ID: 902214043

View in Genome Browser
Species Human (GRCh38)
Location 1:14923761-14923783
Sequence TCCCCACAGCTGACCGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902214043_902214051 6 Left 902214043 1:14923761-14923783 CCTCTCCCGGTCAGCTGTGGGGA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 902214051 1:14923790-14923812 CTCTCGGCAAGGCTGTCACAGGG 0: 1
1: 0
2: 0
3: 8
4: 186
902214043_902214048 -5 Left 902214043 1:14923761-14923783 CCTCTCCCGGTCAGCTGTGGGGA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 902214048 1:14923779-14923801 GGGGACCTCGGCTCTCGGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 106
902214043_902214052 13 Left 902214043 1:14923761-14923783 CCTCTCCCGGTCAGCTGTGGGGA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 902214052 1:14923797-14923819 CAAGGCTGTCACAGGGTGTCAGG 0: 1
1: 0
2: 0
3: 13
4: 204
902214043_902214053 18 Left 902214043 1:14923761-14923783 CCTCTCCCGGTCAGCTGTGGGGA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 902214053 1:14923802-14923824 CTGTCACAGGGTGTCAGGAGAGG 0: 1
1: 0
2: 2
3: 32
4: 383
902214043_902214050 5 Left 902214043 1:14923761-14923783 CCTCTCCCGGTCAGCTGTGGGGA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 902214050 1:14923789-14923811 GCTCTCGGCAAGGCTGTCACAGG 0: 1
1: 0
2: 3
3: 20
4: 194
902214043_902214047 -10 Left 902214043 1:14923761-14923783 CCTCTCCCGGTCAGCTGTGGGGA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 902214047 1:14923774-14923796 GCTGTGGGGACCTCGGCTCTCGG 0: 1
1: 0
2: 1
3: 24
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902214043 Original CRISPR TCCCCACAGCTGACCGGGAG AGG (reversed) Intronic
900284998 1:1894781-1894803 GACCCAGAGCTGACCGGGTGTGG - Intergenic
901634407 1:10663894-10663916 TGCCCGCAGCTGACGGGGAGCGG - Intronic
902214043 1:14923761-14923783 TCCCCACAGCTGACCGGGAGAGG - Intronic
902305277 1:15533205-15533227 TCTCCAAAGCTGGCCGGGTGTGG + Intronic
903354307 1:22736860-22736882 TCCCCAGGTCTGACAGGGAGGGG - Intronic
904696677 1:32335375-32335397 TCCGCACAGCAGATCCGGAGCGG - Intronic
905090859 1:35430236-35430258 TCCCCAAAGATGGCCGGGCGCGG - Intergenic
905365542 1:37449201-37449223 TGCACACAGCTGCCAGGGAGTGG + Intergenic
906608505 1:47187057-47187079 TCCCCAAAACTCACAGGGAGTGG + Intronic
908772146 1:67607087-67607109 TCCTCACAGTTGACCGTCAGAGG + Intergenic
910100020 1:83565687-83565709 TCCCCACAGAGAACCAGGAGAGG - Intergenic
910567917 1:88666476-88666498 TTCCCAGACCTGACCGGGCGCGG + Intergenic
914374642 1:147062160-147062182 ACGCCACAGCTGGCCGGGCGGGG - Intergenic
915087190 1:153396825-153396847 TCCCCACTGCCCACTGGGAGGGG + Intergenic
919968857 1:202557863-202557885 ACCCTACAGCTGTCCAGGAGAGG - Intronic
920173218 1:204084312-204084334 CCCCCACAGCTGCCTGGGAGAGG - Intronic
920311727 1:205052647-205052669 TCCCCTCAGCTGTCTGGGTGGGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1062820201 10:529017-529039 TCCTCACAGGTCACTGGGAGGGG - Intronic
