ID: 902215075

View in Genome Browser
Species Human (GRCh38)
Location 1:14929653-14929675
Sequence TTAGTGACTCACAGCAAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 139}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902215075_902215081 17 Left 902215075 1:14929653-14929675 CCGTGTTTGCTGTGAGTCACTAA 0: 1
1: 0
2: 1
3: 9
4: 139
Right 902215081 1:14929693-14929715 GAGAGACAGGCATGGTTATAAGG 0: 1
1: 0
2: 0
3: 18
4: 196
902215075_902215082 18 Left 902215075 1:14929653-14929675 CCGTGTTTGCTGTGAGTCACTAA 0: 1
1: 0
2: 1
3: 9
4: 139
Right 902215082 1:14929694-14929716 AGAGACAGGCATGGTTATAAGGG 0: 1
1: 0
2: 2
3: 19
4: 224
902215075_902215085 27 Left 902215075 1:14929653-14929675 CCGTGTTTGCTGTGAGTCACTAA 0: 1
1: 0
2: 1
3: 9
4: 139
Right 902215085 1:14929703-14929725 CATGGTTATAAGGGGTGTGCGGG 0: 1
1: 0
2: 1
3: 14
4: 104
902215075_902215084 26 Left 902215075 1:14929653-14929675 CCGTGTTTGCTGTGAGTCACTAA 0: 1
1: 0
2: 1
3: 9
4: 139
Right 902215084 1:14929702-14929724 GCATGGTTATAAGGGGTGTGCGG 0: 1
1: 0
2: 1
3: 10
4: 128
902215075_902215078 4 Left 902215075 1:14929653-14929675 CCGTGTTTGCTGTGAGTCACTAA 0: 1
1: 0
2: 1
3: 9
4: 139
Right 902215078 1:14929680-14929702 TGTAAACACTCCAGAGAGACAGG 0: 1
1: 0
2: 1
3: 10
4: 182
902215075_902215083 19 Left 902215075 1:14929653-14929675 CCGTGTTTGCTGTGAGTCACTAA 0: 1
1: 0
2: 1
3: 9
4: 139
Right 902215083 1:14929695-14929717 GAGACAGGCATGGTTATAAGGGG 0: 1
1: 1
2: 1
3: 10
4: 170
902215075_902215079 9 Left 902215075 1:14929653-14929675 CCGTGTTTGCTGTGAGTCACTAA 0: 1
1: 0
2: 1
3: 9
4: 139
Right 902215079 1:14929685-14929707 ACACTCCAGAGAGACAGGCATGG 0: 1
1: 0
2: 3
3: 26
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902215075 Original CRISPR TTAGTGACTCACAGCAAACA CGG (reversed) Intronic
902215075 1:14929653-14929675 TTAGTGACTCACAGCAAACACGG - Intronic
908871427 1:68617614-68617636 TCAGTGGCTGACAGCAAAAAAGG + Intergenic
911170458 1:94765879-94765901 TTCCTGACTCACAGAAATCATGG + Intergenic
915014721 1:152722027-152722049 TAAGTGACTAAAAGCAAGCAAGG - Intergenic
921683472 1:218062106-218062128 TTTCTGAGTCACAGGAAACAAGG - Intergenic
1069169190 10:65203945-65203967 TCCGTGACTCAGAGCAAACAAGG - Intergenic
1071118791 10:82254051-82254073 GCAGTGACTCACAACAGACAGGG - Intronic
1071235975 10:83648904-83648926 TAAGTGACTAACAGCAATCCAGG + Intergenic
1072268497 10:93752939-93752961 TGAGTGACTCACAGAATCCAAGG - Intergenic
1072922796 10:99590751-99590773 TAAAAGACACACAGCAAACAGGG + Intergenic
1075320327 10:121486315-121486337 TCAGTTGCTCACAGCAAAAATGG + Intronic
1078379016 11:10822934-10822956 ATAGTGACTCACAGAACTCAGGG - Intronic
1081938507 11:46920913-46920935 CCAGTGACTCACAGCAGCCAGGG - Intergenic
1087770274 11:102201952-102201974 TTTGTGCCTAAAAGCAAACAAGG + Intronic
1088622815 11:111704074-111704096 TTGGTCTTTCACAGCAAACAAGG - Intronic
1088837003 11:113586161-113586183 TTATTGGTTCACAGCAAATATGG - Intergenic
1090024867 11:123158829-123158851 CTAGTGATACACAGCACACAAGG + Intronic
1091598175 12:1894696-1894718 TTAGAAACTCGCAGCAAACTAGG + Intronic
