ID: 902217464

View in Genome Browser
Species Human (GRCh38)
Location 1:14943664-14943686
Sequence GTGACCTGCTCAAGATCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 1, 2: 14, 3: 78, 4: 407}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902217460_902217464 17 Left 902217460 1:14943624-14943646 CCATTTTACAGATGAGAGAACTG 0: 11
1: 487
2: 2723
3: 7710
4: 14697
Right 902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG 0: 1
1: 1
2: 14
3: 78
4: 407
902217459_902217464 18 Left 902217459 1:14943623-14943645 CCCATTTTACAGATGAGAGAACT 0: 6
1: 414
2: 2336
3: 6850
4: 13583
Right 902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG 0: 1
1: 1
2: 14
3: 78
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902217464 Original CRISPR GTGACCTGCTCAAGATCACT TGG Intronic
900603912 1:3515460-3515482 GTGTCCAGCTCACAATCACTCGG - Exonic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901805951 1:11738680-11738702 GTGACTTGCCTAAGGTCACTAGG + Intronic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902671669 1:17978857-17978879 ATTACCTGCTCAAGGTCACATGG - Intergenic
902821962 1:18948979-18949001 GTGACTAGCCCAAGCTCACTCGG + Intronic
903010131 1:20323985-20324007 GTCACCTGCCCAAGGTCACATGG + Intronic
903186457 1:21632053-21632075 GTGACCCGCCCAAGGTCACATGG + Intronic
903188734 1:21644402-21644424 GTAACCTGTTCAAGGTCCCTTGG - Intronic
903239621 1:21974228-21974250 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903243429 1:21999156-21999178 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903250777 1:22052017-22052039 GTGACTTGCCCCAGATCACAGGG - Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903496240 1:23769514-23769536 GTGACATGCTCAAGTCCACATGG - Intergenic
903569377 1:24293206-24293228 GTAATCTGCTCAAGGTCACAGGG - Intergenic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903708953 1:25307633-25307655 GTTATCTGCCCAAGGTCACTCGG + Exonic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903953349 1:27009310-27009332 GTCACTTGCACAAGATCACGTGG + Intronic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904055901 1:27669639-27669661 GTATCCTGCCCAAGGTCACTTGG - Intronic
904172292 1:28599776-28599798 GTGACCTGTCCAAGGTCACTAGG - Intronic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
905002800 1:34686430-34686452 TTGAACTGCTCAAGGTCACCGGG + Intergenic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
905772639 1:40648246-40648268 AGGACCTGCTCAGGATCACATGG - Intronic
905850154 1:41267995-41268017 GTGACTTGCTTAAGGTCACTGGG - Intergenic
905894264 1:41534933-41534955 GTGACTTGCCCAAGGTCACCTGG - Intronic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906912777 1:49972993-49973015 CTAACCTGCCCAAGATCACATGG + Intronic
907309472 1:53531043-53531065 GTGACCTGCCCAAGGTCACAGGG + Intronic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
909040500 1:70643541-70643563 CTGACCTGGTCAGCATCACTAGG - Intergenic
909428158 1:75552139-75552161 GTGGCTTGCCCAAGATCACAGGG - Intronic
909561907 1:77016561-77016583 GTGATCTGATCAAAGTCACTTGG + Intronic
912713028 1:111963034-111963056 GTGGCCTGCTCAAGATCTCCTGG - Intronic
912722070 1:112028634-112028656 GCGACCTTCTCCAGATCAATAGG - Intergenic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913112342 1:115667571-115667593 GGGACCTGCTCAAGGTCACAGGG + Intronic
913186736 1:116375214-116375236 GTGACTTGCTCAAGGTCAAACGG + Intronic
913213250 1:116599107-116599129 GTGACTAGCTTAAGGTCACTAGG - Intronic
913983991 1:143548819-143548841 GTTACTTGTTCAAGGTCACTAGG + Intergenic
915299522 1:154944165-154944187 TTAACTTGCCCAAGATCACTTGG + Exonic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
917716996 1:177748288-177748310 GTGAGCTGCTCAGGGTGACTGGG - Intergenic
918105874 1:181414750-181414772 GTGACTTTCTCAAGGTCACGTGG + Intronic
920678878 1:208057973-208057995 GTGACTTGCTCAAAGTCACCTGG + Intronic
921374526 1:214460099-214460121 GTGACCTGCCCACAGTCACTGGG - Intronic
922200321 1:223395031-223395053 GTCACGTGCACAAGACCACTAGG + Exonic
922235689 1:223720977-223720999 GTCACCTGCCCAAGTTCCCTGGG - Intronic
923221409 1:231897650-231897672 GTGACCAGCTCAAAATCAGATGG - Intronic
