ID: 902209970

View in Genome Browser
Species Human (GRCh38)
Location 1:14897887-14897909
Sequence GGCTCACTCAGGAGCTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902209961_902209970 18 Left 902209961 1:14897846-14897868 CCAGCAGACCTCACTCAGAACCG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 902209970 1:14897887-14897909 GGCTCACTCAGGAGCTGTCTGGG 0: 1
1: 0
2: 2
3: 15
4: 173
902209959_902209970 20 Left 902209959 1:14897844-14897866 CCCCAGCAGACCTCACTCAGAAC 0: 1
1: 0
2: 3
3: 16
4: 186
Right 902209970 1:14897887-14897909 GGCTCACTCAGGAGCTGTCTGGG 0: 1
1: 0
2: 2
3: 15
4: 173
902209960_902209970 19 Left 902209960 1:14897845-14897867 CCCAGCAGACCTCACTCAGAACC 0: 1
1: 0
2: 3
3: 20
4: 207
Right 902209970 1:14897887-14897909 GGCTCACTCAGGAGCTGTCTGGG 0: 1
1: 0
2: 2
3: 15
4: 173
902209962_902209970 10 Left 902209962 1:14897854-14897876 CCTCACTCAGAACCGCTTGCTGA 0: 1
1: 0
2: 0
3: 9
4: 104
Right 902209970 1:14897887-14897909 GGCTCACTCAGGAGCTGTCTGGG 0: 1
1: 0
2: 2
3: 15
4: 173
902209965_902209970 -2 Left 902209965 1:14897866-14897888 CCGCTTGCTGAAACTAACCGGGG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 902209970 1:14897887-14897909 GGCTCACTCAGGAGCTGTCTGGG 0: 1
1: 0
2: 2
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902209970 Original CRISPR GGCTCACTCAGGAGCTGTCT GGG Intronic
900075179 1:809284-809306 TGGTCACTCAGTAGCCGTCTTGG + Intergenic
900259250 1:1715532-1715554 TGCTCACCCAGCAGCGGTCTCGG + Intronic
900630042 1:3630014-3630036 GGCTGCCTCAGAAGCTGGCTGGG + Exonic
900782415 1:4626708-4626730 TGCTCCCCCAGGAGCTGTCCAGG - Intergenic
900977703 1:6027364-6027386 TGCTCACTCAGTAGCTGGCAGGG - Intronic
901740144 1:11336300-11336322 GGCCCACTCTGGTGCTGGCTAGG - Intergenic
901941858 1:12668336-12668358 GGCTTAGTCAGGGGCTGTGTTGG + Intergenic
902209970 1:14897887-14897909 GGCTCACTCAGGAGCTGTCTGGG + Intronic
902253652 1:15172880-15172902 TGGTCACTTAGGAGCGGTCTGGG + Intronic
902527778 1:17070491-17070513 GGGTCACTGAGGTGCTGTGTGGG - Intronic
903930159 1:26857258-26857280 GGTTTCCTCAGGAGCTGTCTGGG + Exonic
904104415 1:28066078-28066100 TACTCACTTAGGAGCCGTCTTGG - Intronic
904905413 1:33894196-33894218 GTCTCACTCCAGAGCTGCCTAGG + Intronic
908413937 1:63894125-63894147 GAGTCACTTAGTAGCTGTCTTGG - Intronic
910033349 1:82759298-82759320 GGCTCACACTGCAGCTGTATGGG - Intergenic
914704905 1:150162547-150162569 GGCTGGCTCAGTAGCTGTGTGGG + Intronic
915971139 1:160356085-160356107 GGCCCACCCAAGAGCTCTCTGGG - Intronic
918051563 1:180977361-180977383 GGCTCCCCCAGGGCCTGTCTGGG - Intronic
918063634 1:181084346-181084368 AGGTCACTCAGGCGCTATCTGGG - Intergenic
920161659 1:204003182-204003204 GGCTCACTCTGCTGTTGTCTTGG - Intergenic
920266981 1:204731280-204731302 GACTCACTCTGGAGCTGCCAGGG - Intergenic
922743661 1:228030981-228031003 TGCACACTCAGGAGCTCTCCTGG - Intronic
923007020 1:230058207-230058229 GGCTCACTCAGGGGCAGCCTGGG + Intronic