1093511259 12:19931561-19931583 TTAATGACTGACAGCAAAGCAGG + Intergenic
1093704598 12:22260613-22260635 TCAGTGCCTCACTGGAAACAAGG + Intronic
1097856631 12:64470454-64470476 TTAGTGAATCACATCACAAATGG + Intronic
1098054648 12:66491941-66491963 TAAGTGATTCACAGGAAAAATGG + Intronic
1098601869 12:72341026-72341048 TGAGTGACCCACAGCTGACATGG + Intronic
1099067602 12:78003109-78003131 ATAGTGACTCAAAAGAAACATGG - Intronic
1101312707 12:103598090-103598112 TTTGTCACTCAGAGCAAAAAAGG - Intronic
1101835398 12:108291578-108291600 TGACTGACTCAAAGCAAAAAAGG - Exonic
1103826611 12:123744156-123744178 TTTCTGATTCACAGCAAATATGG - Intronic
1106917692 13:34532529-34532551 TTAGTGGCTTATAACAAACAAGG - Intergenic
1107931205 13:45309091-45309113 TCAGTGACTCACAGTAAACAAGG + Intergenic
1111378543 13:87414035-87414057 TCAGTGAATCAAAGCAAAGAAGG - Intergenic
1114790956 14:25657809-25657831 TAAGTGATTCAGAGGAAACAAGG - Intergenic
1117043859 14:51792513-51792535 TAAGAGACTCACAGCAAAAGAGG + Intergenic
1119824203 14:77643441-77643463 TTAGTGTCACACAGCAAAGAAGG + Intergenic
1120699948 14:87688032-87688054 ATAGTGACTCAAAGCAAGCTTGG + Intergenic
1125896527 15:43307457-43307479 TGAGTGACACACAGAAGACAGGG - Intergenic
1126253473 15:46596318-46596340 TTAATGACTCAGAGTAAACCTGG - Intergenic
1126973925 15:54151939-54151961 TTAGTGGCTCACAGAAATCAGGG - Intronic
1127402226 15:58600903-58600925 TTAGGGACTTACAACAAACTGGG + Intronic
1132247922 15:100311525-100311547 TTAGTAACTCAAAGCAGAGAAGG - Intronic
1133843556 16:9432748-9432770 TCTGTGGCACACAGCAAACAGGG - Intergenic
1134747824 16:16601448-16601470 ACTGTGACTCACAGCTAACAGGG + Intergenic
1134997644 16:18752215-18752237 AATGTGACTCACAGCTAACAGGG - Intergenic
1135343866 16:21671175-21671197 ATAGTGAATCACTTCAAACAGGG - Intergenic
1136700282 16:32130591-32130613 TTAGTTACTCACAAAAAACTAGG - Intergenic
1136767370 16:32796872-32796894 TTAGTTACTCACAAAAAACTAGG + Intergenic
1136800778 16:33073829-33073851 TTAGTTACTCACAAAAAACTAGG - Intergenic
1203069762 16_KI270728v1_random:1058894-1058916 TTAGTTACTCACAAAAAACTAGG + Intergenic
1145360162 17:22205311-22205333 GTAATGACTTACAGCAAAGAAGG - Intergenic
1153996355 18:10445383-10445405 TGAGTGACTCAAAGTAGACATGG + Intergenic
1154169928 18:12044044-12044066 TTGGTGACCCACAGCAAAATGGG - Intergenic
1158471119 18:57737846-57737868 TCCGTGACTCAAAGCAAGCAAGG + Intronic
1158629419 18:59099304-59099326 TTAGTGAATTACAGAACACAGGG + Intergenic
1161597384 19:5157538-5157560 TTAGACACACACAGCAGACATGG - Intergenic
1163979694 19:20887611-20887633 TGAGTGGCTGACAGTAAACAGGG - Intergenic
1165245112 19:34494165-34494187 TTAAGAACTCACAGGAAACATGG + Intronic
1168580035 19:57547671-57547693 AATGTGACTCACAGCAACCAGGG - Exonic
926869115 2:17392496-17392518 TAATTGACTCACAGTACACATGG - Intergenic
928667807 2:33568166-33568188 TTCCTGACTCACAGAAATCATGG + Intergenic
929262891 2:39885850-39885872 TTAGTGAATCCCAACAAAGATGG - Intergenic
931983148 2:67715610-67715632 TTATTGACTCAAAGCAAAAGGGG + Intergenic
932402142 2:71488438-71488460 TTAGTGAATCACTGCAGTCAAGG - Intronic