1063334359 10:5197421-5197443 GTGTCATGCTCAAGACCACGCGG - Intronic
1063413777 10:5856884-5856906 GTGACCTGCATGAGGTCACTTGG + Intergenic
1063923528 10:10955198-10955220 GTAACCTGCTCAAGGCCACGTGG + Intergenic
1064479645 10:15726412-15726434 ATGTCCTGCTCAACCTCACTTGG + Intergenic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1065966808 10:30777349-30777371 GTGACTTGCTCAAGTCCACAGGG + Intergenic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1070079602 10:73172438-73172460 GTAACCTGCTTAAGGTCATTTGG - Intronic
1070492964 10:76994666-76994688 ATGACCTGCTTATGATTACTAGG + Intronic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1070795184 10:79212113-79212135 GTGACTTGCTTAAGGTCACGTGG - Intronic
1072212787 10:93261945-93261967 CTGACTTGCTCAAGAACACGTGG + Intergenic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1072439078 10:95438168-95438190 CAGGCCTGCCCAAGATCACTAGG + Intronic
1073345346 10:102778734-102778756 GTAGCCTTCTAAAGATCACTTGG + Intronic
1074082424 10:110178282-110178304 GTGACCTGTTCAAGGTCACATGG + Intergenic
1074374323 10:112926817-112926839 GTGCCCTGCACAAGAACATTTGG + Intergenic
1074895866 10:117777245-117777267 GTGACCTACTTAAGGTCACCTGG - Intergenic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1075025017 10:118978108-118978130 GTGACCTGCTCCAGGTCCCTGGG - Intergenic
1076398602 10:130161275-130161297 GTGACTTGCCCAAGGTCACCTGG + Intronic
1076406949 10:130218747-130218769 GTGGCCTGCCCTAGAGCACTGGG + Intergenic
1077486877 11:2842934-2842956 GTGACTTGCCCAAGGTCACCCGG + Intronic
1078742330 11:14078651-14078673 GTAACCTGTTCAAGGTCACAGGG - Intronic
1078774496 11:14381669-14381691 GTGACCTGCTCATGGTCACATGG - Intergenic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1078910930 11:15731105-15731127 GTGACTTGCTCAGGTTCACATGG + Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1079129490 11:17738961-17738983 GGGACCTGCCCAAGGGCACTCGG + Intronic
1079141506 11:17813340-17813362 GTGACTTGCTCATGATCATGTGG + Intronic
1079937955 11:26641316-26641338 GTGACTTGCTAAAAATCACACGG + Intronic
1079989576 11:27232636-27232658 GTGACTTGCTCATGGTCACTTGG + Intergenic
1080067729 11:28039072-28039094 GTGAGTTGCCCAAGGTCACTTGG - Intronic
1080849751 11:36057906-36057928 GTGACTTGCACAAGATTTCTTGG - Intronic
1082046234 11:47730394-47730416 GTGACCTGCTGACGATTTCTAGG + Intronic
1082262389 11:50086808-50086830 GTGATTTGCGCAAGCTCACTTGG - Intergenic
1082813489 11:57493192-57493214 ATGACTTGCTCAAGCTCACAGGG + Intronic
1083258794 11:61512017-61512039 GTGACTTGCTCAAGATCACTTGG - Intergenic
1083870759 11:65487066-65487088 GTGACCTGCTGAAGGTCCCAGGG + Intergenic
1084901236 11:72311492-72311514 GTGACCTGCTTAAGGTTACAGGG + Intronic
1085236729 11:75021054-75021076 GTGACCTGTTCAGGAACATTGGG - Intergenic
1085251324 11:75145767-75145789 GTGACCAGCCCCAGGTCACTGGG + Intronic
1085312339 11:75524142-75524164 GGGACCTGCTCAAGGTCTCAAGG - Intronic
1085394151 11:76198174-76198196 GTGACTTGCTCAAGGTCGCAAGG - Intronic
1085439105 11:76541575-76541597 GTGACCTCTTCAAATTCACTTGG + Intronic
1085510035 11:77083493-77083515 GTGACCTGCCCAAGCTCCCCTGG - Intronic
1085770107 11:79317625-79317647 GTGACCTGCTCAAGGTCATATGG + Intronic
1087008456 11:93491550-93491572 GTAACTTGCTCAGGACCACTAGG + Intronic
1089270609 11:117299376-117299398 GTGATCTGCTCAAGGTGACAGGG - Intronic
1089529585 11:119117828-119117850 GTTGCCTGCTCAAGATCACTTGG - Exonic
1089685871 11:120146567-120146589 GTAACCTGCCCAAGGTCACAAGG + Intronic
1090405605 11:126474374-126474396 GTGACTGGCTCAAGGTCACATGG + Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092225474 12:6745531-6745553 GGGAGCTGTTCAAGATCAGTAGG + Intergenic
1092225636 12:6746516-6746538 GTGACCTGCCCAAGACCACAAGG + Intergenic
1095254028 12:40012607-40012629 CTTACCTGCTAAAGATCACCAGG + Intronic
1095540047 12:43299232-43299254 GTAACTTGCTCAAGGTCATTCGG + Intergenic
1096127042 12:49127405-49127427 ATGACCAGCCAAAGATCACTTGG + Intergenic
1096244788 12:49978399-49978421 TTGACTTGCTCAAGGTCACCTGG + Intronic
1096944069 12:55384275-55384297 GTGATCTATTCAAGATTACTCGG + Intergenic
1098595474 12:72270061-72270083 GTGACCTGCTGAGGATCGCAGGG + Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1100764112 12:97844474-97844496 GTGACTTGCCCAGTATCACTTGG - Intergenic
