ID: 902210062

View in Genome Browser
Species Human (GRCh38)
Location 1:14898588-14898610
Sequence AGATGTTCCCTGTAAGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902210062_902210070 29 Left 902210062 1:14898588-14898610 CCTCCAGCTTACAGGGAACATCT 0: 1
1: 0
2: 0
3: 10
4: 137
Right 902210070 1:14898640-14898662 AGGGACACACACACAGAGTAGGG 0: 1
1: 0
2: 5
3: 85
4: 2446
902210062_902210068 10 Left 902210062 1:14898588-14898610 CCTCCAGCTTACAGGGAACATCT 0: 1
1: 0
2: 0
3: 10
4: 137
Right 902210068 1:14898621-14898643 CTTGTACACACACATACACAGGG 0: 1
1: 0
2: 20
3: 105
4: 733
902210062_902210069 28 Left 902210062 1:14898588-14898610 CCTCCAGCTTACAGGGAACATCT 0: 1
1: 0
2: 0
3: 10
4: 137
Right 902210069 1:14898639-14898661 CAGGGACACACACACAGAGTAGG 0: 2
1: 0
2: 8
3: 113
4: 823
902210062_902210067 9 Left 902210062 1:14898588-14898610 CCTCCAGCTTACAGGGAACATCT 0: 1
1: 0
2: 0
3: 10
4: 137
Right 902210067 1:14898620-14898642 GCTTGTACACACACATACACAGG 0: 1
1: 1
2: 5
3: 62
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902210062 Original CRISPR AGATGTTCCCTGTAAGCTGG AGG (reversed) Intronic
900278486 1:1849358-1849380 AGATCTGCCCTGTGAGATGGAGG - Intronic
900403001 1:2480302-2480324 AGATGTTCAGGGTGAGCTGGGGG + Exonic
900644596 1:3703224-3703246 AGAGGTCCCCTGGAAGCAGGAGG + Intronic
902210062 1:14898588-14898610 AGATGTTCCCTGTAAGCTGGAGG - Intronic
902923755 1:19682563-19682585 TGATGGTGCCTGTCAGCTGGTGG + Exonic
905637721 1:39566141-39566163 AGATGTTTCCTGATACCTGGTGG + Intronic
906895531 1:49766220-49766242 AGATGTCCACTGTTAGCTGAAGG - Intronic
912626376 1:111207871-111207893 AGCTGATCCCTGCAAGATGGGGG - Intronic
913342643 1:117774552-117774574 AGATGTTCTCTGTCAGGTTGGGG - Intergenic
922064531 1:222124277-222124299 GGATGCTCCCTGTCAGGTGGGGG - Intergenic
922312880 1:224412754-224412776 AAATGTGGCCAGTAAGCTGGAGG + Intronic
922950810 1:229557837-229557859 AGATGCTCCCACTAAGTTGGTGG + Intronic
1064106120 10:12502327-12502349 TGATGTACCGTGCAAGCTGGAGG + Intronic
1065174879 10:23066335-23066357 AGACGTTCCCTCTTAGGTGGTGG + Intergenic
1069175295 10:65282762-65282784 AGGTGTTCACTTTAAGCTAGAGG - Intergenic
1069747521 10:70725360-70725382 AGAAATTCCCTGTCAGATGGAGG + Intronic
1076681011 10:132171163-132171185 AGAGGAGCCCTGTGAGCTGGCGG - Intronic
1078503976 11:11915580-11915602 AAATGTTTCCAGTAAACTGGGGG + Intronic
1081531027 11:43959524-43959546 GGATGTTCCCTGTCAGCAGTGGG + Intergenic
1083093084 11:60220731-60220753 AGATGTTCCTTCTAAGGTGAAGG + Intronic
1085235200 11:75009280-75009302 AGCTGTTCCCTGAAACCTGTGGG + Exonic
1085272993 11:75281329-75281351 AGATGTCCCATGTCAGATGGAGG - Intronic
1086478439 11:87205915-87205937 AGATGTTCTCTGTGAACTGAGGG - Intronic
1087687864 11:101285774-101285796 AGAAGTTCCCGTGAAGCTGGAGG - Intergenic
1089370719 11:117954389-117954411 AGGTGTTCCCTGTGTGCTGGAGG + Intergenic