934319372 2:91958529-91958551 TAATTGACTCACAGCTCACATGG + Intergenic
936878653 2:117223009-117223031 TTAGTGAGTCACAACAGACCTGG - Intergenic
937435152 2:121874018-121874040 TAAGTGGCTCAGAGCAAAAAGGG - Intergenic
937471770 2:122179979-122180001 TTACTGACTCACTGCAACCAGGG - Intergenic
940063642 2:149600904-149600926 TATGGGATTCACAGCAAACATGG - Intergenic
940497529 2:154452263-154452285 TATGTCACTCACAGCAAACTTGG + Exonic
945777404 2:214124129-214124151 TTGTTGTGTCACAGCAAACATGG - Intronic
1171231721 20:23492319-23492341 TTAGTGACTGAATGCAATCAAGG - Intronic
1173701523 20:45075998-45076020 CCAGGGACTCTCAGCAAACACGG + Exonic
1176134179 20:63513087-63513109 TTTGTGAATCACAGCAGATAAGG + Intergenic
1181035801 22:20169286-20169308 TTAATGACACACAGGAAAGAAGG - Intergenic
1181287782 22:21766783-21766805 TTAGACACTAACAGCAAACGCGG - Intronic
1184805107 22:46790058-46790080 TTACTGGCTTACAGCAAACATGG + Intronic
949548207 3:5090700-5090722 TAAGTCATCCACAGCAAACATGG - Intergenic
949811886 3:8015109-8015131 TTAGGATTTCACAGCAAACAAGG + Intergenic
950793912 3:15495214-15495236 TTATTGACTCACTGCAAAGAGGG + Intronic
951065085 3:18254947-18254969 TTATTATCTCACAGTAAACATGG + Intronic
952032582 3:29162103-29162125 TTAGTGACACTCAGTAAAAATGG - Intergenic
952034561 3:29183950-29183972 TTGGTGAGTCACAGTAGACATGG + Intergenic
952193486 3:31047846-31047868 TCAGTGCCTCAGTGCAAACAGGG + Intergenic
953074653 3:39557484-39557506 CTAGTGAATCACAGCAACCAAGG - Intergenic
953553385 3:43922937-43922959 TGAGGAACTCACAGCAGACATGG + Intergenic
954241960 3:49300752-49300774 AGAATGACTCACAGCAAACCTGG + Intronic
955764190 3:62323463-62323485 TTAGAAATTCACAGGAAACAAGG + Intronic
961099783 3:124188796-124188818 TTAATGACTCACAGCAAAGCAGG + Intronic
961813615 3:129536059-129536081 CTAGTGAGTCACAGTAAAGAGGG - Intergenic
964124465 3:153221924-153221946 TCAGTGACTCACAGCAAGACAGG - Intergenic
965710381 3:171550909-171550931 TCAGTGATTTAGAGCAAACAAGG + Intergenic
965771238 3:172183375-172183397 TTAATGACACACAGCAAAAGAGG - Intronic
970449975 4:16156842-16156864 TGAGTGAGTGACAGCAATCATGG + Intergenic
971272525 4:25163909-25163931 TTAGGAACTCAAGGCAAACAGGG - Intronic
973579682 4:52331071-52331093 TGCAAGACTCACAGCAAACATGG - Intergenic
975847972 4:78545371-78545393 TTAGCTACTCTCAGCACACAGGG - Intergenic
978191240 4:105915080-105915102 TCAGTGTCTCACAGGAGACACGG + Intronic
979724923 4:123949540-123949562 TTAGTGCCTCACAGAAAAGGAGG - Intergenic
980222822 4:129942455-129942477 ATAGTGACTAACATTAAACATGG + Intergenic
982401560 4:154973398-154973420 TTAGAGACTCAGAGCCAGCAGGG - Intergenic
982778283 4:159464960-159464982 TGTGAGACTCACAGCAAACCTGG - Intergenic
983318989 4:166170660-166170682 TTTGTAAATCACATCAAACAAGG + Intergenic
983737521 4:171081131-171081153 TTAGTGACTGAGAGCAAAATGGG - Intergenic
984819267 4:183866017-183866039 TTGGTGACTCCCAGCAGACCTGG + Intronic
985418863 4:189763512-189763534 TTTGCCATTCACAGCAAACATGG - Intergenic
985541496 5:489543-489565 TTAGGAGCTCACAGCAAACTCGG - Intronic
986516073 5:8565200-8565222 TCATTGACCCACAGAAAACATGG - Intergenic
987701023 5:21398464-21398486 TTATTGACTCACAGATCACAAGG - Intergenic
