ID: 902214348

View in Genome Browser
Species Human (GRCh38)
Location 1:14924774-14924796
Sequence GGGGCTCGGGGGCTGCACCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 344}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902214340_902214348 -7 Left 902214340 1:14924758-14924780 CCTCGGCGTGGGGACCGGGGCTC 0: 1
1: 1
2: 0
3: 20
4: 189
Right 902214348 1:14924774-14924796 GGGGCTCGGGGGCTGCACCGGGG 0: 1
1: 0
2: 3
3: 31
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902214348 Original CRISPR GGGGCTCGGGGGCTGCACCG GGG Intronic
900087198 1:904303-904325 GGGGGTGGGGGGCGGCATCGGGG + Intergenic
900117119 1:1033627-1033649 GGGGCGCTGGGGCTGGGCCGGGG - Intronic
900121728 1:1051192-1051214 TGGGCCCTGGGTCTGCACCGTGG + Intronic
900129200 1:1080464-1080486 GGGCCTGGGGGGCTGCTCAGAGG + Intergenic
900158881 1:1214096-1214118 GGGGCTCGGCGGCTGGGCCGCGG - Exonic
900315923 1:2056277-2056299 GTGGCTCTGACGCTGCACCGGGG + Intronic
900340601 1:2187064-2187086 GTGACTTGGGGGCTGCACAGTGG + Intronic
900417974 1:2543693-2543715 AGGGCTCGGGGCTGGCACCGAGG + Intergenic
900473195 1:2864425-2864447 GGGGATTGGGGGCTACAGCGTGG + Intergenic
901109817 1:6785594-6785616 GGGGCTGGGGGGCGGCGCGGCGG + Intronic
901405008 1:9039678-9039700 GGGGCTGGGCGGCTGCCCGGAGG + Intronic
902214348 1:14924774-14924796 GGGGCTCGGGGGCTGCACCGGGG + Intronic
902410512 1:16208920-16208942 TGGGCTCGGGGGCTTCAGGGCGG + Exonic
903259145 1:22121862-22121884 GAGGCTCGGGGGCTTTTCCGAGG + Intronic
903389647 1:22954861-22954883 GGGGCTGTGGGGCTGGACAGAGG - Intronic
903668623 1:25022605-25022627 GGGGCCTAGAGGCTGCACCGGGG + Intergenic
904473300 1:30748845-30748867 GGGGATCAGCGGCTGCACTGGGG - Intronic
904912273 1:33944309-33944331 GGGGCGAGTGGGCTGCACCAGGG + Intronic
904941052 1:34165049-34165071 GGGGCGCTGCGGCTGCCCCGCGG - Exonic
905279123 1:36837663-36837685 GAGTCTCGGGTGCTGAACCGAGG - Intronic
906205647 1:43985110-43985132 GGGGCTCGGGGGCTGGAAGTGGG - Intronic
906919419 1:50048192-50048214 GGGGTGCGGGGCCTGCGCCGAGG - Intronic
909489434 1:76209805-76209827 GTGGCCCGGGGGCTGCACAGAGG - Intronic
914817116 1:151071171-151071193 GGGGCTGGGGAGCTGGACCAAGG + Intronic
914824923 1:151133284-151133306 GGGGCTCTGGGCCCCCACCGTGG + Exonic
915246295 1:154558476-154558498 GGGGCCAGGGGGCGGCGCCGGGG - Exonic
918097222 1:181345444-181345466 GGGGCCAGGGGGCTGCGCCTGGG + Intergenic
920678698 1:208056720-208056742 GGGGTCCAGGGGCTGCACTGGGG + Intronic
920795538 1:209132952-209132974 GGGGCTCGGAGGCTGCTGCGGGG - Intergenic
921060191 1:211578769-211578791 GGGGCTCGGCGGCTTGACCCGGG - Intergenic
922586330 1:226737243-226737265 GGGGCTCCGGGGCTCCTCGGGGG + Exonic
922787788 1:228291728-228291750 GGTGCTGGTGGGCTGGACCGTGG + Intronic
924184669 1:241475664-241475686 GAGGCTCTGGGGCTGCCCTGGGG - Intergenic
1062843690 10:689406-689428 GGGGCGCGGGGCCTGCGGCGGGG - Intronic
1062921254 10:1281600-1281622 AGGGCTCAGGAGCAGCACCGAGG + Intronic
1062946079 10:1463150-1463172 TGGGATTGGGGGCTGCAGCGGGG + Intronic
1062966306 10:1610206-1610228 GGGGCCCTGGGGCTGCAGGGAGG - Intronic
1069386259 10:67885236-67885258 GGGGCTCGGGGCAGGCTCCGCGG + Intronic
1069633297 10:69910603-69910625 GGGGCATGGGGGCAGCACAGGGG - Intronic
1070129722 10:73647950-73647972 GGGGCTCTGGAGCTCCACCTGGG + Exonic
1070333071 10:75431664-75431686 GGGGCGCGGCGGCAGCAGCGGGG - Intronic