924905534 1:248448014-248448036 GAGTCATTCAGTAGCTGTCTAGG + Intergenic
924922358 1:248644022-248644044 GAGTCATTCAGTAGCTGTCTAGG - Intergenic
1062855743 10:778711-778733 GGCTCTCTCAGGAGACGCCTGGG + Intergenic
1064520868 10:16199258-16199280 GGATCATTCAGGAGTTTTCTGGG + Intergenic
1065281209 10:24140512-24140534 CAGTCACTTAGGAGCTGTCTGGG - Intronic
1067364743 10:45615251-45615273 GGCTAACTTAGGAGCTGTGAGGG - Intergenic
1070147629 10:73786131-73786153 GCCTCGCTCGGGAGCTGTCCGGG + Intronic
1070287311 10:75093274-75093296 GGCTGCCTCAGGTGCTCTCTGGG - Intergenic
1071162782 10:82770510-82770532 GTCTCCCTCAGGAGGTGGCTTGG + Intronic
1071527016 10:86364973-86364995 GGCTGACTCCAGAGCTGTCCAGG - Intronic
1077367320 11:2166431-2166453 GGGTCACCCAGGGGCTGGCTTGG - Intronic
1079025675 11:16945990-16946012 GGCTCCCTCATGAGCAGGCTGGG - Intronic
1083182389 11:60995640-60995662 GGCTCACTCCAGCACTGTCTAGG - Intronic
1090321054 11:125844287-125844309 GGCCCACCCAGGAGCTGCATGGG + Intergenic
1090469392 11:126966641-126966663 GGCTCATTCTGGAGGTGGCTGGG + Intronic
1091004150 11:131937382-131937404 AGCTCACACAGGAGTTGTGTGGG + Intronic
1091035458 11:132228809-132228831 GGGTCACTCAGGTGTTGTCATGG + Intronic
1092359858 12:7827504-7827526 AGCTCTCTCAGCAGCTCTCTGGG - Exonic
1092372597 12:7929693-7929715 AGCTCTCTCAGCAGCTCTCTGGG - Exonic
1093914305 12:24783779-24783801 GGATCACTCAGGAGATATTTAGG - Intergenic
1096179584 12:49543264-49543286 GCCTCACTCAGGGGGTGTTTGGG + Exonic
1096971576 12:55670600-55670622 GGGTTAAACAGGAGCTGTCTGGG - Intergenic
1097516878 12:60617638-60617660 GGTCCACCCAGGAGCTGTGTGGG + Intergenic
1100180337 12:92078490-92078512 TTCTCATTCAGGAGCTCTCTTGG + Intronic
1100435361 12:94566111-94566133 GAGTCACTTAGCAGCTGTCTTGG + Intergenic
1101838324 12:108310617-108310639 CGCTCACTCAAGACCTTTCTTGG - Intronic
1102001426 12:109560147-109560169 GGATCTCTAAGGAGCTATCTGGG + Intronic
1102007361 12:109597127-109597149 GGCTCCCCCAGGGGCTGTCCCGG + Exonic
1102185570 12:110945631-110945653 GGCTCACTCACGTGGCGTCTTGG + Intergenic
1102842580 12:116141799-116141821 AGCTCACTCATGAGCTAACTGGG + Intronic
1103657203 12:122481298-122481320 GGCTTGCTCAGGTACTGTCTAGG - Intronic
1104905550 12:132211795-132211817 GGCTGCCTCAGGTGCTGGCTGGG - Intronic
1105639659 13:22249402-22249424 GACTCACTTAGTAGCTGTCTTGG + Intergenic
1106076592 13:26465892-26465914 GGATCACTCAGCAGCTGACATGG + Intergenic
1106251761 13:27987272-27987294 GGCTGCCTCAGGGGCTGTCCTGG - Intronic
1108422136 13:50261810-50261832 AGCTCTTTCTGGAGCTGTCTGGG + Intronic
1112304839 13:98264453-98264475 CAGTCACTCAGGAGCTGCCTTGG + Intronic
1117954404 14:61111442-61111464 GGCTCCCTCTGGAGCAGGCTGGG + Intergenic
1121109147 14:91300598-91300620 GGCTCACCCAGGAGCTGCCAGGG + Intronic
1121245318 14:92457836-92457858 GGCTCACTGAGCACCTGACTTGG + Intronic
1121462758 14:94094625-94094647 GGCTCATTCACGAGTTTTCTGGG - Intronic
1122339348 14:101018319-101018341 GGCTCGCTCAGGTACTCTCTCGG - Intergenic
