ID: 902216440

View in Genome Browser
Species Human (GRCh38)
Location 1:14937200-14937222
Sequence GCATAGACACAGGCTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 289}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902216440_902216443 -3 Left 902216440 1:14937200-14937222 CCTCAGCAAGCCTGTGTCTATGC 0: 1
1: 0
2: 1
3: 25
4: 289
Right 902216443 1:14937220-14937242 TGCCCCTTGCTAGGTGTTATAGG 0: 1
1: 0
2: 0
3: 7
4: 106
902216440_902216447 5 Left 902216440 1:14937200-14937222 CCTCAGCAAGCCTGTGTCTATGC 0: 1
1: 0
2: 1
3: 25
4: 289
Right 902216447 1:14937228-14937250 GCTAGGTGTTATAGGACCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902216440 Original CRISPR GCATAGACACAGGCTTGCTG AGG (reversed) Intronic
900150697 1:1178101-1178123 GCAGACACAAAGGCTTCCTGCGG + Intronic
900484695 1:2916716-2916738 GCAGGCACACAGGCATGCTGGGG - Intergenic
900745444 1:4357548-4357570 GCATACAGACAGGCAAGCTGTGG - Intergenic
901010578 1:6199477-6199499 GCATCTACCCAGGCTCGCTGGGG - Intronic
901030207 1:6302866-6302888 TCATAGACACAGGCATTGTGTGG - Intronic
902216440 1:14937200-14937222 GCATAGACACAGGCTTGCTGAGG - Intronic
903664434 1:24997763-24997785 GCCTAGAGACGTGCTTGCTGGGG - Intergenic
904716342 1:32470580-32470602 GCAGAGATACAGGTTTGCTCTGG + Exonic
907714960 1:56917696-56917718 GTACAGACGCAGGCTTGCTGAGG + Exonic
907975013 1:59423204-59423226 GCAGAGACAAAGGCTTTCGGTGG - Intronic
909067229 1:70949863-70949885 AAATAGAGAGAGGCTTGCTGGGG + Intronic
909465871 1:75973488-75973510 GCATAGCCAGTGGCTTGCTTTGG - Intergenic
912953119 1:114134247-114134269 GCTTAGAGCCAGGCTTGGTGGGG - Intronic
913217700 1:116634429-116634451 GCATGAAGCCAGGCTTGCTGTGG - Intronic
913515950 1:119605912-119605934 GCATAGAGACAGGCAGGCTGTGG + Intergenic
913591305 1:120329303-120329325 GAATACACACAGGCTTTCTAAGG + Intergenic
913652059 1:120925796-120925818 GAATACACACAGGCTTTCTAAGG - Intergenic
914050410 1:144126127-144126149 CCATGGCCACAGGCTTTCTGAGG - Intergenic
914128772 1:144839318-144839340 CCATGGCCACAGGCTTTCTGAGG + Intergenic
914169048 1:145203274-145203296 GAATACACACAGGCTTTCTAAGG + Intergenic
914524168 1:148447229-148447251 GAATACACACAGGCTTTCTAAGG + Intergenic
914599507 1:149188642-149188664 GAATACACACAGGCTTTCTAAGG - Intergenic
914642237 1:149619907-149619929 GAATACACACAGGCTTTCTAAGG - Intergenic
916061778 1:161103765-161103787 GAATTGATACAGGCTTCCTGAGG + Intronic
917789022 1:178487607-178487629 GTATAGGCACAGGCGTGGTGGGG - Intergenic
918088353 1:181264251-181264273 GGACAGATACAGGCCTGCTGAGG + Intergenic
918303914 1:183228631-183228653 GCACAGACACAGCCTGCCTGGGG - Intronic
920251247 1:204623891-204623913 GCCTACACACAGGGTTGTTGGGG - Intronic
921589186 1:216983952-216983974 TCAGAGACACAACCTTGCTGTGG + Intronic
921720296 1:218463776-218463798 GACTACACACAGGCCTGCTGTGG + Intergenic
922340479 1:224650932-224650954 GCGTGGACACTGGCTTGATGGGG + Intronic