1070566310 10:77606104-77606126 GAGGCTGGAGGGCTGCACCAAGG - Intronic
1071690808 10:87818019-87818041 GGCGCTTGGGGGCGGCACTGAGG + Exonic
1072717427 10:97761037-97761059 GGGGCGTGGGGGCTGCAGCCTGG + Intergenic
1073330312 10:102666156-102666178 GGGCCACGAGGGCTGCACAGAGG - Intergenic
1073392746 10:103193006-103193028 GTGGGGCGGGGGCCGCACCGAGG + Intronic
1073428938 10:103473463-103473485 CAGGCGCGGGGGCTGCGCCGGGG - Exonic
1073446272 10:103582372-103582394 GAGGCTGGGGGGCTGCAGAGAGG - Intronic
1075690229 10:124389319-124389341 GGGGCTCGGGAGCTGGGGCGGGG - Intergenic
1075782092 10:125023614-125023636 GGGGCTGGTGGGCCGCACTGGGG + Intronic
1075855307 10:125624788-125624810 GGGGCTCGGGGGCAGATCCCAGG + Intronic
1075940621 10:126387933-126387955 GGGGCTCCGGAGATGCGCCGGGG + Intronic
1076306202 10:129467189-129467211 GGGGCGCGGGGGCGGGGCCGAGG - Exonic
1076922211 10:133459903-133459925 GGGGCCGGGGCGCTGCACGGGGG + Intergenic
1076986021 11:236454-236476 GGGGCGCGGAGGCGGGACCGGGG - Intronic
1077135432 11:995772-995794 GGGGGACAGGGGCTGCACAGAGG - Intronic
1077190144 11:1252591-1252613 GGGCCTCGGGAGCTGGACTGTGG - Intronic
1077325484 11:1962126-1962148 GGGGCTCAGGGGTTGGACCGAGG + Intronic
1077360984 11:2139978-2140000 GGGGCTCCGGCGCGGCACCGGGG - Intronic
1077360988 11:2139986-2140008 GGGGCTCCGGGGCTCCGGCGCGG - Intronic
1080388923 11:31826372-31826394 GGGGCTCGGGGTCTGTCCCCGGG - Intronic
1080551506 11:33376708-33376730 GGGGCGCGGGGGCCGGCCCGTGG + Intergenic
1080834304 11:35926260-35926282 GAGGATTGGGGGCTGCACGGTGG + Intergenic
1081636809 11:44727103-44727125 GGGGCTCGGGGCCGGGACCGGGG - Intronic
1081725153 11:45322753-45322775 GGGGGTCTGGGGCTGCACTTAGG - Intergenic
1083479316 11:62933640-62933662 GGGTCTCAGGGGCAGCACCAAGG + Intergenic
1083670886 11:64299481-64299503 GGGGATCGGGGCCTGCCCAGCGG - Exonic
1083726841 11:64632978-64633000 GGGGTTTGGGGGCTGCCCCCAGG + Intronic
1083852594 11:65376919-65376941 GGGCCCCGGGGGCTGTTCCGAGG - Exonic
1083882116 11:65553887-65553909 GGGGGGCGGGGCCTGCACTGGGG + Exonic
1084102341 11:66958054-66958076 GGCGCTCGGGGGCTGCAGCCGGG + Intronic
1084128745 11:67118392-67118414 GGGGCCAGGCCGCTGCACCGAGG + Intergenic
1084184546 11:67464750-67464772 GGGGCTGTGGGGCGGCACTGGGG - Intronic
1084461142 11:69297379-69297401 GGGGCTGGGGGCCTGCCCCCCGG - Intronic
1084592523 11:70098795-70098817 GGGCCACGGGGGCTGTAGCGGGG + Intronic
1084656640 11:70523543-70523565 AGGGCTTCGGGGCAGCACCGGGG - Intronic
1084732374 11:71081848-71081870 GGGGCTCAGGGTCTGCCCCTGGG - Intronic
1084769652 11:71334422-71334444 GAGGCTGGGGGGCTGCAGCTGGG - Intergenic
1084804854 11:71571660-71571682 GGGGCTGGGGGCCGGGACCGCGG + Intergenic
1085172830 11:74463432-74463454 GGGGCTCTGGGGCTGCCTCTGGG + Intronic
1087761822 11:102110696-102110718 AGGGCCGGGGGGCTGCGCCGCGG - Exonic
1089496422 11:118910513-118910535 GGGGCCCCGGGGCTGCAGCTGGG + Exonic
1090189536 11:124759299-124759321 GGCGCTCAGGGGGTGGACCGGGG + Intronic
1090941574 11:131392425-131392447 GGGGCTCTGTGGTTGCACAGAGG - Intronic
1091238962 11:134039834-134039856 GGGGCATGGGCTCTGCACCGAGG - Intergenic
1091292955 11:134452308-134452330 GAGACTCTGGGGCTGCAGCGTGG - Intergenic
1202808464 11_KI270721v1_random:17305-17327 GGGGCTCAGGGGTTGGACCGAGG + Intergenic
1091812859 12:3414579-3414601 GGGGCTTGGAGGCTGCTGCGGGG - Intronic
1092256274 12:6928156-6928178 GGGGATCGGGGTTTGCTCCGGGG + Intronic