1062940995 10:1421311-1421333 TCCTCACAGCTGAGCGTGGGTGG - Intronic
1063683226 10:8210622-8210644 AACCCACTGCTGACCGGGTGTGG - Intergenic
1063830106 10:9942746-9942768 TCCCCAAAGCAGACCCTGAGAGG + Intergenic
1067822077 10:49539235-49539257 GCCACCCAGCTGACCGGCAGCGG - Intronic
1069902669 10:71715040-71715062 ACCCCACAGCTGTCCTGGAGAGG + Exonic
1069979390 10:72241791-72241813 TCCCAACAGCAGGCAGGGAGTGG - Intergenic
1070982477 10:80660502-80660524 TCCCCAAAGCCGACCTTGAGAGG - Intergenic
1072687989 10:97550084-97550106 TCCCAACAGCTGGCCGGCAAGGG - Intronic
1075336070 10:121609612-121609634 TCACCACAGCTGCCCTGGAGAGG + Intergenic
1076664278 10:132077221-132077243 TCTCCCCAGGTCACCGGGAGAGG - Intergenic
1077205731 11:1343082-1343104 GCCCCACAGTTGGCCGGGCGTGG + Intergenic
1077870603 11:6259117-6259139 CCTCCACAGCTGGGCGGGAGTGG - Intergenic
1078103996 11:8346981-8347003 TTCCCACAGATGACTGGGAAGGG + Intergenic
1083033573 11:59615776-59615798 TCCCCGCGGCTGGCCGGGCGGGG - Exonic
1083237519 11:61361256-61361278 TCCTCAGAGCTGAGAGGGAGTGG - Intronic
1083402129 11:62430824-62430846 TCTCATCAGCTGACCGTGAGAGG - Intergenic
1084362593 11:68678404-68678426 TTCCCACAGCAGACGGCGAGCGG + Intergenic
1084447615 11:69212890-69212912 TCCCAACAGCAGACATGGAGTGG - Intergenic
1084756002 11:71239084-71239106 TGTCAACAGATGACCGGGAGGGG + Intronic
1086739536 11:90350816-90350838 TCCCCACAGCTGGGCGGCAAGGG - Intergenic
1088888957 11:114029891-114029913 ACTCCACAGGTGACCAGGAGAGG - Intergenic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1091941952 12:4493800-4493822 TGTCTACAGCTGGCCGGGAGTGG + Intronic
1092089710 12:5794393-5794415 TCCTCACTGTTGACTGGGAGTGG - Intronic
1092233270 12:6789688-6789710 TCCCCGGAGCTGAGAGGGAGGGG + Intronic
1097190355 12:57216675-57216697 TGCCCCCAGCTGGGCGGGAGGGG + Intergenic
1097245638 12:57606186-57606208 TCCACTCAGCTGACCAGGACTGG - Exonic
1101180973 12:102217785-102217807 TCCCCACACCTGGCCGGGCACGG + Intergenic
1101782148 12:107845844-107845866 GCCCCAGAGCTGACCGCGGGAGG + Intergenic
1102329101 12:112013882-112013904 TCCCCACAGGTGAAGGGAAGGGG - Intronic
1103201344 12:119090543-119090565 TCCCCACATCCCACCAGGAGTGG + Intronic
1103326713 12:120126280-120126302 TCCCCATAGCTGACTGGTGGTGG + Intergenic
1103931642 12:124453803-124453825 TCCCCACAGCTGGGCTGGAGGGG + Intronic
1107057105 13:36118268-36118290 TCATCACAGCCGACCAGGAGAGG + Intronic
1109689372 13:65865868-65865890 TCCTCACAGGTGACTGGCAGTGG - Intergenic
1113743350 13:112725881-112725903 TCACCTCAGCTGCCGGGGAGGGG - Intronic
1113952201 13:114078189-114078211 GCCCCACAGCTGAGCGGGACGGG + Intronic
1114126243 14:19729801-19729823 TCCCCAAAGCCCACTGGGAGAGG - Intronic
1121427120 14:93860281-93860303 TCCTCACAGCTGCCCTGGAAGGG + Intergenic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1121804568 14:96805519-96805541 TCCCCACAGATAAACGGCAGGGG - Intronic
1122440207 14:101726650-101726672 TCTCCACAGCAGACAGGGGGAGG - Intergenic
1122827422 14:104377012-104377034 TCCCCACAGCAGCCCAGGAGAGG - Intergenic