1090209557 11:124908425-124908447 AGATATTCCCTCTAAGATGAAGG - Intergenic
1092100388 12:5878686-5878708 TGATGTTCCCAGTAATCTGTTGG - Intronic
1094821261 12:34227663-34227685 GGGTGTTCCCTGTAGGCTGGGGG - Intergenic
1096073388 12:48788277-48788299 AGATTACCCCTGTGAGCTGGAGG - Intronic
1108427487 13:50318691-50318713 AGCTCTTGCCTCTAAGCTGGTGG - Intronic
1112897656 13:104320468-104320490 AGATGTTCCCAGTAAGCACACGG + Intergenic
1114694725 14:24615751-24615773 AGCTGGTGCCTGTAAGCTCGGGG + Intergenic
1121371318 14:93360863-93360885 AGATATTCCTTGTAAGGTGAAGG + Intronic
1122319618 14:100845889-100845911 GGAAGTGCCCTGTGAGCTGGGGG + Intergenic
1124211456 15:27768189-27768211 AGATGGTCCCTGTAGGGCGGTGG - Intronic
1125799962 15:42436978-42437000 ACATTTACCCTGTAAGCAGGAGG + Intronic
1129523607 15:76200679-76200701 AACTGATCCCTGCAAGCTGGAGG - Intronic
1132877087 16:2144734-2144756 AGATGGGCCCTGGGAGCTGGGGG - Intronic
1134418170 16:14062485-14062507 AGAGGTTCCAGGTAAGCAGGGGG + Intergenic
1136332825 16:29592473-29592495 AATTTTTCCCTGTAAGCGGGAGG + Intergenic
1136575092 16:31118672-31118694 AGAAGTTCCCAGTATGATGGAGG - Intronic
1139737218 16:69001752-69001774 AGACGTTCCCCCGAAGCTGGTGG + Intronic
1141273580 16:82563412-82563434 GTATGTTGCCTGTAAACTGGGGG - Intergenic
1141518386 16:84561582-84561604 AGGTGCTCCCTGCAGGCTGGAGG - Intergenic
1144663499 17:17086860-17086882 GGATGTTCTCTGGAAACTGGAGG + Intronic
1146676110 17:34774848-34774870 AGATGTCCCCTGTGTGCTGCTGG - Intergenic
1149609675 17:57950923-57950945 GAATTTGCCCTGTAAGCTGGGGG - Intronic
1151077032 17:71285889-71285911 ATATGTTTCTTCTAAGCTGGAGG + Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1156905999 18:42352680-42352702 AGATTTTACCTGAAAGGTGGTGG + Intergenic
1158412779 18:57222362-57222384 ACATGGTCCCTGGAACCTGGAGG + Intergenic
1164576668 19:29409182-29409204 AGCTGTGCCCTGTCAGCTGGAGG - Intergenic
1165627412 19:37286056-37286078 ACATGTGCCCTGTACGCCGGAGG - Intergenic
1165630114 19:37298684-37298706 ACATGTGCCCTGTACGCCGGAGG - Intergenic
1166251235 19:41572454-41572476 GGAAGCTCCCTGTAAGCCGGGGG + Intronic
930042564 2:47139029-47139051 GAATGTTCCATGTGAGCTGGAGG + Intronic
930112985 2:47694954-47694976 AGATATTCCCCCGAAGCTGGTGG + Intergenic
933006926 2:77006369-77006391 AGATGTTCCCTGTGCTATGGTGG + Intronic
933891482 2:86775445-86775467 AGATGTACTCTGAAGGCTGGTGG + Exonic
935217745 2:100988195-100988217 AGATCTGCCCTGGAAGTTGGGGG - Exonic
940190236 2:151032939-151032961 AGATGTTTCTGGTCAGCTGGTGG - Intronic
940898022 2:159099700-159099722 AGATGTCACCTGGAAGATGGTGG - Intronic
941150186 2:161905159-161905181 AGATGTTCCCTTTAGACCGGTGG + Intronic
942299940 2:174551676-174551698 ACGTGTTCCCTGTTAGCTGGAGG + Intergenic
943747362 2:191476200-191476222 AGATGTTTCCAGAAAGCTGTGGG + Intergenic
944637119 2:201685106-201685128 AGATGTCCCCTGTCATCTCGTGG + Exonic