1093894693 12:24562751-24562773 GGGGCGCGGGGGCGGTGCCGGGG + Intergenic
1095752937 12:45730217-45730239 GGGGCTGGGGGGGTGGCCCGCGG + Intronic
1096436063 12:51591677-51591699 AGGGATGGAGGGCTGCACCGCGG - Intronic
1096649305 12:53054102-53054124 GGGGGTGGGGGGCTGTCCCGGGG - Intronic
1096741260 12:53695676-53695698 GGGGCGGGCGGGCTGCACAGAGG + Intergenic
1100565424 12:95790264-95790286 GCTGCTCTGGGGCTGCACGGTGG - Exonic
1100830865 12:98515767-98515789 GAGGCTCGGAGGCGGCAGCGCGG + Exonic
1101409390 12:104456658-104456680 GGGGGTGGGTGGCAGCACCGAGG + Intronic
1101466776 12:104957891-104957913 TGGGCTCGGGCGCTGCCCGGCGG + Intronic
1102010345 12:109614542-109614564 AGGGCTCAGGGGCAGCACCCAGG - Intergenic
1102204594 12:111081927-111081949 GAGGCTGGAGGGCTGCACCTGGG - Intronic
1103341750 12:120224610-120224632 CGGGCTCTGGGGCTGCCCTGTGG + Intronic
1103377669 12:120469404-120469426 GGGGCGCGGGGGCCTCACCGGGG + Exonic
1104057637 12:125242771-125242793 GAGGCTCTGGGGCTGGACCAGGG - Intronic
1104711811 12:130992643-130992665 GGGGCCAGGTGGCTGCACAGGGG - Intronic
1104761292 12:131298872-131298894 GAGGCTCGGTGGCTGCTGCGGGG + Intergenic
1104818483 12:131661920-131661942 GAGGCTCGGTGGCTGCTGCGGGG - Intergenic
1104916128 12:132265558-132265580 GGGGCCCGGGGGCTTCACACAGG - Intronic
1104961613 12:132490732-132490754 GGGGCGCGGGGGCGGCGCCTCGG - Exonic
1104975047 12:132548550-132548572 GTGGCTCAGGGGCTGCCCGGGGG - Intronic
1105937741 13:25117607-25117629 GGGGACCGGGGGCAGCACTGGGG - Intergenic
1106308264 13:28532402-28532424 GGGGCTGGGCGGGTGCACTGGGG - Intergenic
1112216435 13:97434802-97434824 GGGGCTTGGCGGCTGCACCCCGG + Intronic
1112437887 13:99404621-99404643 GGGGCCCAGGGGCTGCAGAGGGG - Intergenic
1113055075 13:106259334-106259356 GGGGCTCGGATGCTGCTGCGGGG - Intergenic
1117327271 14:54681169-54681191 GGGGCTGGGGGGCTGGAGGGGGG - Intronic
1119652341 14:76392707-76392729 GTGGCTCGGGGGCTGCCACCAGG + Intronic
1121828974 14:97033600-97033622 GCAGCTCTGGGCCTGCACCGTGG - Intergenic
1122230886 14:100305941-100305963 GGGGCGCCGGGGCAGCACCGTGG - Intronic
1122972807 14:105159225-105159247 GGGGCTCGGGGGCGGGGCCGGGG - Intronic
1122985043 14:105208153-105208175 GGGGCTCGGGGGCTGGGGCGCGG - Intergenic
1123089898 14:105737880-105737902 GGGGCTCGGGGGCAGGGCTGTGG - Intergenic
1123464569 15:20506000-20506022 TGGGCGCGGCGGCCGCACCGGGG - Intergenic
1123558056 15:21452497-21452519 TGGGCGCGGGGGCTGCCCTGCGG - Intergenic
1123594284 15:21889778-21889800 TGGGCGCGGGGGCTGCCCTGCGG - Intergenic
1123653545 15:22495041-22495063 TGGGCGCGGCGGCCGCACCGGGG + Intergenic
1124118449 15:26868054-26868076 TGGGCGCGGGGGCTGCACTGCGG - Intronic
1124275298 15:28321967-28321989 TGGGCGCGGCGGCCGCACCGGGG - Intronic
1124307406 15:28589634-28589656 TGGGCGCGGCGGCCGCACCGGGG + Intergenic
1124722280 15:32120726-32120748 GGGGTTGGGGAGCTGCTCCGTGG - Intronic
1125674363 15:41494445-41494467 CGGGCGCGGGGGCTGCACGGGGG + Intronic
1125719133 15:41836740-41836762 GGGTCTGGGGGGCTGCTCCCTGG + Intronic
1127923561 15:63515416-63515438 GGGGGTTGGGGGCAGCCCCGTGG + Intronic
1128650679 15:69410593-69410615 GGGGCGTGGGGGCTGTACCACGG + Intergenic
1129413814 15:75363842-75363864 GGGGCCGGGGGGCTGGACTGTGG - Intronic
1129549914 15:76437215-76437237 GGTGCACGGGGGCTGCAAAGAGG - Intronic
1129672798 15:77616460-77616482 GGGGCATGGCGTCTGCACCGGGG - Intronic