1125448949 15:39787818-39787840 ACTCCACAGCAGACAGGGAGAGG - Intergenic
1126302165 15:47209704-47209726 TCAACACAGCAGACCTGGAGAGG - Intronic
1127880950 15:63157816-63157838 CCCCCAGAGCTAACCGAGAGCGG - Intronic
1128065540 15:64762302-64762324 TCCCCACAGCTGAGTGTGAGTGG + Intronic
1128359801 15:66954029-66954051 TCCCCACAGCAGAAGGGCAGTGG + Intergenic
1128737631 15:70062200-70062222 TCCCCACAGCCGTGCAGGAGCGG + Intronic
1129358948 15:75012514-75012536 TCATCACAGCTGACCCGGGGAGG + Intronic
1129856876 15:78831016-78831038 TCCCTTCAGCTGGCCGGAAGAGG + Intronic
1131853692 15:96569585-96569607 TCCCCACAGCCCTCCGTGAGGGG + Intergenic
1132643615 16:988953-988975 TCCCAGCAGCTGCCTGGGAGGGG + Intergenic
1132725336 16:1335951-1335973 TCCCCAGAGCGGCCCGAGAGGGG - Intronic
1133427361 16:5704394-5704416 TCGCCACAACTCACAGGGAGTGG + Intergenic
1134071178 16:11260780-11260802 GCCACACAGCTGATGGGGAGGGG - Intronic
1134273397 16:12754621-12754643 TCTCCACAGCTGACAGGCAGAGG + Intronic
1136552172 16:30987634-30987656 TCCCCACAGCAGCCTGGGAAAGG - Intronic
1139958134 16:70702966-70702988 GACCCACAGCTGACCGGAGGAGG + Intronic
1143447880 17:7019575-7019597 TCCCCAATTCTGACTGGGAGTGG - Intergenic
1145001037 17:19304758-19304780 TCCCCACCGCTGACAAGCAGTGG - Intronic
1147325693 17:39668386-39668408 CCCCCACAGCGGACCGGTCGGGG + Exonic
1147649132 17:42051978-42052000 CCCCCACAGCTGCCCCCGAGTGG + Intronic
1153271828 18:3330025-3330047 TCCCTACTGCAGACCTGGAGTGG + Intergenic
1156654736 18:39271847-39271869 TCCCCAGAGGAGACCTGGAGCGG - Intergenic
1158345801 18:56515733-56515755 TCCCCTCAGCTGACTGAGAGAGG + Intergenic
1160729133 19:632801-632823 CCCCCACGGCGGCCCGGGAGAGG - Intronic
1160808714 19:1003655-1003677 TCCCCGCAGTTGACCGGGGCGGG - Exonic
1161022491 19:2016582-2016604 CCCCCACACCTGGCCTGGAGAGG - Intronic
1161591311 19:5130413-5130435 TCCTGACAGGTGACAGGGAGGGG - Intronic
1164039702 19:21483733-21483755 TCCCCGCTGCTGAGTGGGAGAGG - Intronic
1165350636 19:35273258-35273280 TCACCACGGGTGACCGGAAGTGG - Intronic
1165771473 19:38383034-38383056 TCCTCACAGTTGACCCAGAGAGG + Intronic
1165791593 19:38496051-38496073 TTCCTACAGCTGGCCGGGTGCGG - Intronic
1166945184 19:46391872-46391894 TCCACACAGCTCCACGGGAGAGG - Intronic
925800940 2:7599725-7599747 TGCCCAGAGCGCACCGGGAGCGG + Intergenic
927632083 2:24783456-24783478 TCCCCTCAGTTGGCCGGGTGCGG + Intergenic
929820273 2:45267680-45267702 TACACACAGCTGACAGAGAGTGG - Intergenic
930051622 2:47220333-47220355 TCCCCACAGCAGTGCTGGAGGGG + Intergenic
932611316 2:73202491-73202513 TCCCCACTGCGGTCCGGGCGGGG - Exonic
933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG + Intronic
934646783 2:96063551-96063573 TCTGCACAGCTGGCCGGCAGCGG - Intergenic
935188609 2:100757334-100757356 TCCCCAAAGCCCACCAGGAGTGG + Intergenic
936574525 2:113642117-113642139 TCCCCACAGCTGAGGGGCTGGGG + Exonic
937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG + Intergenic