922806996 1:228395281-228395303 GCACAGCCACAGGCAAGCTGGGG + Intronic
924775958 1:247114603-247114625 GCTAAGACACAGGCTGGCCGGGG + Intergenic
1062798846 10:364514-364536 TCATAAGGACAGGCTTGCTGGGG - Exonic
1062968116 10:1625923-1625945 GCATGGACACAGGCCTCCAGTGG + Intronic
1062968147 10:1626084-1626106 GCATAGACACAGGCCTCCACTGG + Intronic
1063391481 10:5652579-5652601 GCCTAGACACAGGCTCTCTCAGG - Intronic
1065765233 10:29023500-29023522 GCATAGACACAGGATGGATTGGG - Intergenic
1067499506 10:46789700-46789722 CCACAGACACAGACTTGGTGTGG + Intergenic
1068662907 10:59641800-59641822 GCATAGGCACATGGTTGCTTGGG - Intergenic
1068783111 10:60943475-60943497 CCATAGACACGGGGTTGCGGGGG + Intronic
1068904053 10:62302766-62302788 GCAGAGACAGAGGCTTTCTGCGG + Intergenic
1070020384 10:72579320-72579342 GCATAGACACAGGCTTCTCATGG + Intronic
1070288681 10:75100900-75100922 GCAGAGGCACAGGCTTCCTTGGG + Intronic
1070864641 10:79700534-79700556 GCACAGCCACAGGCCTGCTCTGG + Intergenic
1070878430 10:79838664-79838686 GCACAGCCACAGGCCTGCTCTGG + Intergenic
1071631544 10:87222763-87222785 GCACAGCCACAGGCCTGCTCTGG + Intergenic
1071644986 10:87354975-87354997 GCACAGCCACAGGCCTGCTCTGG + Intergenic
1072549884 10:96469463-96469485 GCACAGACACAGGGAGGCTGGGG - Intronic
1073426833 10:103460051-103460073 GCATTGACCCAGGCTTGCCCTGG + Intergenic
1075780111 10:125012012-125012034 GCATTCACACAGGCTGGGTGGGG - Intronic
1076812730 10:132897740-132897762 GCTCAGACCCAGGCTTCCTGGGG + Intronic
1078546729 11:12252447-12252469 ACATGGATGCAGGCTTGCTGGGG - Intronic
1080522821 11:33082576-33082598 AAAGAGACAAAGGCTTGCTGGGG - Intronic
1081798756 11:45842140-45842162 AAAGAGACAAAGGCTTGCTGGGG + Intergenic
1082029155 11:47592370-47592392 CCTCACACACAGGCTTGCTGTGG + Intronic
1083862539 11:65430115-65430137 TCACAGACACAGGCTTGGGGAGG - Intergenic
1084529159 11:69717004-69717026 GGATGGACACGGGCTTGCAGAGG + Intergenic
1085116263 11:73934907-73934929 GCAGAGGCAGAGGGTTGCTGAGG - Intergenic
1085318974 11:75562809-75562831 GCCTCCTCACAGGCTTGCTGAGG + Exonic
1085886724 11:80531375-80531397 GCATACAGACAGGCAGGCTGTGG + Intergenic
1087162152 11:94959351-94959373 GCATGGGCACAGGCTTGGGGAGG - Intergenic
1087261183 11:96014065-96014087 GCATACATACAGGCAGGCTGTGG - Intronic
1090136193 11:124201283-124201305 GCATACAGACAGGCAGGCTGTGG - Intergenic
1090277087 11:125427892-125427914 GCATAGACTCAGCCATCCTGTGG + Intronic
1091242136 11:134060296-134060318 GAAGAGACAAAGGCTGGCTGGGG + Intergenic
1092057862 12:5522410-5522432 GAAGAGACACAGGGATGCTGAGG + Intergenic
1092218421 12:6697815-6697837 GCTGAGACACAGGCCTACTGTGG + Intronic
1093697744 12:22181249-22181271 CCAGAGGCACAGGCTTTCTGAGG + Intronic
1094586610 12:31782697-31782719 GCATACAGACAGGCAGGCTGTGG - Intergenic
1096232091 12:49902507-49902529 GCTCACGCACAGGCTTGCTGGGG - Intronic