1131112900 15:89776526-89776548 GCGGCTCGGGAGCTGCAGCTCGG - Exonic
1131174666 15:90202064-90202086 CGCCCTCGGGGGCGGCACCGCGG - Intronic
1132201753 15:99959786-99959808 GGGACTCGGGGGCTGCCCTAAGG - Intergenic
1202966406 15_KI270727v1_random:179669-179691 TGGGCGCGGGGGCTGCCCTGCGG - Intergenic
1132491646 16:234973-234995 GGAGCTAGGGGGCAGCACGGCGG - Intronic
1132508512 16:324835-324857 GGGACTCGGGGGCTGGGCCTGGG - Intronic
1132564286 16:613818-613840 GGGGGTCGTGGGCAGCACCCAGG + Intronic
1132588162 16:715162-715184 CGGGCTTGGGGGCTTCGCCGGGG + Exonic
1132670885 16:1101934-1101956 GGGGCTCTGGGGCTGGAGCTTGG - Intergenic
1132720951 16:1315387-1315409 GGGGGTCGGGGGCTGGGCTGGGG - Intronic
1132975777 16:2710434-2710456 GGGCCTTGGTGGCTGCACTGTGG - Intergenic
1136026766 16:27473686-27473708 GGGGCTCTGGGGCAGCACCCAGG + Intronic
1136522545 16:30806128-30806150 GCGGAGCTGGGGCTGCACCGAGG + Intergenic
1137626306 16:49910891-49910913 GGGGCTCTGGGGCTGCCAGGCGG + Intergenic
1138417451 16:56879507-56879529 GGGGCTCAGGGACTCCACGGTGG - Intronic
1138514638 16:57529215-57529237 CGGGCTCAGGGGCGGCTCCGGGG + Exonic
1138747850 16:59384469-59384491 GGGGCTGGGGGGCTGCAGTTTGG + Intergenic
1139545345 16:67647259-67647281 GCGGCTCACGGGCTGCACCCTGG - Intronic
1142103804 16:88291286-88291308 GGGGCTCGGCTGCTGCACATTGG + Intergenic
1142355387 16:89599241-89599263 GGGTCTCGGGGGCTGGGCAGAGG + Intergenic
1142359213 16:89618953-89618975 GGGGCAGGGGGGCTGCAGGGAGG - Intronic
1142412643 16:89924154-89924176 GGGGTGTGGAGGCTGCACCGTGG + Intronic
1142978299 17:3657891-3657913 GGGGCACGGAGGCTGGACCCTGG - Intronic
1143037189 17:4006130-4006152 GGGGCTCGAGGGCATGACCGGGG - Exonic
1143116485 17:4584451-4584473 GGGCCTCGGGGGCGGAGCCGGGG - Intronic
1143210062 17:5179359-5179381 GGGTCTCTGGAGCTGCACCAGGG + Intergenic
1143493363 17:7296429-7296451 GGGGCACGTGTGCTGCCCCGGGG - Intergenic
1143514528 17:7413195-7413217 GGAGCATGGGGGCTGCACAGGGG + Intronic
1144710132 17:17396102-17396124 AGGGCTGGGGGGATGCGCCGTGG - Intergenic
1146208277 17:30922659-30922681 AGGGCGCGGGGGGCGCACCGCGG - Intronic
1146438918 17:32876906-32876928 GGGCCTCCGGGGCCGCTCCGTGG + Exonic
1147566462 17:41539260-41539282 GAGGCACGGGGGATGCACCAAGG + Intergenic
1148085925 17:44993835-44993857 GGAGCTGGGGGCCTGCACCCGGG - Intergenic
1148875374 17:50683951-50683973 GGGGATCGTGGGCCGCACTGGGG + Exonic
1149863637 17:60138587-60138609 GGGGCTAGGGAGCTACACTGTGG - Intergenic
1150250090 17:63700230-63700252 GGGGGTCGGCGGCGGCGCCGGGG - Intronic
1151834478 17:76574004-76574026 GGGGCTCTGGGCCTGCAGTGTGG + Intronic
1152067030 17:78117626-78117648 GGTGCTCGAGGGCTTCACCCTGG + Exonic
1152689620 17:81712142-81712164 GGTGCTCCGGGGCTGCTGCGTGG - Intergenic
1152697419 17:81804073-81804095 CGGGCTCGGGGGCGGCCCCGCGG - Intergenic
1152718379 17:81910845-81910867 GGAGCCCGCGGGCTTCACCGCGG + Intronic
1152727727 17:81955910-81955932 TGGGGTCGGGGGCAGCAGCGGGG - Intronic
1152812891 17:82390693-82390715 GGGACTTGGGGGCCGCACCTTGG - Intronic
1152960770 18:79222-79244 GAGGCTCAGGGGCAGCTCCGGGG - Intergenic
1152960790 18:79292-79314 GAGGCTCAGGGGCAGCTCCGGGG - Intergenic
1152960810 18:79362-79384 GAGGCTCAGGGGCAGCTCCGGGG - Intergenic
1152960830 18:79432-79454 GAGGCTCAGGGGCAGCTCCGGGG - Intergenic
1154304160 18:13218315-13218337 GGGGATCCGGGGCTGGCCCGCGG + Intronic
1157227465 18:45880198-45880220 GGGGCTCAGAAGCTGCTCCGCGG + Exonic