1123035302 14:105469531-105469553 CGCTCACCCATGAGCTCTCTGGG + Intronic
1125785616 15:42314451-42314473 AGCTAACTCAGGAGCTGTTATGG + Intronic
1128870086 15:71148234-71148256 GGCTCCCTCTGGATCTGCCTTGG - Intronic
1129104502 15:73296743-73296765 GAGTCACTTAGTAGCTGTCTCGG - Intronic
1130853627 15:87821656-87821678 GGCTGAATCTGGATCTGTCTTGG - Intergenic
1134059064 16:11188156-11188178 AGCTCACTCAGGAGCCATCTCGG - Intergenic
1135823683 16:25707077-25707099 GAGTCACTCAGCAGCTGTCTTGG + Intronic
1137456188 16:48619787-48619809 GGCTCACTGAGGGTGTGTCTAGG + Intronic
1137515281 16:49138119-49138141 AGCTCATTCAGGCACTGTCTAGG - Intergenic
1138177007 16:54909571-54909593 GGGGCAATCAGGAGCTGTCCTGG + Intergenic
1138185375 16:54972676-54972698 GGGGCAATCAGGAGCTGTCCTGG - Intergenic
1138418867 16:56886596-56886618 GACTCCCCCAGGAGCTGTGTTGG - Intronic
1142572209 17:882385-882407 GCCTCATTCAGGAGCTGTCTAGG - Intronic
1146008684 17:29178161-29178183 GCCTCACTCCTGGGCTGTCTGGG - Intronic
1150348693 17:64424602-64424624 GGATTACTCATGAGCTTTCTGGG + Intergenic
1151979581 17:77500590-77500612 TTCTCACTCAGGAGCCTTCTGGG - Exonic
1152881446 17:82818360-82818382 GGCTGACTCAGGAGGTGACAGGG + Intronic
1154378372 18:13827550-13827572 GGCTCACACCGGATCTGTGTTGG + Intergenic
1155165408 18:23228231-23228253 GGCTCAGTGAGCAGCTGGCTGGG + Intronic
1156050040 18:32921598-32921620 GAGTCACTTAGCAGCTGTCTTGG - Intergenic
1157201483 18:45663726-45663748 GGCTCTCTCAGGTGCGGACTAGG + Intronic
1157545405 18:48542999-48543021 GTCTCACTCAGGCCCTGCCTGGG + Intronic
1160478733 18:79218683-79218705 TGGTCACTCAGGGCCTGTCTTGG + Intronic
1161271540 19:3392528-3392550 GGCTCCCTCAGGGGCTGTCTCGG - Intronic
1163232862 19:16015872-16015894 GGCTCAGTCAGGAGGGGTCTAGG + Intergenic
1168450277 19:56461246-56461268 GATTAAATCAGGAGCTGTCTGGG - Intronic
925850794 2:8079707-8079729 GGCATACTGAGGAACTGTCTTGG - Intergenic
927865049 2:26582900-26582922 GACTCACTCAGGACCTGGCGAGG + Exonic
928733307 2:34258036-34258058 GGGTAACACAGGAGCTGACTGGG + Intergenic
932055238 2:68436870-68436892 GTCACACCCAGCAGCTGTCTTGG - Intergenic
932214698 2:69959136-69959158 CTCTCCCTCAGGAGCTGTCCAGG + Intergenic
932581352 2:72994578-72994600 GGACCAGTCAGGAGCTGCCTGGG - Intronic
935102141 2:100006987-100007009 GGCTCTCTCAGGACCTTGCTTGG - Exonic
938031393 2:127997494-127997516 GCCTCCCACAGGAGCTGGCTGGG - Intronic
941568155 2:167134845-167134867 GATTCACTTAGAAGCTGTCTTGG - Intronic
943009641 2:182431784-182431806 GGGTCACTCAGGATCTTTCTGGG + Intronic
945104435 2:206296350-206296372 TAGTCACTCAGTAGCTGTCTTGG + Intronic
945714005 2:213336067-213336089 GGCCCACCCAAGAGCTGTGTGGG + Intronic
949082542 2:242115500-242115522 TGGTCACTCAGTAGCCGTCTTGG - Intergenic
1169353131 20:4886123-4886145 GGCCCACCCTGGAGCTGCCTGGG - Intronic
1169363535 20:4972093-4972115 GCCTGACTCAGTGGCTGTCTTGG + Intronic
1170160714 20:13307418-13307440 GGCTCATGAAGGAGCTCTCTGGG + Intergenic