1096817971 12:54213610-54213632 GCACAGAAACATGCTTCCTGGGG + Intergenic
1097088650 12:56488120-56488142 GCAGAGCCGGAGGCTTGCTGGGG - Exonic
1097359641 12:58644961-58644983 GGAGAGATACAGGCTTACTGAGG + Intronic
1100263424 12:92953876-92953898 GCAAGTACACAGGGTTGCTGTGG - Intergenic
1101428692 12:104608494-104608516 AAGTAGACAAAGGCTTGCTGGGG - Intronic
1101455221 12:104824740-104824762 GCATACAGACAGGCAGGCTGTGG - Intronic
1104986487 12:132600497-132600519 TCAGGGACACAGCCTTGCTGTGG - Intergenic
1105043879 12:132986057-132986079 GCAGAGACGCAGGCGTGCTGAGG - Intergenic
1105288877 13:19033184-19033206 GATTTCACACAGGCTTGCTGGGG + Intergenic
1105618301 13:22041286-22041308 GCATACAGACAGGCAGGCTGTGG - Intergenic
1105702943 13:22947513-22947535 GCTTTGATACAGGCTGGCTGTGG + Intergenic
1105845014 13:24286607-24286629 GCATAGCCGCAGCCCTGCTGAGG + Intronic
1105855700 13:24370300-24370322 GCTTTGATACAGGCTGGCTGTGG + Intergenic
1106169900 13:27280034-27280056 GCATACAGACAGGCAGGCTGTGG - Intergenic
1106446363 13:29835803-29835825 GCAAAGACTCAGCCTTGCTGTGG + Intronic
1106767991 13:32934770-32934792 GGACACACACAGGATTGCTGAGG - Intergenic
1107801064 13:44108451-44108473 GCATAGACCCAGGCTGGATGAGG - Intergenic
1107942727 13:45388854-45388876 GTATAGATACAGGAATGCTGAGG + Intergenic
1108112153 13:47086379-47086401 GCAGAAACAGAGGCTTTCTGGGG - Intergenic
1108153463 13:47560762-47560784 ACATGGACATAGGCTTGCTTTGG - Intergenic
1109619228 13:64879874-64879896 GCATACAGACAGGCAGGCTGGGG + Intergenic
1110433652 13:75455796-75455818 GTAAAGACACAGCCTTGATGTGG + Intronic
1111193765 13:84844867-84844889 GAATAGACACAGGTTAGCAGGGG - Intergenic
1111584535 13:90268004-90268026 GCATACACACAGGCAGGTTGTGG + Intergenic
1112285410 13:98099772-98099794 GAGGAGACAAAGGCTTGCTGGGG - Intergenic
1114413902 14:22526184-22526206 GCATGGAAACAGGCTTCTTGGGG - Intergenic
1115457901 14:33626138-33626160 GCATAGACACAGACATGATGTGG - Intronic
1120745323 14:88146715-88146737 GCATACAGACAGGCGGGCTGTGG - Intergenic
1121509499 14:94501734-94501756 GCTGTGACACAGGCATGCTGAGG - Intronic
1122498861 14:102180579-102180601 GCAAGTACTCAGGCTTGCTGTGG + Intronic
1123420285 15:20125436-20125458 CCATGGCCACAGGCTTTCTGAGG - Intergenic
1123445577 15:20328096-20328118 CCATGGCCACAGGCTTTCTGAGG + Intergenic
1123529509 15:21131972-21131994 CCATGGCCACAGGCTTTCTGAGG - Intergenic
1126744975 15:51817295-51817317 GCATACAGACAGGCAGGCTGTGG + Intergenic
1128120086 15:65139411-65139433 GAGGAGACAAAGGCTTGCTGGGG - Intergenic
1129017658 15:72482856-72482878 TTAAAGACAGAGGCTTGCTGTGG + Intronic
1130682658 15:86010208-86010230 GCATACAGACAGGCAGGCTGTGG + Intergenic
1130690436 15:86077518-86077540 GCAGGGAAACAGGGTTGCTGGGG + Intergenic
1132854964 16:2040618-2040640 GCTTGGACAAACGCTTGCTGGGG + Intronic
1132904102 16:2273447-2273469 CCACAGGAACAGGCTTGCTGAGG - Intergenic
1133996447 16:10752172-10752194 GCAGAGACCAAGGCTTGGTGAGG + Intronic