1157401298 18:47390742-47390764 GGGACTCGGGGGCTGGACCTGGG + Intergenic
1157966755 18:52217204-52217226 GGAGCTCTGGGCCTGCACCTTGG + Intergenic
1158388901 18:57027083-57027105 GGGGGACGCGGGCTGCACAGGGG - Exonic
1160116060 18:76080804-76080826 GGGGCTGGGGAGGTGCATCGCGG - Intergenic
1160404761 18:78637928-78637950 TGGGCTCCGGGTCTGCACTGCGG - Intergenic
1160731003 19:641771-641793 CGGGCTGGGAGGCTGCCCCGAGG + Intronic
1160773406 19:843798-843820 AGGGGTCTGGGGCTGCACCGCGG + Intronic
1160775469 19:853220-853242 GGGGCTCAGGGGCGGCCCCGGGG - Intronic
1161133894 19:2608444-2608466 GGTGCAGGGGAGCTGCACCGAGG - Intronic
1161136855 19:2625019-2625041 GGGGCTCGGGCCCTGTGCCGAGG + Intronic
1161476914 19:4491282-4491304 GGGGCACCAGGGCTGCGCCGGGG - Intronic
1161493712 19:4576266-4576288 GGGCCTCGTGGGCTGCAGTGAGG - Intergenic
1161583925 19:5094971-5094993 GCAGCTCGGGGGCGGCGCCGGGG + Intronic
1163747428 19:19056732-19056754 GGGCCCCGGGGGCTGCACGGAGG - Intronic
1165255970 19:34577495-34577517 GGTGCCCCGGGGCTGCAGCGCGG + Intergenic
1165794117 19:38508825-38508847 GGGGGTTGGGGGCTGAGCCGAGG + Intronic
1166128822 19:40733274-40733296 GGGGCTTGGTGACTGCACCCTGG - Exonic
1166205104 19:41264472-41264494 CGGGCTCGGGGGCCACCCCGGGG + Exonic
1166343406 19:42151450-42151472 GGGGCTGGGGGGACGCACCTGGG + Intronic
1166540016 19:43599021-43599043 TGGGCTTGGCGGCTGGACCGTGG - Exonic
1166677141 19:44747399-44747421 GGGGCATGGGGGCTGCACCCCGG - Intergenic
1166837666 19:45677303-45677325 CGGGGTCGGGGTCTGCACAGGGG + Exonic
1167072784 19:47230571-47230593 GGGGCGGGGGGGCGGCACGGAGG - Intronic
1167268978 19:48497740-48497762 GGGGCTGGGAGGCTGGACCTCGG - Exonic
1167490213 19:49788622-49788644 AGGGCTCGGGAGATGCACTGTGG + Intronic
1167646878 19:50710756-50710778 GGGCCACGGGGGCTGCACGTTGG + Intronic
1168153341 19:54460589-54460611 GGGGCTCGGGGGGGGCCCGGGGG - Intronic
1168280824 19:55304666-55304688 GGGGGGCGGGGGCTGCTCCCCGG - Exonic
925905964 2:8539810-8539832 GGGGCTGGGGCCCTGCAGCGAGG - Intergenic
925984984 2:9207651-9207673 GGCGCTCGGGGGCTGCGGCGGGG - Intronic
926146002 2:10397501-10397523 GGGCCTGGGGGGCTGCAGGGTGG - Intronic
927809342 2:26173033-26173055 GGGGCCCGGGGGCGGGGCCGGGG + Intergenic
929501250 2:42493535-42493557 TGGGGTGGGGGGCTGCAGCGGGG - Exonic
932567384 2:72918268-72918290 GGAGTGCGGGGGCTGCAGCGGGG - Exonic
932621908 2:73269646-73269668 GCGGCACGCGGGCTCCACCGCGG + Exonic
933774017 2:85761027-85761049 GGGGCTGAGGGGCTGCATCCGGG + Intronic
933895984 2:86809661-86809683 GGGGCTCGGGGCGTGCCCTGGGG + Intergenic
934636063 2:95991396-95991418 GGGGCTCGGGGTATGGACGGGGG - Intronic
934797583 2:97114030-97114052 GGGGCTCGGGGTTTGGACGGGGG + Intronic
934835830 2:97589409-97589431 GGGGCTCGGGGTATGGACGGGGG - Intronic
935222633 2:101028257-101028279 GGGGGTTAGGGGCTGCAACGGGG + Intronic
936553263 2:113469400-113469422 GGGGCACGGGGGCTCCACTTTGG - Intronic
936916284 2:117642050-117642072 GGGACACAGGGGCTGCCCCGAGG + Intergenic
937905181 2:127049628-127049650 GGTGCTCAGGGGCTGAGCCGTGG + Intronic
938066376 2:128284047-128284069 GAGGGTGGGGGGCTGCCCCGTGG - Intronic
938540501 2:132280499-132280521 GGGGCTTGGGGGGGGCAGCGGGG + Intergenic
939629701 2:144516992-144517014 GGGGCTCGAGGGGGGCAGCGGGG + Intronic
940533550 2:154908915-154908937 GGGGCAGGGTGGCTGCACTGAGG + Intergenic
944221860 2:197310943-197310965 CGGGCGCGGGGGCAGCGCCGGGG - Intronic