1170368491 20:15622499-15622521 TAGTCATTCAGGAGCTGTCTTGG - Intronic
1176043587 20:63081069-63081091 GGCTCCCTCTGGAGCTGCTTGGG - Intergenic
1177432994 21:21014612-21014634 TGCTCAATCAAGAGCTGTCGTGG + Intronic
1178142612 21:29701164-29701186 GCCTCACACAGTATCTGTCTAGG - Intronic
1179545055 21:42108107-42108129 AGCTCGCTTGGGAGCTGTCTGGG + Intronic
1179768286 21:43591870-43591892 AGGTCACTCAGTAGCTATCTAGG + Intronic
1179982205 21:44901421-44901443 GGCTCTGTCAGGCGCTGTGTGGG - Intronic
1182146538 22:28000342-28000364 GGCCCCCACAGGACCTGTCTTGG - Intronic
1183768815 22:39905419-39905441 GGCTCACACCGAGGCTGTCTTGG - Intronic
1184003729 22:41693959-41693981 GGATCAGGCAGGAGCTCTCTGGG - Exonic
950158431 3:10741324-10741346 TGCCCACTCAGCAGCTGTGTGGG - Intergenic
950628340 3:14264943-14264965 GGCTTCCTCAGGGCCTGTCTGGG - Intergenic
951587089 3:24226617-24226639 GGCTTACCCTAGAGCTGTCTAGG + Intronic
956089741 3:65653238-65653260 GGCTCATTCAAGAGCTGTACAGG - Intronic
956167525 3:66407822-66407844 GCCTGAATCAGGAGCTGCCTTGG - Intronic
959898794 3:111636658-111636680 GACTCACTCAGCAGCTGACAAGG + Intronic
966708953 3:182950544-182950566 GTCTCACTCTGTAGCTCTCTTGG + Intronic
969577281 4:8043819-8043841 GGCTCACTGAGGCGCTGCCTGGG - Intronic
970057232 4:11988760-11988782 GGCTCCCTCAGGATCTGTGTGGG - Intergenic
972389647 4:38602618-38602640 TACTGACTCAGGAACTGTCTTGG + Intergenic
973637950 4:52877274-52877296 GGCTCAGCCAGAGGCTGTCTGGG + Intronic
976389097 4:84491621-84491643 GGCTGACTGAGGAGCTATCTTGG + Intergenic
977784919 4:101021803-101021825 GCATCACTCAGGAGGTGTCTAGG + Intergenic
981258253 4:142688930-142688952 GTCTCACCCAGGAACTGACTCGG + Intronic
985581311 5:696528-696550 GGCCCACACAGGAGCTGGTTAGG - Intergenic
985595940 5:787860-787882 GGCCCACACAGGAGCTGGTTAGG - Intergenic
990940828 5:61201065-61201087 GGCCCACTCAGGAGCTGCACAGG - Intergenic
997026200 5:130064886-130064908 GCCTCTCTGAGGAGCTGCCTAGG + Intronic
997995486 5:138582460-138582482 GGCTCCATCAGGAGCTGTAGCGG + Intergenic
998270695 5:140703739-140703761 GGCTCATCCTGGGGCTGTCTTGG + Intronic
1000381004 5:160629251-160629273 GGCTGCCACAGGAGCTCTCTAGG + Intronic
1004984023 6:21059558-21059580 GGCTCACTTGGGAGCTGCATGGG - Intronic
1005840752 6:29743341-29743363 GCCTCCTCCAGGAGCTGTCTTGG - Intergenic
1005922969 6:30417280-30417302 GCCTCCTCCAGGAGCTGTCTCGG + Intergenic
1006522608 6:34580496-34580518 GGCACACTCAGGAGCTGCTGGGG + Intergenic
1009396925 6:63210969-63210991 TAGTCACTCAGTAGCTGTCTTGG + Intergenic
1012279669 6:97314039-97314061 GGATCACTCACTAGTTGTCTTGG + Intergenic
1012900198 6:104996449-104996471 TTCACAGTCAGGAGCTGTCTTGG - Intronic
1013519362 6:110918344-110918366 GGCACAATCAGGAGCTCTCCTGG - Intergenic
1015237177 6:130985040-130985062 GGTTCACTGGGGATCTGTCTAGG - Intronic
1019370068 7:658037-658059 GGCTCACGGAGCTGCTGTCTCGG - Intronic
1021989616 7:26129245-26129267 GGCTCATTCTGGAGTTTTCTTGG - Intergenic