945370929 2:209016864-209016886 ACATGTTTGCAGTAAGCTGGAGG + Intergenic
1170085461 20:12526530-12526552 AGATATTACCTGGAAGATGGTGG - Intergenic
1170877157 20:20261266-20261288 AAAAGTTTCCTGTCAGCTGGAGG + Intronic
1171268443 20:23793660-23793682 ATATGTGCCCAGGAAGCTGGTGG + Intergenic
1173435570 20:43029255-43029277 AGCTGTTCCGTGTAATTTGGGGG - Intronic
1173499739 20:43544476-43544498 AGATGTTGTCTGTGTGCTGGTGG - Intronic
1174353036 20:49981880-49981902 AAAAGATCCCTGTAGGCTGGCGG - Intergenic
1176705689 21:10118856-10118878 ACATGTTCCCTGTGCGCCGGAGG - Intergenic
1178756609 21:35356103-35356125 AGATTTTCCCTCTAAGCAAGGGG + Intronic
1179164907 21:38927754-38927776 AGCTGTTCTCAGAAAGCTGGAGG - Intergenic
1184230765 22:43157251-43157273 ACGTGTACCCTGGAAGCTGGAGG + Intronic
1184922629 22:47616326-47616348 CGATGTTCGCAGTAAGCTGATGG + Intergenic
952750105 3:36817956-36817978 AGCTGTTACCTGTCAGCTGCAGG - Intergenic
952828343 3:37542629-37542651 AGATGTTCACTTGGAGCTGGTGG + Intronic
956011423 3:64835541-64835563 AGATGTACCCAGTGTGCTGGGGG - Intergenic
956892167 3:73623996-73624018 GGATGTTCCCGGGAAGCTCGGGG + Intronic
958025239 3:88041498-88041520 AGATATTCCTTCTAAGATGGAGG - Intergenic
959445296 3:106432015-106432037 TTATGTTCCCTGTAACCTTGTGG + Intergenic
961008181 3:123419010-123419032 AGCTGTTGTCTGTAAGCTGGAGG - Intronic
961028397 3:123581228-123581250 AGATCTTCCCTGCAATCTGAAGG + Intronic
963702053 3:148638758-148638780 AGGTGTTCCCTGGTATCTGGGGG - Intergenic
965112786 3:164448849-164448871 AGCTGTACCCTGCAAGCTGCAGG + Intergenic
970809794 4:20078983-20079005 AGATGTTTCCAGTAAAGTGGAGG + Intergenic
972856411 4:43113290-43113312 AGAGCTTACCTGTGAGCTGGGGG + Intergenic
973118377 4:46488647-46488669 AGATATTCCTTGTAAGGTGAAGG + Intergenic
973537221 4:51895446-51895468 AGATGTTCCCTACCAGCTGCCGG - Intronic
973579601 4:52329620-52329642 AGATGTTCTTGGTAAGCCGGTGG - Intergenic
978341649 4:107725944-107725966 AGATGTTCCTTCTAAGGTGAAGG - Intergenic
982736090 4:159008223-159008245 AGATTTTATCTGTAAGGTGGAGG + Intronic
991770312 5:70034795-70034817 AGATGTTTCCTCAAAGCAGGCGG + Intronic
991849607 5:70910214-70910236 AGATGTTTCCTCAAAGCAGGCGG + Intronic
993062394 5:83054536-83054558 AGATATTCCATCTGAGCTGGAGG + Exonic
995168598 5:109078771-109078793 AGATGTTCTATGTAATCTGTTGG - Intronic
1002368500 5:178730839-178730861 AGAGGGCCCCTGTGAGCTGGAGG + Intergenic
1006339814 6:33440636-33440658 GCATGTTCCCTGGAAGCTGAGGG + Intronic
1007384048 6:41508681-41508703 AGGTGATCCCTGGAGGCTGGAGG - Intergenic
1009684961 6:66945149-66945171 AGATCTTCCCTGTTTGCTTGTGG + Intergenic
1009909399 6:69906514-69906536 GGATGATTTCTGTAAGCTGGTGG + Intronic
1010070858 6:71743666-71743688 ACATGTGCCCTTTAATCTGGAGG - Intergenic
1010580813 6:77594304-77594326 AGATGTTCCTTTTAAGGTGAAGG - Intergenic
1010690572 6:78906914-78906936 AGATCTTCTCTGAAAGATGGTGG + Intronic