1100779503 12:98009105-98009127 GTGAACTGCCTAGGATCACTGGG - Intergenic
1101210461 12:102530412-102530434 GTGACTTGCCTAAGATCACAAGG + Intergenic
1101241894 12:102847209-102847231 GTGACTTGCTCATGATCACAGGG + Intronic
1101718188 12:107329298-107329320 CTGACTTGCCCAAGATCACCTGG - Intronic
1101841960 12:108334071-108334093 GTGACATTCCCAAGATCATTTGG - Intronic
1101985462 12:109442623-109442645 GTGACCTGCCCAGGATCTCACGG - Intronic
1102024072 12:109703568-109703590 GGGACCTGCCCAAGGTCACGTGG + Intergenic
1102193435 12:111006766-111006788 GTGATTTGCCCAAGATCACATGG - Intergenic
1102302616 12:111781719-111781741 GTGACTTACCCAAGGTCACTTGG + Intronic
1102396484 12:112590383-112590405 AGGACCTGCTCAAGGTCACTGGG - Intronic
1102638401 12:114344791-114344813 GTGACTTGCTCAAGGTCATAGGG - Intergenic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102980562 12:117237734-117237756 GTGAACTGCTCAAGGTAACAAGG + Intronic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1104360921 12:128132509-128132531 GTGGCCTGTCCAAGATCACACGG + Intergenic
1107018034 13:35724013-35724035 GTGACTAGTTCAAGGTCACTTGG + Intergenic
1109076219 13:57839094-57839116 GTAACTTGCCCATGATCACTTGG + Intergenic
1109168739 13:59069485-59069507 GTGGCCTGCTCCAAATCACAAGG + Intergenic
1109716024 13:66223471-66223493 GTAACCTGTCCAAGATCACATGG - Intergenic
1110973897 13:81805055-81805077 GTAACTTGCCCAAGGTCACTGGG - Intergenic
1111048783 13:82850988-82851010 GTGACAAACTCAAGATCAATAGG + Intergenic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1113667919 13:112153804-112153826 CTCACCTGCCCAAGGTCACTAGG - Intergenic
1113833009 13:113311683-113311705 CTACCCTGCTCAAGATCACAGGG - Intronic
1114576935 14:23724002-23724024 GTTAGGTGCTCAAGAGCACTTGG + Intergenic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1115110659 14:29817656-29817678 GTAACCTGCGGGAGATCACTAGG + Intronic
1115199972 14:30842800-30842822 ATTACTTGCTCAAGATCACATGG + Intergenic
1115667425 14:35567524-35567546 GTGACTTGGCCAAGATCACAAGG + Intronic
1117457597 14:55913473-55913495 GTGACTTGCCCAAGATCTCACGG + Intergenic
1118595184 14:67429957-67429979 GTAACTTCCTCAAGATCACGTGG + Intergenic
1118920919 14:70149380-70149402 GGGTCTTGCTCCAGATCACTTGG + Intronic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120737302 14:88067087-88067109 GTGACTTGCTCAAGATTACTAGG - Intergenic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1121033148 14:90676392-90676414 GTGACTGGCCCAAGATCACATGG + Intronic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121429245 14:93875060-93875082 GTGACCTCCCCAAGGTCACATGG - Intergenic
1121535376 14:94687111-94687133 GTGACTTCCTCAAGGTCACACGG + Intergenic
1121572409 14:94956856-94956878 GTGATCGGCCCAAGGTCACTCGG + Intergenic
1121911689 14:97797647-97797669 GAGACTTGTTCAAGATTACTTGG + Intergenic
1122016413 14:98800575-98800597 GTGACTTGTTCAAGATCTCAAGG - Intergenic
1122024849 14:98868192-98868214 GTGACTTTCTCAAGATCATGTGG - Intergenic
1122145254 14:99684840-99684862 GTCACCTGCCCAAGGTCACACGG + Intronic
1124848333 15:33311985-33312007 GCGACTTGCTCAAGGTCACTTGG - Intronic
1125173485 15:36793422-36793444 GTGACTTGCTTAAGATAACACGG - Intronic
1125423117 15:39524536-39524558 GTGACTTGCCCTAGATCACCTGG + Intergenic
1125933672 15:43617272-43617294 GTAACCTGCTCAAGGTCATATGG + Intronic
1125946770 15:43716734-43716756 GTAACCTGCTCAAGGTCATATGG + Intergenic
1126699680 15:51356661-51356683 GTGACCTGCCGAAGGTCACACGG - Intronic
1127969208 15:63945681-63945703 GTGGCCTGCTTAAGCTCACATGG - Intronic
1128232610 15:66046163-66046185 GGGACCTGCTCCAGTTCACATGG + Intronic
1129577884 15:76771508-76771530 GTGACTTGTTCAAAATCATTTGG - Intronic
1129682669 15:77666639-77666661 GTTAGCTGCTCCAGATCACAAGG - Intronic
1130152701 15:81323755-81323777 GTGACTTGCCCAAGGTCACCTGG - Intronic
1131174851 15:90202989-90203011 GTAGCCTGCTCAAGGTCACATGG - Intronic
1131480179 15:92774053-92774075 ATGACTTCCTCAAGGTCACTCGG + Intronic
1132882042 16:2166711-2166733 TTCACCTGCACAAGACCACTGGG + Intronic
1132997664 16:2831604-2831626 GTAACGAGCTCAAGATCACAGGG + Intronic