947524639 2:230870671-230870693 TGGGCTCGGAGGCCCCACCGAGG - Intronic
948135463 2:235633005-235633027 GGGGTTCAGAGGCTGCACCACGG - Intronic
948166197 2:235864512-235864534 GGGGCTCCGGGGCCGCGCAGTGG - Intronic
1168802704 20:653383-653405 GGGGCTCAGGCTCTCCACCGGGG + Intronic
1169001181 20:2169045-2169067 GGGGCTCGGGGCCTGAGCTGAGG + Intronic
1169327347 20:4686639-4686661 AGGGGCCGGGGGCTGCCCCGCGG + Intronic
1171191436 20:23162259-23162281 GGGGATTGGGGGCTGCTCCAAGG - Intergenic
1172284576 20:33731904-33731926 GGGGCTCGGCGGCGGCTCCTGGG + Exonic
1172320950 20:33994495-33994517 GGGGAACGGAGGCTGCTCCGGGG + Intronic
1172474422 20:35226606-35226628 GGGGCGCGGGGGCAGCACCCGGG - Intergenic
1173210653 20:41029156-41029178 TGGGGTCGGGGCCTGCGCCGGGG - Intronic
1174287752 20:49484137-49484159 GGGGCGCGGGGGCAGGACCGCGG + Intergenic
1174404130 20:50292800-50292822 GGGGCTTGGGGGCTGGGCTGCGG - Intergenic
1174570427 20:51497504-51497526 GGTGGTCTGGGGCTGGACCGGGG - Intronic
1175267089 20:57709614-57709636 GGGGCTCGGGGGCGGCCGGGGGG + Exonic
1175937403 20:62520084-62520106 GGGGCTGAGGGGCTGCACCGAGG - Intergenic
1177082722 21:16661273-16661295 GGGGCTGGGGGGCTGCGGCAGGG - Intergenic
1177166878 21:17613033-17613055 GGGGCTCGGGGGTGGCCTCGCGG - Intergenic
1178534867 21:33403267-33403289 GGGCCTCTGCGGCTGCAGCGCGG - Exonic
1178948495 21:36966908-36966930 GGGGCGGGGGGTGTGCACCGGGG + Intronic
1179433615 21:41344324-41344346 CGGTCTCGGGAGCTGCACCAAGG + Intronic
1179787077 21:43735991-43736013 GGGGCTGAGGGGCTGCACGGAGG - Intronic
1179971119 21:44837082-44837104 GGGTGTCGGGGGCTACACGGAGG - Intergenic
1180147127 21:45927911-45927933 GGGGCTCAGGAGCTGCCCCATGG - Intronic
1180230135 21:46422167-46422189 AGGGCTTGGGGGATGCCCCGAGG - Intronic
1182123658 22:27801622-27801644 GGGGCGCGGGGGCAGCTCTGGGG + Intergenic
1182352313 22:29705814-29705836 GAGGGTCGTGGGCTGCACCCAGG - Intergenic
1183282082 22:36937493-36937515 GGGGCTGGGGGGCTGCTCTGTGG - Exonic
1183653445 22:39171854-39171876 GGTGCGAGGGGGCTGCACCTGGG - Intergenic
1184035133 22:41914633-41914655 GGGGCGCGGGGACTGCTCGGCGG - Exonic
1184320298 22:43736870-43736892 GGGGGTGGGCGGCTGCAGCGTGG - Intronic
1184653566 22:45930369-45930391 GAGGCCTGGGGGCTGCACCCAGG - Intronic
1184690250 22:46114196-46114218 GGGCCTTGGTGGCTGCCCCGTGG - Intergenic
1184771912 22:46602101-46602123 GAGGCTGTGGGGCTGCACTGTGG + Intronic
1185016557 22:48346533-48346555 CTGGCTGGGGGGCTGCACAGTGG + Intergenic
1185088310 22:48752542-48752564 TGGGCTGGGGGGCTGCGCCACGG + Intronic
1185252809 22:49814282-49814304 AGGGTTCTGGGCCTGCACCGGGG - Intronic
1185346584 22:50313250-50313272 GGGGCTCAGGGCCTGCTCCCTGG - Intronic
950420048 3:12893018-12893040 GGGGTTGGGGGGGTGCACAGTGG - Intergenic
954424086 3:50434274-50434296 GGGGCAGGGGGGCGGCACTGAGG - Intronic
956301225 3:67774887-67774909 GGGGCTTTGGGGTTGCACCTGGG - Intergenic
962588144 3:136862504-136862526 GGGGCGCGGAGGCTGCTCGGAGG + Intronic
962702150 3:138010273-138010295 GGGGCTGGCCGGCTGCATCGCGG + Exonic
966592114 3:181695357-181695379 CGGGCTCGTGGGCTGCTCCGAGG - Intergenic
966851093 3:184165321-184165343 TGGGGCTGGGGGCTGCACCGGGG + Intronic
966886530 3:184380390-184380412 GGGGCTCTGGGCCGGCGCCGCGG - Exonic
968148344 3:196318259-196318281 GGCGCTCGCGGGCTTCAGCGAGG - Exonic
968225038 3:196968191-196968213 CGGCCTCGGGGGCTGCACTTCGG - Intronic