1010703333 6:79077860-79077882 AGATGGACCCTGTCAGCAGGCGG - Exonic
1011054873 6:83193769-83193791 AGATGTTTACAGTGAGCTGGGGG - Intronic
1012373444 6:98532708-98532730 ATCTGTTCTCTGTAAGCTGGAGG - Intergenic
1012463099 6:99485978-99486000 AGGTGTTCTTTGTAAGCTTGAGG - Intronic
1015764207 6:136698995-136699017 ATAAGTTCCCTGAAAGCTGAAGG - Intronic
1019211488 6:170408849-170408871 AGAGGTTTTCTGTAAGATGGGGG - Intergenic
1019270538 7:144644-144666 AGAGGTTCTGTGTGAGCTGGAGG + Intergenic
1024744142 7:52388043-52388065 AGATATTCCTTCTAAGCTGAAGG + Intergenic
1024958312 7:54949474-54949496 AGATATTCCTTCTAAGCTGAAGG - Intergenic
1027507627 7:79037458-79037480 AGAGGTTCTCTGTATGCTGTGGG + Intronic
1028934947 7:96454668-96454690 AGATGTTCCTTCTAAGATGAAGG + Intergenic
1030926834 7:115467358-115467380 AGATGATCACTGTAATCTGTTGG + Intergenic
1032751931 7:134850205-134850227 AGCTGTTTCCTGTCAGCAGGAGG - Intronic
1035477717 7:159155426-159155448 ACTTGTTCCCTGGAACCTGGTGG + Intergenic
1036492356 8:9239463-9239485 GGATGTTTCGTGGAAGCTGGTGG - Intergenic
1036530567 8:9582521-9582543 TGATGTCTCCTGTAAGCTGGTGG - Intronic
1040890127 8:52308746-52308768 AGTTGTTCCCTGTGGGATGGGGG - Intronic
1042045038 8:64641258-64641280 AGATATTCCTTGGAATCTGGAGG - Intronic
1042356384 8:67833104-67833126 AGATGTTCTCTGTCTGCTGAAGG + Intergenic
1042667929 8:71228117-71228139 AGCAGTTCCCTGTGAGCTGCAGG + Intronic
1043260030 8:78184585-78184607 AGATATTCCTTCTAAGGTGGAGG - Intergenic
1053642970 9:40105985-40106007 ACATGTTCCCTGTGCGCCGGAGG - Intergenic
1053763181 9:41359505-41359527 ACATGTTCCCTGTGCGCCGGAGG + Intergenic
1054323823 9:63703230-63703252 ACATGTTCCCTGTGCGCCGGAGG - Intergenic
1054541790 9:66270672-66270694 ACATGTTCCCTGTGCGCCGGAGG + Intergenic
1058856495 9:109067768-109067790 GGATGTGCCTCGTAAGCTGGTGG - Intronic
1058918500 9:109590689-109590711 AGATGTGCCCTGGAGGCTAGTGG - Intergenic
1060891657 9:127193084-127193106 AGAGCTTGCCTGTAGGCTGGGGG + Intronic
1061549278 9:131323976-131323998 AGAAGGTCCCTGGAAGCAGGTGG + Intergenic
1202790723 9_KI270719v1_random:88965-88987 ACATGTTCCCTGTGCGCCGGAGG - Intergenic
1186361497 X:8846688-8846710 AGGTGTTCCCTATACACTGGTGG - Intergenic
1189186911 X:39062632-39062654 AGATGTACCTTGCAAGCTAGTGG + Intergenic
1189601533 X:42631639-42631661 AGAGATTACCTGTAAACTGGGGG - Intergenic
1189857498 X:45237994-45238016 GTATGTTCCCTGGAACCTGGGGG - Intergenic
1190471143 X:50780914-50780936 ATATGCCCTCTGTAAGCTGGGGG + Intronic
1194357654 X:92905972-92905994 AGATCTTCTCAGTAAGCTTGCGG - Intergenic
1196793005 X:119481278-119481300 AGATCTTCCCTGTAAGCCCAGGG - Intergenic
1200665827 Y:6021582-6021604 AGATCTTCTCAGTAAGCTTGCGG - Intergenic
1201767557 Y:17586786-17586808 GGATGGTCCCTGTAGGCTGGGGG - Intergenic
1201833996 Y:18319199-18319221 GGATGGTCCCTGTAGGCTGGGGG + Intergenic
1201959532 Y:19663689-19663711 AGATGTTACCTTGAAGCTGGAGG - Intergenic