ID: 902213061

View in Genome Browser
Species Human (GRCh38)
Location 1:14917406-14917428
Sequence TCATCTCCGTCCACTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902213061_902213069 26 Left 902213061 1:14917406-14917428 CCCCCAGGAGTGGACGGAGATGA 0: 1
1: 0
2: 1
3: 5
4: 121
Right 902213069 1:14917455-14917477 GTGTCCCGCTCAGAAGCCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 47
902213061_902213065 -1 Left 902213061 1:14917406-14917428 CCCCCAGGAGTGGACGGAGATGA 0: 1
1: 0
2: 1
3: 5
4: 121
Right 902213065 1:14917428-14917450 ACAGTCTCCATAGAGATAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 106
902213061_902213071 30 Left 902213061 1:14917406-14917428 CCCCCAGGAGTGGACGGAGATGA 0: 1
1: 0
2: 1
3: 5
4: 121
Right 902213071 1:14917459-14917481 CCCGCTCAGAAGCCGTGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 113
902213061_902213066 0 Left 902213061 1:14917406-14917428 CCCCCAGGAGTGGACGGAGATGA 0: 1
1: 0
2: 1
3: 5
4: 121
Right 902213066 1:14917429-14917451 CAGTCTCCATAGAGATAGCAGGG 0: 1
1: 0
2: 1
3: 11
4: 132
902213061_902213068 25 Left 902213061 1:14917406-14917428 CCCCCAGGAGTGGACGGAGATGA 0: 1
1: 0
2: 1
3: 5
4: 121
Right 902213068 1:14917454-14917476 TGTGTCCCGCTCAGAAGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902213061 Original CRISPR TCATCTCCGTCCACTCCTGG GGG (reversed) Intronic