1135535599 16:23291869-23291891 GCAGAGACACAGGTTGGGTGCGG - Intronic
1136222147 16:28835681-28835703 GCATACACAGCGGCTGGCTGGGG - Exonic
1138175850 16:54897663-54897685 GGATAGAGACAGCTTTGCTGGGG - Intergenic
1139229946 16:65273931-65273953 CCATAGGCACAGGCTTCCTGGGG + Intergenic
1141480160 16:84301035-84301057 GCAAAGACAGAGGGTTGCAGAGG + Intronic
1141552033 16:84812726-84812748 GCAGATACACAGGCCTGCTGAGG - Intergenic
1143290201 17:5822503-5822525 GCATACAGACAGGCAGGCTGTGG + Intronic
1143614851 17:8043669-8043691 GCATTGCCACTGCCTTGCTGAGG - Intronic
1144138474 17:12321914-12321936 CCAGAGACGAAGGCTTGCTGGGG - Intergenic
1144851235 17:18245106-18245128 GCACAGCCCCAGGCTTGGTGAGG - Exonic
1145392971 17:22470254-22470276 TCACAGACACTGGCTGGCTGAGG + Intergenic
1145717743 17:27038716-27038738 GATTTCACACAGGCTTGCTGGGG + Intergenic
1146738550 17:35261026-35261048 GAATGCACACAGGCTTGCTGCGG - Exonic
1147255411 17:39178236-39178258 GGGTAGACACAGGGCTGCTGAGG - Intronic
1148218209 17:45845341-45845363 GCATAGCCACAGGGATGGTGAGG - Exonic
1149436849 17:56640427-56640449 GCATAGAGAGAGATTTGCTGTGG - Intergenic
1149656772 17:58313820-58313842 TGCTAGACACAGGCCTGCTGGGG - Intronic
1150382668 17:64733030-64733052 GAAGAGACAACGGCTTGCTGTGG + Intergenic
1150970554 17:70022181-70022203 TCATCCACACAGGCTTTCTGGGG + Intergenic
1151579824 17:74971734-74971756 GCAGAGAAGCAGTCTTGCTGGGG + Intronic
1152828459 17:82482289-82482311 CCATAGGCACAGGCTCCCTGTGG + Intronic
1153432735 18:5036722-5036744 ACACAGACACAGGCCTGTTGAGG - Intergenic
1153558833 18:6349436-6349458 GAATACACACTGGCTTGGTGCGG + Intronic
1153968204 18:10201054-10201076 GCGTTGACTCAGGCTGGCTGTGG + Intergenic
1154133905 18:11759834-11759856 AGATAGACACAGGCTTGGAGAGG - Intronic
1154470845 18:14699441-14699463 GATTTCACACAGGCTTGCTGGGG - Intergenic
1155670148 18:28360632-28360654 AAAGAGACAAAGGCTTGCTGAGG - Intergenic
1156354484 18:36329542-36329564 GTATAGTCACAGGCCTGCTATGG + Intronic
1156368764 18:36453775-36453797 GCACAGGCAGAGGCTTGGTGTGG + Intronic
1157092719 18:44654923-44654945 GCAGAGACACAGGCATGATGAGG - Intergenic
1157541607 18:48514866-48514888 CCATAAACAAAGGCTGGCTGTGG + Intergenic
1159784615 18:72697974-72697996 GCAGAGACTCTGGCTTGCAGAGG + Intergenic
1160160738 18:76468039-76468061 GAATAGGCACGGGCTGGCTGGGG - Intronic
1162600227 19:11663237-11663259 GCAGGGAAACAGGCTTGCTGAGG + Intergenic
1165012046 19:32855807-32855829 AAAGAGACAAAGGCTTGCTGGGG - Intronic
1166907429 19:46121801-46121823 AAAGAGACAAAGGCTTGCTGGGG + Intronic
1168346127 19:55651001-55651023 GCATAGTCACAGGGGTCCTGAGG + Intronic
1168474975 19:56668976-56668998 GGGGAGACACAGGCTTGCTTGGG + Intronic
1202689817 1_KI270712v1_random:78765-78787 CCATGGCCACAGGCTTTCTGAGG - Intergenic
926089250 2:10039739-10039761 GCATAGCCACAGGCTCTCTCTGG + Intergenic
926825543 2:16902083-16902105 GCATACAGACAGGCAGGCTGTGG - Intergenic