939679643 2:145114699-145114721 TCACCACAGCTTACAAGGAGAGG + Intergenic
940241284 2:151565794-151565816 TCTACAGAGCTGACCTGGAGTGG - Exonic
944316011 2:198286493-198286515 TCCCCACTGCTGTCCGGCAAGGG - Intronic
945225377 2:207528266-207528288 TCCCCACCGCTCACCTGAAGTGG - Intergenic
947723319 2:232381929-232381951 TCCCCAGAGCGCACGGGGAGGGG - Exonic
948125972 2:235564925-235564947 GACCCACAGCTGGCCGTGAGTGG - Intronic
948443343 2:238012351-238012373 TCCCTGCAGCTGACAGGGATTGG - Intronic
1175385066 20:58589551-58589573 GGCCCACAGCTGACCCAGAGAGG - Intergenic
1176163626 20:63661515-63661537 TCCCCACAGGAGGCCAGGAGAGG - Intronic
1182558942 22:31143864-31143886 CCCCCACTGCAGACCAGGAGAGG + Intergenic
1183897359 22:40980043-40980065 TCCCCACAGCGGGCCTGGTGGGG - Intergenic
1183897772 22:40983008-40983030 TCCCCACAGCGGGCCTGGCGGGG - Intergenic
1184250708 22:43258535-43258557 TCCCTAGAGCTGAACGGGGGTGG + Intronic
1184489474 22:44800700-44800722 TCCCCGCAGCTGTCCGTGTGAGG + Intronic
1184489483 22:44800732-44800754 TCCCCGCAGCTGTCCGTGTGTGG + Intronic
1184489493 22:44800765-44800787 TCCCCGCAGCTGTCCGTGTGTGG + Intronic
1184489503 22:44800798-44800820 TCCCCGCAGCTGTCCGTGTGTGG + Intronic
1184489513 22:44800831-44800853 TCCCCGCAGCTGTCCGTGTGTGG + Intronic
1184489523 22:44800864-44800886 TCCCCGCAGCTGTCCGTGTGTGG + Intronic
1184489533 22:44800897-44800919 TCCCCGCAGCTGTCCGTGTGTGG + Intronic
1184489543 22:44800930-44800952 TCCCCGCAGCTGTCCGTGTGTGG + Intronic
1184489553 22:44800963-44800985 TCCCCGCAGCTGTCCGTGTGTGG + Intronic
1184489563 22:44800996-44801018 TCCCCGCAGCTGTCCGTGTGTGG + Intronic
1184489679 22:44801412-44801434 TCCCCACAGCTGTCCATGTGTGG + Intronic
1184489688 22:44801444-44801466 TCCCCGCAGCTGTCCGTGTGTGG + Intronic
1185425645 22:50768766-50768788 TCCCCACAGCTGAGGGGCTGGGG - Exonic
949326897 3:2876162-2876184 TCCCCACTGCTGAACAGGAGAGG - Intronic
950237241 3:11334037-11334059 TTCCCGAAGCTGGCCGGGAGCGG - Intronic
952160873 3:30691714-30691736 TCCCCACAGCTTACAGGGAGGGG - Exonic
952937585 3:38412343-38412365 TTCACACAGCTGTCCAGGAGAGG - Intronic
954438827 3:50510561-50510583 TCCCCACAGCTGCCTAGCAGAGG - Intergenic
963766366 3:149340218-149340240 GCCCCACAGGTGACGGGAAGTGG + Intergenic
964892377 3:161552474-161552496 TCCCAACAGAAGCCCGGGAGAGG + Intergenic
966101038 3:176269344-176269366 TCCCCACACCTGACCCAGAAAGG - Intergenic
967097449 3:186188587-186188609 TCCCCGGAGCTGACCAGGACTGG - Intronic
967136846 3:186519749-186519771 CCACCGCAGCTGACTGGGAGTGG - Intergenic
981649040 4:147035300-147035322 ACCTCACAACTGACGGGGAGTGG - Intergenic
984923096 4:184783054-184783076 TCCACACAGCTGTCCAGGAAAGG - Intronic
986925330 5:12741738-12741760 TCGACACAGCAGACCGGGCGTGG + Intergenic
991216996 5:64166318-64166340 TCCCCACCTCAGACCTGGAGAGG - Intronic
996884698 5:128341472-128341494 TACCAATAGCTGACGGGGAGGGG - Intronic
999475868 5:151898527-151898549 TCCCCTCTGCTGACCCAGAGTGG - Intronic
1002301133 5:178257713-178257735 ACCCCACACCTGCCCTGGAGGGG - Intronic