1133654265 16:7844617-7844639 GTGACTTGCTCAATGTCACACGG + Intergenic
1134174333 16:11993626-11993648 GTAACTTGCTCATGATCACATGG + Intronic
1134179929 16:12039350-12039372 GTGACTTGCTCAAGGTCATTTGG + Intronic
1134372991 16:13643024-13643046 GTGAACTGCTCAAGGTCACATGG - Intergenic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134681281 16:16127568-16127590 GTTACTTGCCCAAGATCACATGG + Intronic
1135001907 16:18783830-18783852 GTGACTTGCCCAAGATCTCATGG + Intronic
1135306674 16:21373117-21373139 GTGACTTGCTCAAGGTCATTTGG + Intergenic
1135660323 16:24291041-24291063 GTGACATGCCCAAGGTCACCTGG - Intronic
1135924312 16:26679096-26679118 ATGACTTGCTCAAGGTCACAAGG - Intergenic
1135968640 16:27055964-27055986 GTCACTTGCCCAAGATCACATGG + Intergenic
1136062987 16:27739396-27739418 GTGACCAGCTCAAAAAAACTGGG + Intronic
1136303416 16:29352259-29352281 GTGACTTGCTCAAGGTCATTTGG + Intergenic
1136397677 16:30001892-30001914 GAGACCTGCTCAAGGCCACGTGG - Intronic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1137576135 16:49601558-49601580 GTGACTTGTTCAAGGTCACAAGG + Intronic
1137790023 16:51167066-51167088 ATGACCTGCCCAAGGTCACATGG - Intergenic
1137790637 16:51171870-51171892 GGGACTTGCTCAGGATCACATGG - Intergenic
1137816929 16:51407118-51407140 ATGACCTGCCCAAGGTCACATGG + Intergenic
1137829729 16:51532984-51533006 GTGACTTGCCTAAGATCACAGGG + Intergenic
1137933697 16:52612832-52612854 GTCACTTGCCCAAGGTCACTTGG - Intergenic
1138044409 16:53706005-53706027 GTGACTTGCCCAAGGCCACTTGG + Intronic
1138944598 16:61833043-61833065 GTGACCTGCCCACGATCACATGG - Intronic
1139182792 16:64767601-64767623 GTAACGTACCCAAGATCACTTGG + Intergenic
1139429442 16:66903388-66903410 TTGACTTGCCCAAGATCACGAGG + Intergenic
1139719973 16:68844331-68844353 GTAACCTGTCCAAGATCACGTGG + Intronic
1140200940 16:72894372-72894394 GTGACCTTCTCCACATCATTCGG + Intronic
1140378308 16:74463268-74463290 GTGACCTGCTCAAACTCCCAGGG - Intronic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140776466 16:78253463-78253485 GTACCCTGCTCAAGATCACTGGG + Intronic
1140822422 16:78675216-78675238 GTGACTCACTCAAGATCACGTGG + Intronic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141202657 16:81909906-81909928 GTGACCTGCTCCAGGACACTTGG + Intronic
1141470223 16:84233234-84233256 GTGACTTTCCCAAGATCACTGGG + Intronic
1141545617 16:84766250-84766272 GTGACTTGTTCAAGGTCACATGG - Intronic
1141978293 16:87532971-87532993 TGGACCTGCCCAAGATCACTCGG - Intergenic
1141984461 16:87570926-87570948 GGGACTTGCCCAAGGTCACTCGG - Intergenic
1143623215 17:8093035-8093057 GGGACTTGCTCAAGATCAGCTGG + Intergenic
1145783104 17:27576915-27576937 GTCACCTGCACGAGGTCACTAGG - Intronic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146667246 17:34713307-34713329 GTGACATGCTCAAGAGCACATGG - Intergenic
1146944921 17:36866983-36867005 GTGACTTGCTCAAGGTCCCTTGG - Intergenic
1147955799 17:44133680-44133702 GTGGCCTGCTCCTGATCTCTAGG - Intergenic
1148152267 17:45403860-45403882 GTGACTTGCTCAAGGTCCCTCGG - Intronic
1148222952 17:45877370-45877392 GTAAGCTGCTCATGATAACTGGG + Intergenic
1149035490 17:52129489-52129511 GTAACTTGCTTAAGATCACATGG + Intronic
1149445028 17:56706682-56706704 ATTACTTGCTCAAGATCACACGG + Intergenic
1150447639 17:65239639-65239661 GTGAAATGCTCAAGGCCACTTGG - Intergenic
1152021731 17:77783194-77783216 GGGAGCTGCCCAAGATGACTGGG - Intergenic
1152265666 17:79293225-79293247 GTGACCTGCTCAAGCCCACATGG + Intronic
1152997993 18:426055-426077 GTGACTTGTCCAAGATCACATGG + Intronic
1154102610 18:11489919-11489941 GTCACCTGCCCAAGATGCCTAGG + Intergenic
1155557915 18:27042268-27042290 GTGACTTGGTCAAGGTCACTTGG - Intronic
1157100320 18:44723461-44723483 GTGATTTGTTCAAGATCACATGG + Intronic
1157298218 18:46461183-46461205 GGGACTTGCTCAAGGTCATTGGG - Exonic
1158121865 18:54057231-54057253 GTGACCTACTCAAGTTGGCTTGG - Intergenic
1158308597 18:56134187-56134209 GTGGCTTGCTCAAAATCACATGG + Intergenic
1160233222 18:77064991-77065013 GTGACTTGCCCAAGACCACAGGG - Intronic
1160461242 18:79040386-79040408 AAAACCTGCTCAAGATCACATGG + Intergenic
1160595641 18:79972260-79972282 GTACCCTGCCCAAGGTCACTTGG + Exonic
1160806457 19:994274-994296 GCAACCTGCGCAAGATCAATCGG + Exonic