927394071 2:22629323-22629345 GTATAGAGACAGGCTTGTTTTGG - Intergenic
927653223 2:24924731-24924753 ACAGAGACACAGGCTTGTGGGGG - Intergenic
929335353 2:40736994-40737016 GCAGAGACACAGGGATGATGAGG - Intergenic
930037179 2:47093836-47093858 CCAAAGCCACAGGCATGCTGCGG + Intronic
930831619 2:55749838-55749860 GCATACACTAAGGCTTGTTGTGG + Intergenic
930866194 2:56124206-56124228 AAAGAGACAAAGGCTTGCTGGGG + Intergenic
932803956 2:74767296-74767318 CCAAAGACTCAGGCTGGCTGAGG - Intergenic
933754517 2:85627464-85627486 TCATAAACACAGGCTTATTGGGG + Intronic
933768555 2:85728468-85728490 TCAGGGACACAGGCTTCCTGTGG - Intergenic
933919275 2:87028232-87028254 CAAGAGACAAAGGCTTGCTGGGG - Intergenic
933956603 2:87377257-87377279 CCATGGCCACAGGCTTTCTGAGG + Intergenic
934003719 2:87741675-87741697 CAAGAGACAAAGGCTTGCTGGGG + Intergenic
934074438 2:88415938-88415960 GCCCAGAAACAGGCTTGCAGAGG + Intergenic
934240746 2:90269284-90269306 CCATGGCCACAGGCTTTCTGAGG + Intergenic
934272446 2:91547475-91547497 CCATGGCCACAGGCTTTCTGAGG - Intergenic
934653895 2:96107570-96107592 GCACAGACCCAGCCCTGCTGGGG + Intergenic
934777539 2:96948951-96948973 GCATCCACGCAGGCTTACTGGGG - Intronic
935353678 2:102178057-102178079 GCAGAGACAGAGGAGTGCTGGGG - Exonic
935513773 2:104008148-104008170 GCATAGACAAAGGCCTGAAGTGG - Intergenic
935663951 2:105494223-105494245 GCATACAGACAGGCAGGCTGTGG + Intergenic
935882254 2:107576220-107576242 GCATACAGACAGGCAGGCTGTGG - Intergenic
936148488 2:109997386-109997408 CCATGGCCACAGGCTTTCTGAGG - Intergenic
936196189 2:110373982-110374004 CCATGGCCACAGGCTTTCTGAGG + Intergenic
938209772 2:129458029-129458051 GCAGAGCCACACACTTGCTGAGG + Intergenic
939649757 2:144746014-144746036 GCATACAGACAGGCAGGCTGTGG - Intergenic
940082487 2:149819771-149819793 GCACACACACAGTCTTGCTGGGG + Intergenic
940360533 2:152791394-152791416 GCATACAGACAGGCAGGCTGTGG - Intergenic
940361444 2:152800355-152800377 GCAGAGGCAAAGGCTTGCTGGGG + Intergenic
941186878 2:162328561-162328583 GCATACACACGGGCAGGCTGTGG + Intronic
941690510 2:168496604-168496626 GCCTACTCACAGGGTTGCTGTGG + Intronic
942540526 2:177010422-177010444 AAAGAGACAAAGGCTTGCTGGGG - Intergenic
946140921 2:217690040-217690062 CCATAGAGACAGGCAAGCTGGGG - Intronic
947207225 2:227672931-227672953 TCATAGACTCAGGCTTCCTCAGG - Intergenic
1170903582 20:20489906-20489928 GCATTTACACAGGCTGGCTCTGG + Intronic
1171210764 20:23315206-23315228 GCATTGACACATGCCGGCTGGGG - Intergenic
1171283530 20:23920319-23920341 GCATACACACTGGCTGGCAGTGG + Intergenic
1171384168 20:24756476-24756498 GCATAGAGACGGGCAGGCTGTGG + Intergenic
1173982662 20:47236847-47236869 CCATAGACACTGGGATGCTGAGG - Intronic
1174265108 20:49325578-49325600 GGAGATGCACAGGCTTGCTGGGG + Intergenic
1174335064 20:49854021-49854043 CCCTAGACCCAGGCTTGGTGAGG + Intronic