968445969 4:652196-652218 GGTGCTCAGGGGCTGCAGGGGGG + Intronic
968503482 4:961554-961576 GGGGCTCGGGGGCCGACCTGTGG - Exonic
968508886 4:986856-986878 GGGCCTCAGGGGCTGCTCTGAGG - Intronic
968701528 4:2060114-2060136 GGGGGTGGGGGGCTGCGCGGCGG - Intronic
969447876 4:7255868-7255890 GGGGCCCCGGGGCTGGAGCGTGG + Intronic
969447895 4:7255910-7255932 GGGGCCCCGGGGCTGGAGCGTGG + Intronic
969447914 4:7255952-7255974 GGGGCCCTGGGGCTGGAGCGTGG + Intronic
969490965 4:7498995-7499017 GGGGGCAGGGGGCAGCACCGTGG + Intronic
974003095 4:56530493-56530515 GGGGCTCGGGGGCTAGACCGGGG + Intergenic
976600656 4:86935098-86935120 GGGGCTCGGCTGCGGAACCGCGG - Exonic
981550520 4:145937499-145937521 GGGGTGCGGGAGCTGCGCCGAGG - Intronic
983779180 4:171646091-171646113 GGGGCTTGGGGGCTACAGCTGGG + Intergenic
985472193 5:53371-53393 GGGACTCGGGGGCGGCAGTGAGG - Intergenic
985517474 5:354366-354388 GGGACCCGGGGGCTGCCCTGGGG + Intronic
986718127 5:10538657-10538679 CAGGCTCGGGGGCTGCAGAGAGG - Intergenic
988816344 5:34838799-34838821 GGAGCTGTGGGGGTGCACCGTGG + Intergenic
990955422 5:61333788-61333810 GGGGCACAAGGGCTGCGCCGCGG - Intronic
997196080 5:131980890-131980912 GAGCCTCGGGGGCTGCGCTGTGG - Intronic
1001014296 5:168126648-168126670 GGGCCTCGGGGCCTGCTCCAGGG + Intronic
1002059997 5:176620435-176620457 GGTGCTCTGGGGCTGCCCGGGGG + Exonic
1003218407 6:4135711-4135733 GGGGCTCGGGGGTGGGGCCGGGG + Intergenic
1003218466 6:4135876-4135898 GGGGCTCGGGGGTGGGGCCGGGG + Intergenic
1003489663 6:6610400-6610422 GGGGCTCAGGGCCTGCACTGTGG - Intronic
1004815303 6:19305967-19305989 GAGACTCTGGGGCTGCACCATGG - Intergenic
1005334072 6:24775480-24775502 CGGGCTTGGGGACTGCAACGCGG + Intronic
1006785052 6:36660849-36660871 GGGGCTCGGGGACCCCGCCGCGG - Intergenic
1010703246 6:79077583-79077605 GGGGCTCGGGGTCCCCGCCGGGG - Intronic
1012930656 6:105312863-105312885 GGGGCTACGGGGCGGCACTGGGG + Intronic
1016996559 6:149965496-149965518 GGGGCTGCGGGTCTGCACCAGGG - Intronic
1017011836 6:150068678-150068700 GGGGCTGCGGGGTTGCACCAGGG + Intronic
1018683137 6:166281537-166281559 GGGGCTGAGGGGCTGCAACTGGG - Intergenic
1019624882 7:2011065-2011087 GGGGTTCGGGGGGAGCACCTGGG + Intronic
1023616484 7:42025259-42025281 GGGGCTCGGGGGCAGCAGGTAGG - Exonic
1024042813 7:45568252-45568274 GGGGGGTGGGGGCTGCACCAGGG - Intergenic
1025051812 7:55739183-55739205 CAGCCTCGGGGGCTGCTCCGTGG + Intergenic
1026874670 7:73872280-73872302 GGGGGTGGGGCGCTGCACTGGGG + Intergenic
1029152106 7:98488026-98488048 TGGGCTGGGAGGCTGCACTGGGG - Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1029748215 7:102528499-102528521 GGGGCTCGGTGGCTGGTCAGAGG + Intergenic
1029766162 7:102627586-102627608 GGGGCTCGGTGGCTGGTCAGAGG + Intronic
1031523300 7:122793151-122793173 GGGGCTGGAGGGATGCACCAAGG - Intronic
1032130717 7:129225243-129225265 GGGGACCGGGGGCCGCTCCGCGG - Exonic
1034058184 7:148058654-148058676 GGGACTAGGGGGCTGCAGAGGGG + Intronic
1034885188 7:154793786-154793808 GGGGTGTGGGGGCTGCTCCGTGG - Intronic
1034919690 7:155070120-155070142 GGGGCGAGGTGGCAGCACCGCGG + Intronic
1035203011 7:157278868-157278890 GGGGCTCCGTGGCATCACCGAGG - Intergenic
1035589615 8:802566-802588 GGCGCTCAGGGGCTGCATGGCGG + Intergenic
1035630689 8:1104683-1104705 TGGGCTGGTGGGCTGCACTGAGG + Intergenic
1035677745 8:1467245-1467267 GGGGCTGGGGGGAGGGACCGTGG - Intergenic