1163174622 19:15555803-15555825 GTGACTTACCCAAGATCATTCGG + Intergenic
1164573005 19:29387612-29387634 GTGACATGCTCAGGATCACATGG - Intergenic
1164836671 19:31359424-31359446 GTGACCTGCTCAGGCTCACTGGG - Intergenic
1165463502 19:35958645-35958667 GTGACTTGCCCAAGTTCACTTGG + Intergenic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
1166773491 19:45298407-45298429 GTGACTTGCTCAAGGTCACTTGG - Intronic
1168235836 19:55062782-55062804 GTCACCGGCCCAAGGTCACTCGG - Intronic
926383070 2:12310369-12310391 CTGACATGCACAAGATCACATGG - Intergenic
927070893 2:19528570-19528592 TTTACTTGCTCAAGATCACAGGG + Intergenic
927331103 2:21865420-21865442 ATGACTTGCTCAGGATCTCTGGG + Intergenic
927494814 2:23545307-23545329 GTGGCTTGCTCAAGGCCACTTGG - Intronic
927915656 2:26934447-26934469 GGGACCTGCCCAAGCTCACAGGG - Intronic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928113822 2:28530980-28531002 GTGACCTGTGCAAGTTCACACGG + Intronic
928279826 2:29935854-29935876 GAGACCTGCTCAACATCATCAGG - Intergenic
928395250 2:30938760-30938782 GTGACCTACTCAATAGCACATGG - Intronic
929324866 2:40597009-40597031 TTAGCCTGCTCAAGATCACATGG - Intronic
929598612 2:43191373-43191395 GTGACCTGCCCAAGGTCACTGGG + Intergenic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930842560 2:55863697-55863719 GTGACTTCCCCAAGATCTCTTGG + Intergenic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
931919380 2:66996607-66996629 GTGACATGGCCAAGATCACATGG + Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
934042183 2:88136738-88136760 CTGTCCTGCTCTAGATCACTGGG + Intergenic
934846640 2:97665088-97665110 GTAACCTGCCCAAGATTATTGGG + Intergenic
935585102 2:104793469-104793491 GTAATCTGCTGAAGATCACCTGG - Intergenic
936246082 2:110828710-110828732 GTCATTTGCTCAAGATCACATGG + Intronic
937379645 2:121365172-121365194 TGGAGCTGCTCAAGATCACGCGG - Exonic
938698878 2:133858823-133858845 GTGACCTGCTCCAGATCTATTGG - Intergenic
938979537 2:136513247-136513269 GTGACTTGTTCAAGATCACATGG - Intergenic
939730000 2:145772209-145772231 TTGACCTGCTCAATCCCACTTGG + Intergenic
940436417 2:153661326-153661348 CTCAGCTGCTCAAAATCACTGGG + Intergenic
940722068 2:157293036-157293058 GTGGCCTGCTAAAGTCCACTTGG - Intronic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
941351826 2:164447505-164447527 GTAAACTGCTCAAGGTCACAAGG + Intergenic
943080210 2:183250943-183250965 CTGACCTCCTCAAGTTCACCTGG - Intergenic
945109784 2:206351163-206351185 GTTACCTTCTCAAGATCATAGGG + Intergenic
945314111 2:208352074-208352096 GCAACTTGCTCAAGATCACTTGG - Intronic
945414199 2:209550936-209550958 GTGACCTCCTCAATGTGACTGGG - Intronic
945503459 2:210607673-210607695 GTGATGTGCTCAAAATCACACGG - Intronic
945922213 2:215766595-215766617 GTGATCTGCTCAAGATCTCTTGG - Intergenic
946458119 2:219845639-219845661 ATGACCTGCCCAAGGTCACATGG - Intergenic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
946949721 2:224860520-224860542 GTAACTTGCCCAAGCTCACTTGG + Intronic
948356927 2:237385515-237385537 ATGACCTGCCCAGGATCACATGG + Intronic
948378877 2:237539775-237539797 GTGACCTGCCGAAGGTCACATGG + Intronic
948469050 2:238165760-238165782 GTTAGATGCTCAGGATCACTGGG + Intronic
948648246 2:239422512-239422534 CTGAATTGCTCAAGACCACTGGG - Intergenic
1168891431 20:1297373-1297395 ATGATCTGCTCAAGGTCACACGG - Intronic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1168991628 20:2101513-2101535 ATGATTTGCACAAGATCACTGGG + Intergenic
1169304356 20:4475477-4475499 GTGAGCTGCCCAAGGTCACTAGG - Intergenic
1170568703 20:17621031-17621053 GTGACCTGCACAGGACCACTAGG + Intronic
1170585361 20:17730265-17730287 GTGGATTGCTCAAGATCACATGG + Intronic
1172239217 20:33401227-33401249 GTGACCTGTCCAAGGTCACACGG + Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1173813474 20:45970546-45970568 GTAGCTTGCTCAAGATCACACGG + Intronic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174657093 20:52180812-52180834 GTAACCTGCCCAAGGTCACATGG + Intronic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175682182 20:60997049-60997071 GTGACCTGCTGAAGCTCATGGGG - Intergenic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
1175954114 20:62599563-62599585 GTGGCCTGCCCAGGACCACTGGG + Intergenic