1175074897 20:56363958-56363980 GGAGCAACACAGGCTTGCTGAGG - Intronic
1175413103 20:58784470-58784492 GCATAGCCCCACGCTGGCTGGGG - Intergenic
1175680615 20:60985753-60985775 GCGAAGGCACAGGCTTGTTGGGG - Intergenic
1178481937 21:32987124-32987146 GCAAAGACATAGGCCTGCTGAGG + Intergenic
1178799352 21:35777988-35778010 GGATAGTCACATGCTTCCTGAGG - Intronic
1179189012 21:39107628-39107650 GCATAGAGGCAGCCTTTCTGGGG - Intergenic
1179342318 21:40523878-40523900 GCATACAGACAGGCAGGCTGTGG - Intronic
1180551601 22:16545798-16545820 CCATGGCCACAGGCTTTCTGAGG + Intergenic
1180819011 22:18812499-18812521 GCATGAAGCCAGGCTTGCTGTGG - Intergenic
1180906019 22:19412277-19412299 TCACAGACACAGGCCTGGTGAGG + Intronic
1180942409 22:19667934-19667956 GCATACAGACAGGCAGGCTGTGG - Intergenic
1181205235 22:21246947-21246969 GCATGAAGCCAGGCTTGCTGTGG - Intergenic
1181352401 22:22268125-22268147 CCATGGCCACAGGCTTTCTGAGG - Intergenic
1183943109 22:41307565-41307587 GCTGAGACACAAGCTTGGTGGGG + Intronic
1203221690 22_KI270731v1_random:48468-48490 GCATGAAGCCAGGCTTGCTGTGG + Intergenic
1203269136 22_KI270734v1_random:38352-38374 GCATGAAGCCAGGCTTGCTGTGG - Intergenic
953458156 3:43060505-43060527 GAACAGACAGAGGCTTGCTACGG - Intergenic
953714858 3:45308517-45308539 GCAAAGGTATAGGCTTGCTGTGG - Intergenic
954654394 3:52185199-52185221 GCTAAGACACAGGCAGGCTGTGG + Intergenic
956511736 3:70000243-70000265 GCATACAGACAGGCAGGCTGTGG - Intergenic
958632348 3:96700290-96700312 GCATAAAGACAGGCAGGCTGTGG - Intergenic
960515183 3:118595483-118595505 GCATATAGACAGGCAGGCTGTGG + Intergenic
961797550 3:129420599-129420621 TCATTGACACAAGTTTGCTGAGG - Intronic
962337628 3:134550628-134550650 GAGTAGAAACACGCTTGCTGTGG + Intronic
962992618 3:140592851-140592873 GAAGAGAAGCAGGCTTGCTGGGG - Intergenic
963157147 3:142111136-142111158 TCATAGAAACAGGCTGGGTGCGG + Intronic
963445185 3:145396007-145396029 GCATACAGACAGGCAGGCTGTGG - Intergenic
964661588 3:159125859-159125881 GCAGAGTCACAGGTGTGCTGTGG + Intronic
965321066 3:167251454-167251476 GCATACAGACAGGCTGACTGTGG - Intronic
965864248 3:173184700-173184722 GAAGAGACACAGGCCTGCTGAGG - Intergenic
966137778 3:176719705-176719727 GTATAGTCACAGACTTTCTGGGG - Intergenic
966436548 3:179891154-179891176 GGAAAGACACAGACTTCCTGAGG - Intronic
967833271 3:193940534-193940556 GCCCTGCCACAGGCTTGCTGTGG + Intergenic
969087050 4:4664284-4664306 GCAAAGACCCAGGGTAGCTGAGG + Intergenic
969407371 4:7002676-7002698 GCAGAGACCCAGGCTTGGTAAGG - Intronic
969761954 4:9192973-9192995 GCAGAGATAGAGGCTTGCTGAGG - Intergenic
970334795 4:15025528-15025550 ACCTAGACACAGGCATGGTGAGG - Intronic
971537575 4:27772853-27772875 ACATAGACACAGGCTAGGCGCGG + Intergenic
972458415 4:39276377-39276399 GCATAGAACCACGCTAGCTGGGG + Intronic
972918483 4:43907440-43907462 GCATACAGACAGGCAGGCTGTGG - Intergenic
974265072 4:59576791-59576813 GCATAGAAAAATTCTTGCTGTGG + Intergenic