1023596609 7:41835647-41835669 GTCTCTCTCAGGAACTCTCTTGG + Intergenic
1027648619 7:80836823-80836845 GGCACAATCTGGGGCTGTCTGGG - Intronic
1028019283 7:85750174-85750196 TGCTCAGTTAGGAGCTGCCTGGG - Intergenic
1032456606 7:132077760-132077782 GGCTCTCTGATGAGCTTTCTGGG + Intergenic
1032882363 7:136103191-136103213 GGCCCCCTCAGCAGCTGTTTGGG + Intergenic
1032998969 7:137481729-137481751 GGCTCACTAATAAGGTGTCTTGG + Intronic
1033880369 7:145874383-145874405 TGGTCACTTAGTAGCTGTCTTGG + Intergenic
1035260412 7:157658440-157658462 TGATCCCTCAGAAGCTGTCTTGG - Intronic
1035540465 8:432203-432225 TGGTCACTCAGTAGCCGTCTTGG - Intronic
1036172702 8:6504469-6504491 TGATCACTTAGTAGCTGTCTTGG + Intronic
1038398812 8:27267489-27267511 GGCTCACCAAGGAACTCTCTTGG - Intergenic
1040557993 8:48498098-48498120 CAGTCACTCAGTAGCTGTCTAGG + Intergenic
1044193760 8:89350988-89351010 GGCTCACTCAAGAAGTGTATAGG + Intergenic
1044409346 8:91867372-91867394 GGCTCATTGTGGAGCTGCCTGGG + Intergenic
1046171463 8:110513308-110513330 TTCTCACTCAGAAGCTGTCAAGG + Intergenic
1047728064 8:127701907-127701929 GGCTCGCTAAGGAGCTTTGTAGG + Intergenic
1047929604 8:129713583-129713605 GTCTCTGTCCGGAGCTGTCTGGG - Intergenic
1049790209 8:144468944-144468966 GGGTCACACAGAAGCTGTTTGGG - Intronic
1053484967 9:38445501-38445523 GGCTCACTCAGGTGGCTTCTTGG - Intergenic
1053613886 9:39744029-39744051 GACTCACTCAGGAACCGGCTTGG - Intergenic
1053871921 9:42501986-42502008 GACTCACTCAGGAACCGTCTTGG - Intergenic
1053900829 9:42793991-42794013 GACTCACTCAGGAACTGGCTTGG + Intergenic
1054239630 9:62598368-62598390 GACTCACTCAGGAACCGGCTTGG + Intergenic
1054260821 9:62863555-62863577 GACTCACTCAGGAACCGGCTTGG - Intergenic
1054553763 9:66632895-66632917 GACTCACTCAGGAACCGGCTTGG + Intergenic
1056354422 9:85784308-85784330 GGCTCACTCCGGAGCCCACTTGG - Intergenic
1060091575 9:120747880-120747902 TGCTCACCCAGGTGTTGTCTTGG + Intergenic
1060934248 9:127506433-127506455 CACTCACCCAGGAGCTGGCTGGG - Exonic
1062016375 9:134293280-134293302 GGCTCACACAGGTGCTTTGTGGG - Intergenic
1062308154 9:135921238-135921260 GGCAAACCCAGGAGGTGTCTGGG - Intergenic
1062478872 9:136742432-136742454 GGCTCACTCAGCAGGTGCCCGGG + Intronic
1203746815 Un_GL000218v1:44684-44706 GGCCCCCTCAGGGGCAGTCTGGG + Intergenic
1187097129 X:16161142-16161164 GGCACACTCAAGAGCTCCCTTGG - Intergenic
1187792931 X:22970420-22970442 GTCTCACTCAGCACCTTTCTTGG - Intergenic
1188327235 X:28820774-28820796 AGCTCACTCAGGAGCTGCCACGG + Intronic
1189577160 X:42366351-42366373 TAGTCACTCAGCAGCTGTCTTGG - Intergenic
1192465109 X:71349346-71349368 GACTCACTCAGGGGCCTTCTGGG + Intergenic
1193909273 X:87281359-87281381 GGTTCACCCAGGAGCTGCATAGG - Intergenic
1200700757 Y:6400356-6400378 GGGTCTCTCAGAAGCTCTCTGGG + Intergenic
1201033355 Y:9764342-9764364 GGGTCTCTCAGAAGCTCTCTGGG - Intergenic
1202175565 Y:22095801-22095823 GGGTCTCTCAGAAGCTCTCTGGG + Exonic
1202215796 Y:22490581-22490603 GGGTCTCTCAGAAGCTCTCTGGG - Exonic