1177613687 21:23489095-23489117 GTGACCTGCCTAAGGTCATTTGG - Intergenic
1178465972 21:32847927-32847949 GAGACCTGCCCATGGTCACTGGG + Intergenic
1179131103 21:38638174-38638196 GTGACTTGCTCAAGGTCCCATGG - Intronic
1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG + Intronic
1179568300 21:42262756-42262778 ATGACCTGCTCAAGGTCACACGG - Intronic
1180927898 22:19568681-19568703 GTGAACTGGTCAAGATGACTTGG - Intergenic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1181935546 22:26435870-26435892 GTGACCTGCTCAAAGTCTCACGG - Intronic
1182081998 22:27536217-27536239 GTGACTTGGCCAAGGTCACTTGG - Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182310149 22:29398580-29398602 GTGACTTGCTCAGGGTCACACGG - Intronic
1182723540 22:32424205-32424227 GTAACTTGCTTAAGGTCACTAGG + Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183304302 22:37074127-37074149 GTGACTTGTCCAAGGTCACTTGG + Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183769088 22:39908040-39908062 GTGACTTGTTTAAGATCACGTGG - Intronic
1184271494 22:43387073-43387095 GTGACCTGCCCAAGGGCACAAGG + Intergenic
1184508398 22:44917801-44917823 GTGACCTGCCCAAGGCCACAGGG - Intronic
1184958626 22:47912103-47912125 GTGACCTGAGCAAGACCACGTGG + Intergenic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
949197112 3:1324843-1324865 GTAACCTGTTCAAGATGACATGG - Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950206843 3:11087291-11087313 GTGACTTGCTCAGGTTCACATGG + Intergenic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
950897908 3:16469974-16469996 GTGACTTGCTCAAGGTCATGGGG + Intronic
951012919 3:17701266-17701288 GGGACCTGAACGAGATCACTTGG + Intronic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
953750012 3:45601718-45601740 GTGACTTGCTCAAGACCATATGG + Intronic
954423057 3:50428745-50428767 GGGACTTGCCCAAGGTCACTAGG + Intronic
955137934 3:56238440-56238462 ATGACCTGCTCAAGCTCCCCAGG - Intronic
955697325 3:61649802-61649824 GTTACTTGCTCAAGATCATGTGG + Intronic
955981699 3:64533811-64533833 TTGGCCTGCTCAAGACCACCTGG + Intronic
959943090 3:112099953-112099975 GTGACTTGCTCAAGGTCACCTGG + Intronic
960356539 3:116660584-116660606 GTAACTTACTCAAGGTCACTTGG + Intronic
961379875 3:126490056-126490078 GTGACCTGCCCAAGGTCTCATGG - Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961637895 3:128344525-128344547 GTGACCTGCCCAAGGTCACAGGG + Intronic
961658783 3:128457472-128457494 GAGACGTGCTCAAGGTCACAGGG - Intergenic
962267267 3:133952819-133952841 GTTACTTGCCTAAGATCACTTGG + Intronic
964519107 3:157543907-157543929 GTGACTTGCCCAAGATCATAAGG - Intronic
964650165 3:159002745-159002767 GTGACTTGCCCAAGGTCATTGGG + Intronic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
967290734 3:187917368-187917390 GTGCCTTGCACAAGGTCACTTGG - Intergenic
967633633 3:191776176-191776198 GTGACATGCTTCAGATCACTGGG + Intergenic
967674806 3:192284270-192284292 GTGACATGCTGATGATCACAGGG + Intronic
967970332 3:194994629-194994651 GTGACTTGCTCAAAGTCACACGG - Intergenic
967976830 3:195040224-195040246 GTGACTTGCCCAAGGTCACGCGG + Intergenic
968045279 3:195620481-195620503 GGGACTTGCCCAAGGTCACTCGG - Intergenic
968061134 3:195726824-195726846 GGGACTTGCCCAAGGTCACTCGG - Intronic
968228568 3:196991035-196991057 GTAACTTGCCCAAGATCACTCGG - Intronic
969292800 4:6251594-6251616 GTGACTTGCCCAAGGTCACCTGG - Intergenic
969320704 4:6410718-6410740 GTGACCTGGCCAGGCTCACTGGG - Intronic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
972356405 4:38283052-38283074 GAAGCCTGGTCAAGATCACTAGG - Intergenic
972763885 4:42133502-42133524 GTAACCTGCCCAGGATCACATGG - Intronic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
975691994 4:76974506-76974528 GTGACCTGCTTAAGACCCATAGG + Intronic
979513892 4:121584959-121584981 GAAACTTGCTCAAGGTCACTTGG - Intergenic
981572018 4:146161834-146161856 GTAATTTGCTCAAGATCACATGG - Intergenic
983381077 4:166994362-166994384 GTAACCTGTCCAAGATCACATGG + Intronic
984748720 4:183251049-183251071 GTGACTTGTTCAAGCTCACATGG - Intronic
985965720 5:3337859-3337881 TTGTTCTGCTCAAGATCACGTGG - Intergenic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