975333470 4:73147369-73147391 GCCTTGACTCTGGCTTGCTGTGG - Exonic
975802410 4:78074942-78074964 TCACAGACAGAGCCTTGCTGAGG + Intronic
976051295 4:81013939-81013961 GCAAAGACTGAGGCTTCCTGAGG + Intergenic
979674970 4:123399627-123399649 GCATAGACAAATCCTTGCTTAGG + Intronic
984817088 4:183849038-183849060 GCATGTACACAGTCTTGCAGGGG + Intergenic
984838624 4:184047455-184047477 CCATACCCACAGGCTTGCAGTGG + Intergenic
989558361 5:42823222-42823244 GGCTAGACACATGCATGCTGAGG + Intronic
989984322 5:50679550-50679572 GAATACACACAGGCTTTCTAAGG - Intronic
990632934 5:57690833-57690855 ACGGAGACAAAGGCTTGCTGGGG + Intergenic
990689184 5:58343605-58343627 GCATATGCACAGGCTGACTGTGG - Intergenic
993021209 5:82593696-82593718 ACATAGCAACAAGCTTGCTGTGG - Intergenic
994301871 5:98157192-98157214 GCATACACACAGGCAGGCTGTGG + Intergenic
994884950 5:105548792-105548814 GCATACAGACAGGCAGGCTGTGG + Intergenic
995387537 5:111604460-111604482 GCATAGAAACAGGATTTCTTGGG - Intergenic
995800468 5:115988688-115988710 GCAGAGACCCTGGCTTCCTGGGG - Intronic
995979050 5:118079131-118079153 GCATACAGACAGGCAGGCTGCGG - Intergenic
999263917 5:150254175-150254197 GCAAAGACACAGGATGCCTGAGG - Intronic
999477725 5:151916600-151916622 GCATAGCTAGAGGCTTGCTTAGG - Intronic
999851120 5:155540609-155540631 ACATAGAGACACTCTTGCTGAGG - Intergenic
1002419528 5:179138382-179138404 GCACAGAAAGAGGCATGCTGAGG + Intronic
1003234066 6:4280836-4280858 GCATAGAAACAGCCCTGCTCTGG - Intergenic
1003423138 6:5975900-5975922 AAAGAGACAAAGGCTTGCTGGGG - Intergenic
1005464710 6:26101217-26101239 GCAGAGACACAGGTATGCTACGG + Intergenic
1007238023 6:40405056-40405078 CCAAAGACACAGGCTGGCTAAGG - Intronic
1007307622 6:40919193-40919215 GCATACAGACAGGCAGGCTGTGG - Intergenic
1007751900 6:44076145-44076167 GGGTACACACAGGTTTGCTGTGG - Intergenic
1007908833 6:45492141-45492163 GCATAGACGCTGGCAGGCTGGGG + Intronic
1009478452 6:64125217-64125239 GCATACAACCAGGCTTTCTGGGG + Intronic
1015519263 6:134114774-134114796 ACAAAGACACAGGTTGGCTGGGG + Intergenic
1018127501 6:160695839-160695861 CAAGAGACAAAGGCTTGCTGGGG + Intergenic
1018149021 6:160921213-160921235 CAAGAGACAAAGGCTTGCTGGGG - Intergenic
1018151800 6:160946589-160946611 ACATAAACACAGGTATGCTGGGG - Intergenic
1018185484 6:161262579-161262601 GTAAAAACACAGGCTTACTGGGG + Intronic
1020914223 7:14171912-14171934 TTTTAGACACAGGCTTACTGAGG - Intronic
1021100614 7:16584010-16584032 GCATACACAGTGGCTGGCTGGGG + Intergenic
1023808407 7:43891634-43891656 GAGGAGACAAAGGCTTGCTGTGG - Intronic
1027005691 7:74690728-74690750 GAGTTTACACAGGCTTGCTGGGG - Intronic
1028075822 7:86514431-86514453 GCATTGGCGCAGTCTTGCTGTGG + Intergenic
1030352626 7:108507040-108507062 TCATAGAAACAGGCTCGGTGAGG + Intronic
1036272056 8:7314839-7314861 GCAGAGATAGAGGCTTGCTGAGG - Intergenic
1036349289 8:7995506-7995528 GCAGAGATAGAGGCTTGCTGAGG + Intergenic