1035772042 8:2155538-2155560 GGGGGTTGGGGGCTACAGCGGGG - Intronic
1045494003 8:102692918-102692940 GGGGCTTTGGAGCTGCACGGAGG + Intergenic
1048991009 8:139760146-139760168 GTGGCTTGGGGGCTGCAGCGAGG + Intronic
1049220110 8:141425199-141425221 GGGGCTCCGGGCCTGCGCAGAGG + Intronic
1049354840 8:142182504-142182526 GTGGCTCGGGGGCTGGCCCTGGG + Intergenic
1049357606 8:142196434-142196456 GGGGCTCAGAGGCCACACCGAGG - Intergenic
1049644550 8:143730190-143730212 GGGGGGCGGTGGCTGCACCAAGG + Exonic
1053221655 9:36317866-36317888 GGGGGTTGGGTGCTGAACCGTGG - Intergenic
1053742785 9:41158052-41158074 GGGGCACGGGGGCTCCACTTTGG + Intronic
1054348062 9:63987893-63987915 GGGGCACGGGGGCTCCACTTTGG + Intergenic
1054445791 9:65314238-65314260 GGGGCACGGGGGCTCCACTTTGG + Intergenic
1054484478 9:65707267-65707289 GGGGCACGGGGGCTCCACTTTGG - Intronic
1056475165 9:86946275-86946297 CGGGGTCATGGGCTGCACCGAGG - Exonic
1056487705 9:87075731-87075753 GGAGCTGGGGGGCAGCACTGAGG - Intergenic
1057665235 9:97039343-97039365 GGCGCCCGGGGGCTGCGCGGAGG + Intronic
1057872439 9:98728594-98728616 TCGGCTCGGGGGATGCACCAGGG - Intergenic
1058357024 9:104094557-104094579 GGGGCGCGGGGGCTGTAGGGAGG + Intronic
1060139877 9:121201206-121201228 GGGGCTTGCGGGCTGCAGGGCGG + Intronic
1060211600 9:121713712-121713734 TGGGCTTAGAGGCTGCACCGGGG + Intronic
1060545607 9:124457437-124457459 GGGGCTGGGTGGCTGGACCTCGG - Intronic
1061359734 9:130133478-130133500 GAGGCACGGGGGCTGCTACGTGG + Intronic
1061548646 9:131319677-131319699 GGGGCCCCGGGGCTGCGCTGCGG - Intergenic
1061570839 9:131476629-131476651 GGGGCTGGGGGCCTGCCCCCAGG + Intronic
1062016563 9:134294081-134294103 GTGGCCCGGGGGCTGGTCCGGGG + Intergenic
1062180293 9:135187770-135187792 GGGTGTCGGGGGCTGCAGAGGGG - Intergenic
1062212609 9:135372928-135372950 GTGGCTGTGGGGCTCCACCGGGG - Intergenic
1062463729 9:136672323-136672345 GGGGCATGGGGGCTGCAGGGCGG - Exonic
1062501783 9:136854899-136854921 CTGGCTGGGGGCCTGCACCGGGG - Intronic
1062592129 9:137278867-137278889 GGTGCCCGGGGGCTGCAGCCCGG - Exonic
1062621468 9:137424099-137424121 GGGCCTCGGCCGCTGCACCCTGG - Intronic
1186496420 X:10015481-10015503 GGGGCGCGGGGGCGGCCGCGGGG - Intergenic
1189165610 X:38857953-38857975 GGGGTTCAGAGGCTGCACAGGGG - Intergenic
1190276602 X:48903244-48903266 GGGGCTGGGGGGCTGAGCTGAGG + Intronic
1190325558 X:49205014-49205036 GGGGGTCTGGGGCTGCCCAGGGG - Intergenic
1192206852 X:69101983-69102005 TGGGCTCTGGGCCTGCACCTGGG + Intergenic
1192436351 X:71145777-71145799 GTGGGTTGGGGGCAGCACCGAGG + Intronic
1194379200 X:93174454-93174476 GGTGCAGGGGGGCTGCACCATGG + Intergenic
1195269391 X:103215337-103215359 GGGGCCCGGGGGCTGCATCGCGG - Intronic
1195278917 X:103310739-103310761 GGGGCCCCGGGGCTGCATCGTGG + Exonic
1200000128 X:153056079-153056101 GGGGCGAGGGGTCTGCACCCCGG - Intergenic
1200180028 X:154144415-154144437 GAGGCTGGGTGGCTGCACTGGGG + Intronic
1200185856 X:154182809-154182831 GAGGCTGGGTGGCTGCACTGGGG + Intergenic
1200191508 X:154219947-154219969 GAGGCTGGGTGGCTGCACTGGGG + Intronic
1200197263 X:154257751-154257773 GAGGCTGGGTGGCTGCACTGGGG + Intronic
1201291168 Y:12421530-12421552 GAGGTGCGGGGGCTGCAGCGGGG - Intergenic
1202378732 Y:24259223-24259245 GGGGCCGGGGGGATGCTCCGTGG - Intergenic
1202492050 Y:25410898-25410920 GGGGCCGGGGGGATGCTCCGTGG + Intergenic
1202584691 Y:26410039-26410061 GGGGCTCGGGGTATGGACAGGGG + Intergenic