986679187 5:10218002-10218024 GTGACCTGCACCAGTTCACATGG - Intergenic
988093878 5:26577103-26577125 GGGACTTGCTCAACATCACAGGG - Intergenic
990382346 5:55230024-55230046 GTGACTTGCTTAAGGTCACCTGG + Intergenic
992197795 5:74356998-74357020 GTGAGGTTCTCAAGATCTCTTGG - Intergenic
993456487 5:88132956-88132978 GTAACTTGCCCAAGATCACTTGG - Intergenic
993523624 5:88937109-88937131 GCAAACTGCCCAAGATCACTTGG + Intergenic
995542394 5:113197777-113197799 GTAATCTGCTCAAGGTCACAGGG + Intronic
996032738 5:118724069-118724091 GTGGCTTGCCCAAGATCACTTGG - Intergenic
996810232 5:127508296-127508318 GTGGACTGGTGAAGATCACTGGG + Intergenic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
997752373 5:136358675-136358697 GGGACCTGCTCAAGGTCTCAAGG - Intronic
998164206 5:139833269-139833291 GTGACATGCCCACGATCACAAGG - Intronic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
998861621 5:146449455-146449477 GTGACTTACACAAGGTCACTGGG + Intronic
999238075 5:150111717-150111739 GTGACTTGCCCAAGATCATCTGG - Intronic
1000899643 5:166897013-166897035 GTGACCCGCCCAAGGTCACAAGG + Intergenic
1001181966 5:169528859-169528881 GTGGCCTGCTCATGATCTCTGGG + Intergenic
1001217880 5:169872802-169872824 GTGATCTGCCCAAGATCCCAGGG - Intronic
1001694680 5:173661128-173661150 GCGACTTGCTCAAGATCATGTGG + Intergenic
1001954189 5:175837152-175837174 GTGACCTGGTCAAGGTCACAGGG + Intronic
1002069293 5:176669909-176669931 GTGGCCTGCTGAATATCACATGG + Intergenic
1003771891 6:9313897-9313919 GTAATCTGCTGAAGATCACAAGG + Intergenic
1004087989 6:12470849-12470871 GGGATTTGCTCAGGATCACTCGG - Intergenic
1004484250 6:16050890-16050912 GTGTGCTGTTCAAGATCACCTGG - Intergenic
1004841877 6:19596769-19596791 ATGACCTTCTCCAGATCACGGGG - Intergenic
1006215833 6:32441915-32441937 ATAATCTGCTCAGGATCACTAGG + Intronic
1006431775 6:34001735-34001757 GTGACTTGCTCAAGGTCTCATGG + Intergenic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1008506362 6:52234678-52234700 GCGACTTGCTCAAGGTCACTTGG - Intergenic
1009403203 6:63280528-63280550 CTGAGCAGCTCACGATCACTGGG - Exonic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1018264171 6:162003693-162003715 TTGACCTGTTAAAGATCAATTGG + Intronic
1018345009 6:162891285-162891307 TTCCCCTTCTCAAGATCACTTGG - Intronic
1018409022 6:163522385-163522407 GTGAGTTGCTCAAGATTACAGGG + Intronic
1018662754 6:166103344-166103366 GTGCACTGCTCAGGATCACAAGG + Intergenic
1019303820 7:322836-322858 GTCTCCTGCTCAACATCCCTGGG - Intergenic
1020040071 7:4995287-4995309 GTGACTTGCTCTGGGTCACTGGG + Intronic
1020708168 7:11571551-11571573 GTAACCTGTCCAAGATCACATGG + Intronic
1022171454 7:27836028-27836050 GTGACTTGGCCAAGATCACATGG + Intronic
1022799361 7:33761097-33761119 GTCACTTCCTCAAGATCACATGG + Intergenic
1022882255 7:34600326-34600348 GTGACTTGTCCTAGATCACTAGG + Intergenic
1023254995 7:38304504-38304526 GTGCCCTGCTCAAAGTCACTTGG - Intergenic
1023700768 7:42889945-42889967 GTTACCTGCTCAAGATTACATGG - Intergenic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1027162429 7:75812479-75812501 GTAACTTGCTCAAGGTCACGTGG - Intronic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1031829683 7:126611247-126611269 TTAACCTGCTCGAGGTCACTAGG - Intronic
1031927654 7:127653085-127653107 GTGACTTGCTTAAGGTCACATGG + Intronic
1032382633 7:131500906-131500928 GTGACTTCCTCAAAATCACATGG - Intronic
1032637668 7:133727616-133727638 GTCACCTGCTCACTATCACTAGG + Intronic
1032710840 7:134458902-134458924 GCGAGCTGCTCAGGGTCACTCGG + Intronic
1033662888 7:143414870-143414892 GTGATTTGCCCAAGATCACTTGG - Intergenic
1034412569 7:150948943-150948965 GTGACCTACACAAGATCCATCGG - Exonic
1034550887 7:151819960-151819982 GTGACGTGCCCAAGGTCACATGG + Intronic
1035872424 8:3150268-3150290 GTGGCCTCCTACAGATCACTGGG + Intronic
1036442547 8:8794221-8794243 GTGACCTGCTTAAGTTACCTCGG + Intronic
1036492918 8:9244415-9244437 GTGATTTGCCCAAGATCACACGG - Intergenic
1037438281 8:18887983-18888005 GTGACTTGTCCAAGATCACACGG + Intronic
1037666420 8:20973811-20973833 GAGGCCTGCTCAAGAGCATTTGG + Intergenic
1038009210 8:23460776-23460798 TTGTCCTGCTCAATCTCACTAGG - Intergenic
1038024731 8:23578219-23578241 GTGGCCTGCTGGAGATCTCTTGG + Intergenic