988035864 5:25826192-25826214 TGAGTTACTCCCACCAAACAGGG + Intergenic
992127982 5:73662391-73662413 TTTCTGCCTCACAGCAAGCATGG + Intronic
992618384 5:78568410-78568432 TTAGTGCCACACAGAGAACACGG + Intronic
993353782 5:86881401-86881423 AGAGTGTCTCACAGGAAACAGGG + Intergenic
995341544 5:111066488-111066510 TCAGGGACCCACAGGAAACAAGG + Intergenic
995865440 5:116685319-116685341 TGAGGGACACACAGGAAACAGGG + Intergenic
999109273 5:149103860-149103882 ATAGTGGCTCACAGCATTCAGGG + Intergenic
1000380161 5:160621719-160621741 TCAGTGACTCACAGCTCACAGGG + Intronic
1006113163 6:31761010-31761032 ACAGTGACTCACATGAAACAAGG - Intronic
1006512531 6:34529339-34529361 TTTGTGACCAGCAGCAAACATGG - Intronic
1007370654 6:41425011-41425033 CTAGGGACACACAGCCAACATGG + Intergenic
1009858676 6:69296118-69296140 CCAGTGACTCTCATCAAACATGG + Intronic
1009926534 6:70127387-70127409 TTAGAGACTCACTGCAATCCTGG + Intronic
1010656945 6:78522550-78522572 TTAGGCATTCACAGCAAAAAGGG - Intergenic
1015331331 6:131982801-131982823 CTAGTGACTCATAGCACACTGGG + Intergenic
1016030972 6:139337753-139337775 CTATTGACTCACACAAAACATGG - Intergenic
1028379316 7:90180862-90180884 TTTGTGCAACACAGCAAACAAGG - Intronic
1029466127 7:100725911-100725933 TTACTGACTCACAGCATTCCTGG - Intergenic
1035733964 8:1874199-1874221 GTTGTGACCCCCAGCAAACACGG - Intronic
1038470859 8:27818173-27818195 TCAGTGACTTACAACAACCAAGG - Intronic
1044322335 8:90817502-90817524 TTAATAACTCTCAGCAAACTGGG - Intronic
1045264561 8:100608429-100608451 TTAGTGGCTCCAAGCCAACATGG + Intronic
1048747741 8:137633855-137633877 ATAGTGTTTCACAGCAAAAATGG + Intergenic
1049041915 8:140118907-140118929 TTGGTGACTCACAGGAAGCCAGG - Intronic
1049412675 8:142480313-142480335 TGAATGTCACACAGCAAACAAGG - Intronic
1051355797 9:16238940-16238962 TTACTGAGTCACAGCAGAGACGG + Intronic
1051577140 9:18629426-18629448 TTATTAACTCTCAGCAAACCAGG - Intronic
1051794659 9:20852165-20852187 CTAGTGATTCACAACAAAAATGG - Intronic
1055931737 9:81566212-81566234 GTACTAACTCACAGCAACCAAGG - Intergenic
1056910964 9:90700281-90700303 TGAGTGCTTCTCAGCAAACATGG - Intergenic
1057363783 9:94399630-94399652 TTGGTCAGTCACAGCATACATGG + Intronic
1057659549 9:96988459-96988481 TTGGTCAATCACAGCATACATGG - Intronic
1058759794 9:108119728-108119750 TTCCTGACACACAGCAAATACGG - Intergenic
1058786824 9:108396259-108396281 TTAGGGATTCAGAGCAAAGAAGG - Intergenic
1059031762 9:110705634-110705656 TTACTGACTTACAGCATAAAGGG + Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061602117 9:131677487-131677509 TTAGTGACTCACAGTGCTCACGG + Intronic
1186102559 X:6172544-6172566 ATAGTGACTCATAAAAAACATGG - Intronic
1188066664 X:25670007-25670029 TTAATGACAAACAGTAAACAAGG + Intergenic
1188706275 X:33335794-33335816 TTAATGAATCACAGTAAACCAGG - Intronic
1190027482 X:46938534-46938556 TTGGTGGCTGACAGCAAAAATGG - Intronic
1190361733 X:49655913-49655935 TTGGTGACCCACAGCAAAGTTGG + Intergenic
1191681852 X:63848657-63848679 TGACTGAAGCACAGCAAACAGGG + Intergenic
1200511223 Y:4082643-4082665 TTAATTATTCAAAGCAAACATGG - Intergenic