG + Intergenic
1201240247 Y:11951983-11952005 GCACTCTCTCAGGGGCTGTCAGG - Intergenic
1201413886 Y:13728467-13728489 TGGCTCACTCAGCTGCTGTGAGG - Intergenic
1201416973 Y:13756808-13756830 GGTCTGACTCAGAAGCTTTCTGG - Intergenic