ID: 902214814

View in Genome Browser
Species Human (GRCh38)
Location 1:14927849-14927871
Sequence AAACCCGCGGTTGAGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902214805_902214814 -7 Left 902214805 1:14927833-14927855 CCCTCCCCTTTACATGAAACCCG 0: 1
1: 0
2: 0
3: 3
4: 98
Right 902214814 1:14927849-14927871 AAACCCGCGGTTGAGGGGACTGG 0: 1
1: 0
2: 0
3: 9
4: 45
902214806_902214814 -8 Left 902214806 1:14927834-14927856 CCTCCCCTTTACATGAAACCCGC 0: 1
1: 0
2: 1
3: 2
4: 46
Right 902214814 1:14927849-14927871 AAACCCGCGGTTGAGGGGACTGG 0: 1
1: 0
2: 0
3: 9
4: 45
902214804_902214814 -6 Left 902214804 1:14927832-14927854 CCCCTCCCCTTTACATGAAACCC 0: 1
1: 0
2: 1
3: 19
4: 181
Right 902214814 1:14927849-14927871 AAACCCGCGGTTGAGGGGACTGG 0: 1
1: 0
2: 0
3: 9
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902214814 Original CRISPR AAACCCGCGGTTGAGGGGAC TGG Intronic
902214814 1:14927849-14927871 AAACCCGCGGTTGAGGGGACTGG + Intronic
903262604 1:22139514-22139536 AATCCCACGGGTGAGGGGAGGGG - Intronic
904768916 1:32870438-32870460 AAACCCAGGGCTGAGGTGACAGG + Intronic
1062857841 10:788274-788296 AGACCCGCTGGTGATGGGACCGG + Intergenic
1065804278 10:29380640-29380662 AAACCACTGGGTGAGGGGACAGG + Intergenic
1065944904 10:30597380-30597402 AAACCACTGGGTGAGGGGACAGG - Intergenic
1069822163 10:71234899-71234921 AAAAGCTGGGTTGAGGGGACAGG + Intronic
1069862932 10:71482510-71482532 ACACCTGAGGTTGGGGGGACAGG + Intronic
1077041130 11:523635-523657 AAAGCCGGGGTTGGGGGGCCGGG + Intergenic
1088481133 11:110296909-110296931 AAACCTGCGGTCGAGGGAAGCGG + Intergenic
1113333612 13:109356406-109356428 AGCCCCGAGGTGGAGGGGACAGG + Intergenic
1115993180 14:39170407-39170429 AATGCCGGGGTAGAGGGGACCGG - Intronic
1122931204 14:104933721-104933743 GGACCCGCGGCTGAGGGGACCGG + Exonic
1122931231 14:104933789-104933811 GGACCCGCGGCTGAGGGGACAGG + Exonic
1122931246 14:104933824-104933846 GGACCCGCGGCTGAGGGGACCGG + Exonic
1122931315 14:104933994-104934016 GGACCCGCGGCTGAGGGGACGGG + Exonic
1122931331 14:104934029-104934051 GGACCCGCGGCTGAGGGGACGGG + Exonic
1122931347 14:104934064-104934086 CGACCCGGGGCTGAGGGGACGGG + Exonic
1122931362 14:104934099-104934121 GGACCCGCGGCTGAGGGGACAGG + Exonic
1132843422 16:1989610-1989632 CAACCCACGGGAGAGGGGACCGG - Intergenic
1133802161 16:9092446-9092468 AGGCCCGGGGTTGGGGGGACAGG + Intronic
1137310396 16:47251188-47251210 ACACCCTCGGTTGAGGCCACAGG + Intronic
1138105187 16:54284217-54284239 AACCCCGAGGTTGAGGGGCCAGG - Intronic
1145305840 17:21674666-21674688 CGACGCGCGGCTGAGGGGACTGG + Intergenic
1161631790 19:5360615-5360637 AGACCCGCGGATGAGTGGGCTGG - Intergenic
1167045416 19:47046307-47046329 AAAGCCAGGGTTGAGGAGACAGG + Intronic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1167439754 19:49501161-49501183 ACACCTGCGGCTGAGGGGAGGGG - Intergenic
928828815 2:35454247-35454269 ATAACCAGGGTTGAGGGGACAGG + Intergenic
933730380 2:85451780-85451802 AAACCCAGAGTTCAGGGGACAGG - Intergenic
934257791 2:91442622-91442644 AAACCCGCGGCGGCGGGGGCAGG - Intergenic
935351595 2:102155640-102155662 AAGCCCGCTGCTGAGAGGACAGG + Intronic
941095643 2:161237773-161237795 CAACCCGGGGCTGAGGGGGCGGG - Intergenic
948621976 2:239241149-239241171 AAACCCTTGGTGGAGGGCACTGG - Intronic
1171523348 20:25792176-25792198 CGACGCGCGGCTGAGGGGACTGG + Intronic
1171531089 20:25854133-25854155 CGACGCGCGGCTGAGGGGACTGG + Intronic
1171553478 20:26063707-26063729 CGACGCGCGGCTGAGGGGACTGG - Intergenic
1172360897 20:34311951-34311973 AAACCCGCGGATGGGTGGGCCGG - Intergenic
962256160 3:133871648-133871670 ACACCCGCTGTGGAGGCGACAGG - Intronic
975556634 4:75672534-75672556 AAACCCGCGGTGGCAGGGAGAGG + Intronic
983618529 4:169734861-169734883 AAAGCCCCGGCTGAGGGCACTGG - Intronic
983704072 4:170636190-170636212 AAACCAGGGGTGGAGGTGACTGG + Intergenic
998308189 5:141100481-141100503 AAACCAGCGGTTGAGAGCCCAGG + Exonic
1003007717 6:2397323-2397345 AAACCAGATGTTGAGGTGACCGG + Intergenic
1011146834 6:84227403-84227425 GAACCCGCGCTTCTGGGGACGGG - Intronic
1018936366 6:168276300-168276322 AGGCCCGGGGCTGAGGGGACAGG + Intergenic
1019488006 7:1298295-1298317 AAACCAGGGGCTGTGGGGACAGG + Intergenic
1025320153 7:58087093-58087115 AAAGCCGCGGAGGCGGGGACAGG - Intergenic
1032386055 7:131525058-131525080 ACACCAGAGGTTGAGGGAACTGG + Intronic
1045673907 8:104588387-104588409 TAACCCCGGGTTGAGGGGGCGGG + Intronic
1051825043 9:21210722-21210744 AAAACAGCGGTGGAGGTGACTGG - Intronic
1053272177 9:36757891-36757913 AAACCAGAGGTTGAAGGGACAGG - Intergenic
1187332770 X:18355258-18355280 AAACCCGGGGTTGAGCTAACGGG + Intergenic
1195903956 X:109826056-109826078 AAACCTGAGGTTGAGAGGCCAGG - Intergenic
1196669055 X:118346472-118346494 ACACCCGCGGGTGAGGGGGCCGG - Exonic