1005530260 6:26697616-26697638 TCCCAGAATCTGACCGGGAGTGG + Intergenic
1005540536 6:26804030-26804052 TCCCAGAATCTGACCGGGAGTGG - Intergenic
1006642072 6:35494722-35494744 CCCCCACAGGTGTCTGGGAGTGG + Intronic
1009011351 6:57846127-57846149 TCCCAGAATCTGACCGGGAGTGG - Intergenic
1011195718 6:84777292-84777314 TCCCCACTGGTGACTAGGAGTGG - Intergenic
1013202294 6:107910999-107911021 TACCCACAACTGACCGGGCATGG - Intronic
1016288390 6:142500342-142500364 TCCCATCACCTGGCCGGGAGAGG + Intergenic
1017064821 6:150519059-150519081 TCCCCAGAGCCCACCGGAAGTGG + Intergenic
1020071833 7:5232318-5232340 TCCCCTCAGCTGAGCGGCTGCGG + Exonic
1022703678 7:32784030-32784052 TCCCCTTAGCTGACTGGGTGAGG - Intergenic
1022907919 7:34874159-34874181 TCCCCTTAGCTGACTGGGTGAGG - Intronic
1023116127 7:36864428-36864450 TCACCAAAGCTGCCTGGGAGGGG + Intronic
1024702569 7:51920619-51920641 TACCCACAGCTGATGGGGACTGG - Intergenic
1026968474 7:74454385-74454407 GCCCCCCACCTGCCCGGGAGGGG + Intronic
1030084453 7:105804739-105804761 TCCTCACAGCAGACCTGCAGGGG + Intronic
1034193303 7:149227032-149227054 TCCCCAGAGCTGATCGGGGATGG + Intergenic
1035031285 7:155862760-155862782 TCCCCACGGCTTACCAGGACTGG - Intergenic
1039435049 8:37554221-37554243 TTCCCACATCTGAACGGGTGGGG + Intergenic
1039615114 8:38949358-38949380 TCTCCCCAGCAGAACGGGAGAGG - Intronic
1039762314 8:40590997-40591019 TCACCCCAGCTGATAGGGAGAGG + Intronic
1040107772 8:43550016-43550038 TCCCCCCGCCTGACCGGGACAGG - Intergenic
1040315365 8:46258066-46258088 TCCCCAGAGCTGTCCCGGATGGG + Intergenic
1041389815 8:57338408-57338430 CCCCCACAGCTGGCCATGAGGGG - Intergenic
1046724072 8:117655533-117655555 TCCCCACAGATCACAGGGAATGG - Intergenic
1048142226 8:131805447-131805469 TGCCCCCAGCTGACAGGGTGAGG + Intergenic
1049368618 8:142252949-142252971 TCCCCACACCTGGGCCGGAGTGG - Intronic
1049593350 8:143472495-143472517 TCCCCACTGCTGAGCGGGCCAGG + Intronic
1053014628 9:34654814-34654836 TCCCAACAGCTGGACTGGAGGGG + Intronic
1055933342 9:81581986-81582008 TCCCCACTGCTGGCTGGAAGTGG + Intergenic
1057786695 9:98093404-98093426 TCCTCACAGCAGCCCAGGAGAGG + Intronic
1057794398 9:98145176-98145198 TCCCCACAGGTGACCAAGTGGGG - Intronic
1059548107 9:115199368-115199390 GCCACACTGCTAACCGGGAGTGG + Intronic
1061144357 9:128788475-128788497 GCCCCAGAGCTGACCAGGTGTGG - Intronic
1185999898 X:4997497-4997519 TCCCCAGATCTCACCAGGAGGGG - Intergenic
1186843918 X:13512258-13512280 TTCCCACAGCAGACTGTGAGGGG + Intergenic
1189117581 X:38358910-38358932 GCACCACAGCTGGCCGGGTGCGG - Intronic
1190234231 X:48603721-48603743 TCCCCACAGGTAACCTGGGGGGG - Intronic
1197651202 X:129066527-129066549 TCGCCATAGCTGACGGAGAGAGG + Intergenic
1197971612 X:132120578-132120600 TCCCCACAGCTGAAAGGAGGAGG - Intronic
1201676288 Y:16588486-16588508 TCCCCAGATCTCACCAGGAGGGG + Intergenic
1202304663 Y:23455819-23455841 ACCCTACAGCTGTCCAGGAGAGG - Intergenic
1202566147 Y:26214772-26214794 ACCCTACAGCTGTCCAGGAGAGG + Intergenic