1036844579 8:12156043-12156065 GCAGAGATAGAGGCTTGCTGAGG + Intergenic
1036865949 8:12398376-12398398 GCAGAGATAGAGGCTTGCTGAGG + Intergenic
1036917771 8:12821271-12821293 GCATACAGACAGGCAGGCTGTGG + Intergenic
1039076203 8:33692738-33692760 GCATATAGACAGGCAGGCTGTGG + Intergenic
1039086269 8:33783320-33783342 GCATAGAGACAGGCAGGCTGTGG + Intergenic
1039843090 8:41307539-41307561 GCACAGACGCAGGCTTCCTGAGG - Intronic
1040433288 8:47364962-47364984 TAATGGCCACAGGCTTGCTGTGG - Intronic
1041934762 8:63322724-63322746 GCATACAGACAGGCAGGCTGTGG - Intergenic
1041935388 8:63326640-63326662 GCATACAGACAGGCAGGCTGTGG - Intergenic
1043392178 8:79802438-79802460 ACATAGACACAGGCTTGGTCAGG - Intergenic
1043841296 8:85107378-85107400 TCATGGACAAAGGCTTGCAGAGG + Exonic
1045614552 8:103893884-103893906 GCATGCACACAGCCATGCTGTGG + Intronic
1047064613 8:121266862-121266884 GCATTGACAAAGGCTTCCTATGG + Intergenic
1047521904 8:125601442-125601464 GCACAGACACAGGCCTGGGGAGG + Intergenic
1048608542 8:135996467-135996489 GAATAGTCTCTGGCTTGCTGTGG - Intergenic
1055199772 9:73646262-73646284 GCATACAGACAGGCAGGCTGTGG + Intergenic
1055647843 9:78377681-78377703 GCATAGCCACAGCCCTGCAGTGG - Intergenic
1056245560 9:84691669-84691691 GCAGAGATGCAGGCTTCCTGGGG + Intronic
1056843321 9:90016450-90016472 GCATTCCCACAGGCTTCCTGGGG + Intergenic
1057174610 9:92986907-92986929 GCAAAGACACAGGCTCCCTTGGG - Intronic
1058584424 9:106491959-106491981 GCATACAGACAGGCAGGCTGTGG + Intergenic
1058709133 9:107664250-107664272 GCATAAACAAAGGCTTACAGTGG + Intergenic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1059247472 9:112861078-112861100 CCAGAAACAAAGGCTTGCTGGGG + Intronic
1060522843 9:124303613-124303635 GCATACACACAAGCATGCAGAGG + Intronic
1061304999 9:129727018-129727040 GCTTAGAGACGGGTTTGCTGGGG - Intergenic
1061791780 9:133062982-133063004 GCACCGACACCGGCTTCCTGTGG - Intronic
1061795455 9:133083548-133083570 GCACCGACACCGGCTTCCTGTGG - Intronic
1062398497 9:136362341-136362363 GCAGAGACACAGGGCTGGTGAGG - Intronic
1062701423 9:137906826-137906848 GACTAGACACAGGCATGCAGGGG - Intronic
1185942824 X:4340548-4340570 GCATAAAGACAGGCAGGCTGTGG + Intergenic
1186102113 X:6168165-6168187 GCAGAAACACAGGCTTGTTAAGG - Intronic
1186387116 X:9121140-9121162 GTATAAACACAGGCTGGGTGTGG + Intronic
1186633802 X:11380216-11380238 ACATATACACAGGCTTGGTTTGG - Intronic
1192148775 X:68699056-68699078 GGACAGACACAGGCTTGGGGAGG - Intronic
1194054098 X:89109794-89109816 GCATACAGACAGGCAGGCTGTGG + Intergenic
1194272739 X:91838472-91838494 GCATAGCCCCAGGCATGCAGAGG + Intronic
1197041310 X:121939252-121939274 GCATAAAAACAGACTTGTTGTGG + Intergenic
1197627009 X:128813474-128813496 GAATAGACATAGGCATGCTTTGG - Intergenic
1197820107 X:130533626-130533648 CCATAGACAAAGGCTTGCTGGGG - Intergenic
1197924022 X:131627618-131627640 GCATAGAGACACTCCTGCTGAGG + Intergenic