1039952246 8:42181478-42181500 GTGGCCTGCCCAAGCTCGCTGGG - Intronic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1041625564 8:60022318-60022340 GTAGCCTGCTAAAAATCACTCGG - Intergenic
1042079246 8:65032196-65032218 ATGACCTGCTCAAGTCCACGGGG - Intergenic
1042636127 8:70877460-70877482 GTGATTTACTCAAGATCACTTGG + Intergenic
1045664732 8:104471954-104471976 GTGATTTGCCCAAGATCACATGG + Intergenic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1046603219 8:116341539-116341561 GTGGCTTGCCCAAGTTCACTGGG - Intergenic
1047837786 8:128713161-128713183 GTGACTTTTTCAAGGTCACTTGG - Intergenic
1048009049 8:130442299-130442321 CTGACTTGCCCAAGATCACATGG - Intronic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1048851129 8:138646458-138646480 GTGACCTGCCCATGGTCAATAGG + Intronic
1049034908 8:140067658-140067680 GTGACTTGATCAAGGTCACAGGG + Intronic
1050369271 9:4903904-4903926 GTGACCTGCTCTCTAACACTAGG - Intergenic
1050442192 9:5676532-5676554 GTAACCTGCTCAAGAATACATGG + Intronic
1052036984 9:23693895-23693917 GTGGCTTGCTCAAGACCACAGGG + Intronic
1052220074 9:26010107-26010129 GTTACCTGCTCAAAATCAAAGGG - Intergenic
1053293083 9:36894926-36894948 GTCACCTGCCCAAGGTCACACGG - Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1056184566 9:84120950-84120972 GTAACCTGCCCAAGATCTCACGG - Intergenic
1056375542 9:86006397-86006419 CTGACCAGCTCAAGAACATTTGG - Intronic
1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG + Intergenic
1056886515 9:90448689-90448711 GGGAGCTGCTCATGACCACTGGG - Intergenic
1057056113 9:91962238-91962260 GTCATCTGCTCAAGATCAACAGG + Intergenic
1057329520 9:94100192-94100214 GTGACTTGCTCAGGGTCACGTGG + Intronic
1057691781 9:97292340-97292362 GTGACCTTCCCAAGACCACATGG - Intergenic
1057802961 9:98201096-98201118 GGGACCTGCCCAAGGTCTCTGGG + Intronic
1058533880 9:105934435-105934457 GTGACTTGCTCAAGGTCATATGG + Intergenic
1058886791 9:109327721-109327743 GTACCCTCCTCAAGATCACCAGG - Intergenic
1059073271 9:111162771-111162793 GTTAACAGCTCAAGGTCACTAGG - Intergenic
1059303914 9:113339303-113339325 GTGACTTGCTGAAGGTCACAGGG + Intronic
1059659389 9:116386547-116386569 GGGACTTGCCCAAGTTCACTTGG + Intronic
1060152322 9:121296606-121296628 GTGACTTGCCCAAGGTCACCAGG + Intronic
1060451773 9:123749472-123749494 GTGACTTGCCCAAGATCTCAAGG - Intronic
1060730867 9:126036185-126036207 GTGACCTGCCCACGGTCACCTGG + Intergenic
1060880604 9:127115545-127115567 GTCGCTTGTTCAAGATCACTTGG + Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061249411 9:129417674-129417696 GTGATCTGCCCAAGGTCACCTGG - Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061818237 9:133208594-133208616 TTGGCCTGCTCCAGATCACAGGG - Exonic
1062021835 9:134323231-134323253 GTGACCAGCTCAGGACCACAGGG + Intronic
1062242219 9:135546764-135546786 TTGGCCTGCTCCAGATCACAGGG + Exonic
1187104711 X:16229399-16229421 GTGACTTCCTCAAGGTCACATGG - Intergenic
1187118369 X:16377003-16377025 ATGTGCTGCTCAAGATGACTTGG - Intergenic
1187435567 X:19265754-19265776 GAGACCTGCTCAAGCTCACATGG - Intergenic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1191668977 X:63731516-63731538 GGGACCTGTCCAAGATCATTTGG - Intronic
1191678414 X:63815839-63815861 CTGACTTGCCCAAGGTCACTGGG + Intergenic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1192154498 X:68733735-68733757 GAGACGTGCCCAAGGTCACTAGG + Intergenic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1195086531 X:101418641-101418663 GGGACCGGCCCGAGATCACTCGG - Intronic
1195387541 X:104327200-104327222 GTAACATGCCCAAGGTCACTTGG + Intergenic
1197291393 X:124662681-124662703 ATGTACTCCTCAAGATCACTAGG + Intronic
1197714050 X:129693529-129693551 GTGACCTGCCTAAGGTCACACGG - Intergenic
1197958366 X:131977474-131977496 TTGATTTGCTCAAGATCACATGG + Intergenic
1198523119 X:137472783-137472805 GGGACATGCTCAAGGTCACACGG - Intergenic
1199088037 X:143651694-143651716 GTGATTTGCTCAAGGTCACATGG + Intergenic
1199297280 X:146173542-146173564 GGAACCTGCTCAAGGCCACTAGG - Intergenic
1199665656 X:150094566-150094588 GTAACTTGCCCAAGATCTCTTGG - Intergenic
1199971455 X:152864855-152864877 TTGAGTTGCTTAAGATCACTGGG + Intronic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic