ID: 902218312

View in Genome Browser
Species Human (GRCh38)
Location 1:14948708-14948730
Sequence CAGAGAAAGCAGTAGCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 371}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902218312 Original CRISPR CAGAGAAAGCAGTAGCATGG AGG Intronic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
901924687 1:12558630-12558652 CAGAGACAGAAGTAGATTGGGGG + Intergenic
902190193 1:14757288-14757310 AAGAGAAAGCAGGAGCAGGCAGG - Intronic
902218312 1:14948708-14948730 CAGAGAAAGCAGTAGCATGGAGG + Intronic
903779360 1:25811490-25811512 CAGTGAAAGCAGCAACATGGAGG + Exonic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
905243966 1:36599586-36599608 GAGAATAAGCAGTAGCATGTGGG - Intergenic
905721067 1:40202488-40202510 TTGATAAAGCAGTAGCCTGGGGG - Exonic
907928667 1:58978835-58978857 AACAGAAAGCAGTAGGATGGGGG + Intergenic
908070533 1:60455089-60455111 CAGTGGCAGCAGTTGCATGGAGG - Intergenic
908724154 1:67157091-67157113 GAGAGAGAGCAGAAGCAGGGTGG - Intronic
910211769 1:84800735-84800757 CAGACCAAGAAATAGCATGGGGG + Intergenic
910895584 1:92066215-92066237 CAGAAAAAGCAGTTGGATGTGGG + Intergenic
911758743 1:101591408-101591430 CAGAGAAAACAGTTGAATGAAGG - Intergenic
913196344 1:116459439-116459461 AAGAGATAGAAGTAGAATGGTGG + Intergenic
913235890 1:116782833-116782855 AATAGAAAGGAGTAGCATGCGGG + Intergenic
914442740 1:147721579-147721601 CAGATAAATTAGCAGCATGGAGG + Intergenic
914457305 1:147847890-147847912 CAAAGAAAGTGGTAGCATGGTGG - Intergenic
914915635 1:151817540-151817562 CAGAGAAAGCAGCTGCAGAGGGG + Intronic
915171141 1:153977896-153977918 CAGAGAAACCAGAAGCTTGACGG - Intergenic
915903897 1:159864304-159864326 AGGAGAAAGCAGTAACATTGTGG + Intronic
916215374 1:162389106-162389128 CAGTGCAAACAGTAGCAGGGAGG - Intergenic
917620633 1:176792039-176792061 CAGAGAATGAAGTAGAATGGAGG - Intronic
918224580 1:182469964-182469986 TAGAGAAAGAAGTAGAATGGTGG + Intronic
918490573 1:185077162-185077184 AATAAAAAGCAGTAACATGGTGG - Intronic
919981426 1:202644594-202644616 AACAGAAAGCAGCTGCATGGAGG - Intronic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921399085 1:214700614-214700636 CAGAGGAAACAGTCGCAGGGTGG - Intergenic
923791871 1:237118525-237118547 CAGAGACAACGGTAGAATGGTGG + Intronic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1067266516 10:44750077-44750099 CAGAGAAAGCAGAAAAATTGGGG - Intergenic
1067664818 10:48268679-48268701 CAGAGATAGTAGAAGCAGGGTGG + Intronic
1070006547 10:72429725-72429747 TATAGAAATCAGTATCATGGAGG - Intronic
1070843649 10:79505200-79505222 CAGCGTGAGCAGGAGCATGGAGG - Intergenic
1070843663 10:79505283-79505305 AAGAGAAAGCTGAAGCAGGGAGG - Intergenic
1070930003 10:80254317-80254339 AAGAGAAAGCTGAAGCAGGGAGG + Intergenic
1070930017 10:80254400-80254422 CAGCGTGAGCAGGAGCATGGAGG + Intergenic
1072038951 10:91589827-91589849 CAGAGTAAGGAGTGGCCTGGTGG + Intergenic
1072530236 10:96312125-96312147 CAGAGAAACGAGTACCATGTTGG + Intronic
1072861297 10:99007807-99007829 CTGAGAAAGCAGGAGCAGTGAGG + Intronic
1073302068 10:102476890-102476912 CAGAGAAACCACTAGAAGGGTGG - Exonic
1073978070 10:109122860-109122882 CAGATAGAGCAGAAGCATGGTGG + Intergenic
1074993300 10:118731707-118731729 TCTATAAAGCAGTAGCATGGAGG + Intronic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075867042 10:125732259-125732281 CAGATAAAGCGTTAGCAAGGCGG + Intronic
1076314056 10:129528453-129528475 AGGAGACAGCAGTAGCACGGAGG + Intronic
1077117162 11:890359-890381 CAGAGAAAGGTGACGCATGGGGG - Intronic
1078570565 11:12454050-12454072 CAGAGAAGACAGTAACTTGGGGG + Intronic
1079011805 11:16834715-16834737 CAGAAAAGGCAGTATTATGGCGG + Intronic
1079119950 11:17674913-17674935 CAGAGAAAGAAGAAGCCTGGAGG + Intergenic
1079541626 11:21582971-21582993 GTGAGAAAGCAGTAGCAGGATGG - Intergenic
1079738620 11:24029648-24029670 CAGAGGAAGCAGGAGTATGTGGG - Intergenic
1079796055 11:24804754-24804776 AAGAGAAAGCAGAAGCAAGAGGG - Intronic
1079909692 11:26294322-26294344 TATAGAAAGCAGTAGCACAGTGG - Intergenic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081415126 11:42805593-42805615 TAGAGACAGAAGTAGAATGGTGG + Intergenic
1082922179 11:58507664-58507686 CATAGGAACCAGTAGCAAGGAGG + Exonic
1083715406 11:64572407-64572429 CACAGATATCAGTGGCATGGAGG - Exonic
1085578119 11:77625587-77625609 AAGAAAAAGCAATAGAATGGAGG + Intronic
1087048463 11:93864096-93864118 CAGAGGAAGAAGTAGCCTTGGGG + Intergenic
1087185223 11:95184263-95184285 GAGGGAAAGCAATAGCATGAGGG + Intronic
1087831140 11:102820880-102820902 CAGAGAAGGCAGAGGGATGGGGG - Intergenic
1088913099 11:114206872-114206894 CAGACAGAGAAGTAACATGGGGG - Intronic
1089129552 11:116201008-116201030 CCGGGAGAGCAGAAGCATGGAGG + Intergenic
1089675906 11:120089046-120089068 CAGAGAGAGAATTAGCAGGGAGG - Intergenic
1089702258 11:120252539-120252561 CACAGAAAGCAGAAACAAGGTGG - Intronic
1091638663 12:2217214-2217236 TAGAGACAGAAGTAGAATGGTGG + Intronic
1091837701 12:3597234-3597256 CAGAGAAAGCCCTAGCATGCGGG + Intergenic
1092156225 12:6283390-6283412 CAGAGACAGAAGTAGAATGGCGG + Intergenic
1093532076 12:20177474-20177496 CAGAGAAAGCAGTTACACTGAGG - Intergenic
1093692275 12:22121871-22121893 CAGAGAAAGAAGGAAGATGGGGG - Intronic
1093700069 12:22210326-22210348 CAGGGATAGCAGTGGTATGGAGG + Intronic
1093910955 12:24746965-24746987 CAAAGAAAGCAGGCACATGGAGG + Intergenic
1094448949 12:30563501-30563523 CAGCAAAAGCAGTAGTAAGGAGG + Intergenic
1096530694 12:52241101-52241123 CAGAGTATTCTGTAGCATGGTGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098467080 12:70799856-70799878 CAGAGAGAGCAGCAGCAGGTAGG + Intronic
1098811182 12:75095193-75095215 AGATGAAAGCAGTAGCATGGTGG - Intronic
1098840077 12:75467402-75467424 TAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1099204507 12:79711896-79711918 AAGAGTAAGCAATAGCAAGGTGG - Intergenic
1099882519 12:88483909-88483931 CAGCAAAAGCAGTAGTAAGGGGG + Intergenic
1102648369 12:114418580-114418602 CAGAGGAGGCAGTTGCAAGGGGG - Intergenic
1104200840 12:126587214-126587236 TAGAGACAGAAGTAGAATGGTGG + Intergenic
1104477083 12:129079589-129079611 TCGAGAAAGCAGGAGAATGGAGG - Intronic
1106063330 13:26317784-26317806 CAGCAAAAGCAGTAGTAAGGGGG + Intronic
1106928878 13:34641819-34641841 AAGAGAAAGCAGGCGCAGGGTGG + Intergenic
1107289913 13:38840250-38840272 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1107362001 13:39628947-39628969 TAGTGAAAGCAGTAGTAAGGAGG - Intergenic
1107791762 13:44009402-44009424 CATAGAAAGCAGGTGCATAGTGG + Intergenic
1107938441 13:45364280-45364302 TGGAGAAAGCAGGAGCAGGGAGG - Intergenic
1108484910 13:50913731-50913753 CACAGAAAGCAGTTTCATGGAGG + Intronic
1108707472 13:53002668-53002690 CAAAGAAAGCAGTGGCAGGCAGG - Intergenic
1111471677 13:88691635-88691657 CATTGAAAGTAATAGCATGGTGG - Intergenic
1111944482 13:94649450-94649472 CAGAGAATCCATTAGCATTGGGG - Intergenic
1113277934 13:108754076-108754098 CAGAACAAGCTGTAGCATGCAGG + Intronic
1114682731 14:24499958-24499980 CATAGAAATAAGTAGAATGGTGG - Intergenic
1115214667 14:31002798-31002820 GACAGAAAGTAGTAGAATGGTGG + Intronic
1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG + Intronic
1117710620 14:58525405-58525427 GAGAGCAAGCAGAAGCAGGGTGG + Intronic
1119532423 14:75372235-75372257 CAGAGAAGGGCGTACCATGGAGG - Intergenic
1119678847 14:76576710-76576732 CAGAGATAGCAATAGCCTGGTGG + Intergenic
1120428882 14:84388439-84388461 CAAAGAAAAGAGTAGAATGGCGG + Intergenic
1120522751 14:85543822-85543844 CAGAGAAAGGAGTAACCAGGAGG - Intronic
1120554981 14:85918632-85918654 AAGAGAAAGCGGAAGGATGGAGG + Intergenic
1120605981 14:86578606-86578628 CATTGAAAGCAATAACATGGAGG - Intergenic
1120993652 14:90398426-90398448 CAGAGAAAGCAGAAACGTGGAGG - Intronic
1121787927 14:96676660-96676682 GAGAGCAAGCAGTAGCATGCAGG - Intergenic
1122149906 14:99719592-99719614 CAGAGACAGAAGTGGAATGGTGG - Intronic
1122280702 14:100620635-100620657 CAGAGAATGCAGCAGAGTGGTGG + Intergenic
1124061377 15:26296626-26296648 AGGAAAAAGCTGTAGCATGGGGG + Intergenic
1124118591 15:26868736-26868758 CAGAGAGAGGAGTAGCTTGCTGG + Exonic
1124232456 15:27957006-27957028 CAGAAGAAGCAGGAGCCTGGTGG - Intronic
1124497117 15:30193329-30193351 AACAGAAAGCAGCTGCATGGAGG - Intergenic
1124746459 15:32345318-32345340 AACAGAAAGCAGCTGCATGGAGG + Intergenic
1124968894 15:34464780-34464802 CAAAGATAGCAGTAACATTGAGG + Intergenic
1125499266 15:40228319-40228341 CAAAGCAAACACTAGCATGGTGG + Intergenic
1126706704 15:51413048-51413070 CAGATAAAGCAATAACAAGGTGG - Intergenic
1127280877 15:57491373-57491395 CGGAGAAAGCAGTGGCACTGTGG - Intronic
1127830297 15:62744275-62744297 GAAAGAAAGCAGTACCAGGGCGG - Intronic
1127862048 15:63002607-63002629 CAGTTAAAGAAGTAGCATTGGGG - Intergenic
1129273060 15:74429434-74429456 CAGAGATGGAAGGAGCATGGAGG - Intronic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129320097 15:74769953-74769975 AAGTGAAAGCAGAAGCAAGGGGG - Intergenic
1129391963 15:75225174-75225196 CAGAGGGAGCAGCAGCATGAGGG + Intergenic
1129472413 15:75762988-75763010 CAGAGGGAGCAGCAGCATGAGGG - Intergenic
1130109758 15:80954474-80954496 CAGGGAAAGGAGTAGGATGTGGG + Intronic
1130894923 15:88162511-88162533 GAAAGAAAACAGGAGCATGGAGG + Intronic
1131808269 15:96146122-96146144 CAGAGGAAGCAGAAGCAAAGGGG - Intergenic
1131842309 15:96450415-96450437 AAGAGAAGGCAGTAGGATGGGGG - Intergenic
1132892001 16:2209176-2209198 CAGAGAACACACTAGCTTGGGGG - Exonic
1133107311 16:3520889-3520911 GAGAAAGAGCAGAAGCATGGGGG - Intronic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1134423304 16:14114559-14114581 CAGAGCCAGCACAAGCATGGTGG - Intronic
1134880282 16:17740148-17740170 CAGAGTAAGGATTTGCATGGAGG + Intergenic
1135328147 16:21540774-21540796 CAGAGACAGAAGCAGCACGGCGG - Intergenic
1135472569 16:22744490-22744512 CAGAGAAAGGAAGAGGATGGAGG + Intergenic
1135770583 16:25215147-25215169 TAGAGACAGAAGTAGAATGGTGG - Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136338500 16:29626794-29626816 CAGAGACAGAAGCAGCACGGCGG - Intergenic
1139591883 16:67937522-67937544 CAGGGTAAGGAGTAGCCTGGGGG - Intergenic
1140420839 16:74817518-74817540 CAGAGAAAGCAGCAGCAGCCAGG - Intergenic
1141341815 16:83210461-83210483 AAGAGAAATCAGAAACATGGAGG + Intronic
1142041237 16:87895708-87895730 CAGAGACAGAAGCAGCAGGGCGG - Intronic
1142485033 17:241826-241848 CAAAGAAAGGACTGGCATGGTGG + Intronic
1143543005 17:7580647-7580669 CAGAGGAAGGAGTAGCGTGTGGG - Intronic
1143775293 17:9195240-9195262 CAGAGAAGCCATTTGCATGGTGG + Intronic
1143972240 17:10804030-10804052 CAGAGAAGGCAGCAGCAGGCAGG - Intergenic
1144909415 17:18668722-18668744 CAGAGGCAGTAGTAGCATGGGGG - Intronic
1146477217 17:33172689-33172711 CAGAGAACTCAGTAGTATGATGG + Intronic
1148907648 17:50921361-50921383 CAGAGAAAGCAGAAGTGTGGAGG - Intergenic
1149455837 17:56787547-56787569 CAGTGAAGGAATTAGCATGGTGG + Intergenic
1151756768 17:76079724-76079746 CAGCCTAAGCAGCAGCATGGAGG - Exonic
1203171336 17_GL000205v2_random:149785-149807 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1154274905 18:12949912-12949934 AATAGAAAGCAGTAGAATAGAGG - Intronic
1154280340 18:12996667-12996689 AAGGGAAAGCAGCAGCTTGGTGG + Intronic
1155011419 18:21782459-21782481 CAGAAAAAGCAGTAGTAAGAGGG - Intronic
1157080318 18:44517777-44517799 AAGAGAAAGCAATAGCAGGAAGG + Intergenic
1157910202 18:51610313-51610335 CATAGAAAGCAGGAGCAAAGAGG - Intergenic
1158644536 18:59232803-59232825 CAGGGAAAGCAGGAGCCTGGTGG + Intergenic
1160539603 18:79613368-79613390 CAAACAAAGCAGCAGCATGGAGG + Intergenic
1160806277 19:993574-993596 CAGAGGAACCAGTTACATGGAGG - Intronic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1161668477 19:5590911-5590933 CTGAGAAAGCAGCAGCCTGGTGG - Intronic
1162095504 19:8307630-8307652 GAGAGCCTGCAGTAGCATGGGGG + Intronic
1163889721 19:20000115-20000137 CTGAGTAATCAGTAGCCTGGCGG + Intronic
1164537853 19:29099592-29099614 TTCAGAAAGCAGCAGCATGGAGG - Intergenic
1164787009 19:30941510-30941532 CAGAGAAATCACTAGGAGGGAGG - Intergenic
926971744 2:18473602-18473624 CTGAGACAGCAGCAGCATGGAGG - Intergenic
929465863 2:42143202-42143224 CAGAAAAAGCAGCAGCAATGAGG - Intergenic
929738044 2:44572173-44572195 CAGAGACAAAAGTAGAATGGTGG - Intronic
930912090 2:56641271-56641293 CAGACAAAGCAGCACCATGGTGG - Intergenic
932085826 2:68759095-68759117 CAGAGAAAGCAGGAGTAAGAGGG + Intronic
933110342 2:78391466-78391488 CAGAAAAAGCAGTACTAAGGGGG - Intergenic
934908958 2:98233003-98233025 CAGAGATAGCAGGAGCAAGAGGG - Intronic
937408431 2:121651353-121651375 CAGAGACAGAACTAGAATGGAGG - Intergenic
939121924 2:138127429-138127451 CAGTGAAAGCAGTAGCCGGCTGG + Intergenic
939470582 2:142615562-142615584 CAGAGCAAGCAGAAGCAATGTGG + Intergenic
940695766 2:156976074-156976096 CAGAAAAAGCAGTACCAAGAGGG - Intergenic
940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG + Intronic
941064826 2:160890070-160890092 CAGTGAATTTAGTAGCATGGCGG + Intergenic
941422385 2:165298597-165298619 AAGAGAACCCAGTAGCATGTGGG + Intronic
942683662 2:178508441-178508463 AATAGAAAGCAGAAACATGGTGG - Exonic
943686950 2:190828665-190828687 CAGAGTTTGTAGTAGCATGGAGG - Intergenic
944078931 2:195763201-195763223 CAGTGAAAACAGTAGTAAGGTGG + Intronic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
945266127 2:207893098-207893120 CAGAGAAAGCAGCAGCCAGTTGG + Intronic
946764735 2:223030085-223030107 CAGAGAAAGCAGGAGGTAGGGGG + Intergenic
947058968 2:226140307-226140329 CTGAGAAAGAAGTAGCAGAGAGG - Intergenic
947762891 2:232616642-232616664 GAGAGACAGAAGTAGAATGGTGG + Intronic
948446353 2:238036539-238036561 CAGGTATAGCACTAGCATGGTGG + Intronic
948665734 2:239533718-239533740 CAGAGAGAGCAGGAGCAAGCAGG - Intergenic
1169768569 20:9176163-9176185 TAGAGGAAACAATAGCATGGAGG - Intronic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172879743 20:38192008-38192030 CAGAGAAAACAGTGGCCAGGAGG - Intergenic
1173193706 20:40896371-40896393 CAAATAAAGCAGTAGTTTGGGGG + Intergenic
1173203927 20:40976621-40976643 CAGTGAAAGCAGTACCAAGAGGG - Intergenic
1174670989 20:52307543-52307565 CAGAAAAAGCAGAAGGGTGGGGG - Intergenic
1174805699 20:53602691-53602713 CACACAAAGCAGTAGCAGGATGG - Intronic
1175009753 20:55723355-55723377 CAGAGAAAGGAGTCGCATGGTGG - Intergenic
1175569507 20:60008391-60008413 CACAGAAAGCAGTAGATTTGGGG + Intronic
1175572749 20:60036621-60036643 CAGAGTAAGCAAAAGCCTGGAGG - Intergenic
1175581341 20:60102159-60102181 GTGAGAAAGCAGAAGCCTGGGGG + Intergenic
1176268642 20:64223877-64223899 AAGAGAAGGCATGAGCATGGGGG - Intronic
1176327320 21:5511613-5511635 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176334153 21:5580092-5580114 CTGAGCAATCAGTAGCATAGTGG + Intergenic
1176393604 21:6240860-6240882 CTGAGCAATCAGTAGCATAGTGG - Intergenic
1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1176436720 21:6679766-6679788 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176460982 21:7006836-7006858 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176467815 21:7075314-7075336 CTGAGCAATCAGTAGCATAGTGG + Intronic
1176484543 21:7388614-7388636 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176491376 21:7457092-7457114 CTGAGCAATCAGTAGCATAGTGG + Intergenic
1176509266 21:7681291-7681313 CTGAGCAATCAGTAGCATAGTGG - Intergenic
1176733112 21:10520051-10520073 CACACAAAGCAGTAGCAGGATGG + Intergenic
1179798558 21:43799691-43799713 CAGAGCAAGCGGTAGCACAGAGG - Intronic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1182204262 22:28607881-28607903 GAGTGAAAGCAGAAGCAGGGAGG - Intronic
1183524199 22:38314173-38314195 CAGAGGAAGCAGGAACATGAGGG + Intronic
1184118083 22:42433502-42433524 CTGAGCAGGCAGTAGCAGGGTGG - Intergenic
1184429949 22:44436783-44436805 TAGAGACAGAAGTAGAATGGTGG - Intergenic
1185201149 22:49506251-49506273 CAGTGGAAGAAGCAGCATGGTGG - Intronic
1185358923 22:50393485-50393507 CAGAGCAAGCAAGAGCATTGAGG + Intronic
1185415903 22:50710174-50710196 CAGAGAAAGCAGGTGCAAGTCGG + Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949200130 3:1367333-1367355 CATAGTAAAGAGTAGCATGGTGG - Intronic
949953366 3:9247859-9247881 CAGAGAAAGGAGGAGCCTGCTGG + Intronic
950115589 3:10448684-10448706 CAGACAAAGCAGTAGGAAGATGG - Intronic
950365122 3:12477697-12477719 CAGGGACAGCAGTTGCAGGGTGG + Intergenic
951396050 3:22167552-22167574 CAGAGAAGGCTGTAACATTGTGG + Intronic
952242445 3:31546414-31546436 CAGACTAAGCAGTCACATGGAGG - Intronic
952852581 3:37741202-37741224 CAGAGAAAGCCTCAGCAGGGTGG - Intronic
953138595 3:40205880-40205902 CAGAGAAAGGAGCAGTAAGGAGG - Intronic
956148111 3:66212669-66212691 TAGAGATAAAAGTAGCATGGTGG - Intronic
956175151 3:66465889-66465911 TAGAGACAGAAGTAGAATGGTGG - Intronic
957115567 3:76019973-76019995 CAGAGAAAACCGAAGCATGTGGG - Intronic
957137487 3:76307935-76307957 CAGAGACAACAGTTTCATGGAGG + Intronic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
957993338 3:87654169-87654191 GAGGGCAAGCAGAAGCATGGTGG - Intergenic
958073996 3:88652802-88652824 CAGAGTAATCAGTAGAAAGGGGG + Intergenic
959349865 3:105248681-105248703 CAAAGAAAGCAGTAGAATAAAGG + Intergenic
959385233 3:105696896-105696918 GACAGAAAGAAATAGCATGGAGG - Intronic
959598083 3:108149328-108149350 CAGCAAAAGCAGGAGCAAGGAGG - Intergenic
962278717 3:134034506-134034528 CAGAGAGAACAATGGCATGGAGG - Intronic
963043137 3:141083603-141083625 CAGCACAAGCAGAAGCATGGAGG - Intronic
964083032 3:152783610-152783632 CAAAAATAGCAGTAGAATGGGGG - Intergenic
965134322 3:164741941-164741963 CTCAGAAAGCAGAAGCCTGGTGG + Intergenic
965622031 3:170651444-170651466 GAGAGCAAGCAGAAGCAGGGCGG - Intronic
965723736 3:171690495-171690517 CAGAGAAAGCAGTGCAAAGGGGG - Intronic
966291108 3:178360956-178360978 GAGGGCAAGCAGAAGCATGGTGG + Intergenic
966531144 3:180981814-180981836 CAGAGAAAGCTGAAGCCTCGAGG + Exonic
967224628 3:187279266-187279288 GCCAGAAAGCATTAGCATGGGGG + Intronic
968034195 3:195531888-195531910 TAGAGATAGAAGTAGAATGGTGG - Intronic
969031066 4:4214756-4214778 CATAGACAGAAGTAGAATGGTGG + Intronic
969683740 4:8657388-8657410 GAGAGAACGCAGGAGCACGGGGG + Intergenic
970158796 4:13168621-13168643 CAGAGAAAGTTGTAGGAAGGAGG - Intergenic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
971304138 4:25465611-25465633 CAGACAAAGAGGTAGAATGGTGG + Intergenic
971473924 4:27054974-27054996 CAGAGGAAGAAGTTGCAAGGGGG + Intergenic
971566136 4:28143969-28143991 GAGAGAGAGCAGAAGCCTGGGGG - Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
972697285 4:41459860-41459882 CAGGGAAAGCTAGAGCATGGAGG + Intronic
973054125 4:45632710-45632732 CAGAGAAAGCATTACCAAGAGGG + Intergenic
973116777 4:46470776-46470798 CAGAGACATCATCAGCATGGCGG - Intronic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
974333495 4:60509640-60509662 CAGTGAAAGCAGTAGTAAGTGGG + Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974972306 4:68845242-68845264 CAGAGAAGGCAGTTGGATAGGGG + Intergenic
975213047 4:71722968-71722990 GAGAGAGAGCAGAAGCAGGGTGG - Intergenic
975382106 4:73712548-73712570 CAGAGAAACCAGCAACAGGGTGG + Intergenic
975721582 4:77253609-77253631 CAGATAAAACACTACCATGGAGG + Intronic
975918208 4:79349770-79349792 CAGAAAAAGCAGTACCAAGGGGG - Intergenic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
976980125 4:91217173-91217195 AAGAGTAAGCAGTAGCAAGAGGG + Intronic
979417372 4:120460483-120460505 GAGAGCAAGCAGAAGCAAGGTGG + Intergenic
979421310 4:120508953-120508975 GAGGGAAAGCAGAAGCAGGGTGG + Intergenic
980124296 4:128758978-128759000 CAGAGAAAGAAATAGAATGGAGG + Intergenic
985278012 4:188257700-188257722 CAGTGAAAGCATGAGGATGGGGG - Intergenic
986225703 5:5810132-5810154 CAGAGAAAGATGTAGGCTGGAGG - Intergenic
986323359 5:6652118-6652140 CAGAGAAAGCAGCAGCACCCCGG + Intronic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
987449660 5:18066333-18066355 CAGATAAAGCAGTGGCAGTGGGG + Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
989261416 5:39423712-39423734 CAGGCAAAGCAGGGGCATGGGGG - Intronic
989502445 5:42184147-42184169 CATAGAAGCCAGTAGCATTGTGG - Intergenic
991042305 5:62188543-62188565 CAGAGAATGATGTATCATGGTGG + Intergenic
992084950 5:73269997-73270019 CCGAGAGAGCAGTAGCAGGTGGG - Intergenic
992178400 5:74173172-74173194 CAGAGAAAGAAGTTTCTTGGAGG - Intergenic
993050943 5:82925136-82925158 CAGAGAAAGCAGGAAACTGGAGG - Intergenic
993604586 5:89972887-89972909 CAGAGGAAGCATTTGAATGGTGG - Intergenic
994665255 5:102697132-102697154 CAGCAAAAGCAAAAGCATGGAGG - Intergenic
995301833 5:110594151-110594173 GAGGGCAAGCAGAAGCATGGTGG + Intronic
995530119 5:113084100-113084122 CTCAGAAATCAGTAGCATAGGGG - Exonic
997204287 5:132033520-132033542 CAGAGAAAGTATAATCATGGAGG + Intergenic
997211924 5:132081860-132081882 TACAGAAATCAGTAGCATTGAGG + Intergenic
997217924 5:132129718-132129740 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
997593070 5:135087352-135087374 AAGAGCAAGCAGAAGCAAGGAGG + Intronic
997934323 5:138097337-138097359 CAGAGAAAGCAGAGGTCTGGGGG - Intergenic
998634343 5:143936082-143936104 CAGAGAAAGCAGTACTAAGAGGG + Intergenic
999794569 5:154977009-154977031 CAGAGACAGAAGTAGAATGGTGG - Intergenic
999933031 5:156454678-156454700 CAGAGAGAGCATTGGCATGGTGG + Intronic
1001519981 5:172384539-172384561 TAGAGACAGAAGTAGAATGGTGG - Intronic
1001582105 5:172805964-172805986 AAGAGAAAGGAGAAGCAAGGCGG - Intergenic
1003749822 6:9042713-9042735 CAGCGAAGGCAGAAGCACGGTGG + Intergenic
1004601417 6:17153970-17153992 CAGAGAAAGCAGAAGCGTTTGGG - Intergenic
1005534784 6:26744415-26744437 CAGAGAAAGAAGGAGAGTGGTGG + Intergenic
1005867752 6:29948953-29948975 CAGAGGAAGCAGTAGCTGGGTGG - Intergenic
1006044222 6:31280804-31280826 CAGAGGAAGCAGTTGCATCTGGG - Intronic
1006516648 6:34549276-34549298 CAGAGACAGGAGCAGAATGGTGG + Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007250011 6:40489157-40489179 CAGAGAAGGCAGTGAGATGGAGG - Intronic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1009352876 6:62704630-62704652 CAGTGAAGGCAGTAGCAAGATGG - Intergenic
1009492196 6:64304861-64304883 CAGTGAAAGCAGTGGTAAGGGGG + Intronic
1011476881 6:87757019-87757041 CACAGAAAGCAGAAGCTTGTGGG + Intergenic
1012250284 6:96972499-96972521 CAGAGAAAGAGGTTGCATTGGGG + Intronic
1013285959 6:108681957-108681979 CAGAGGCACTAGTAGCATGGGGG + Exonic
1013479777 6:110543737-110543759 TGGAGGAAGCAGGAGCATGGAGG + Intergenic
1014177111 6:118342838-118342860 GAGGGCAAGCAGAAGCATGGTGG - Intergenic
1015808316 6:137134196-137134218 CAGCTAAAGCAGCTGCATGGAGG + Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1017577232 6:155818459-155818481 CAGAGAAAGCAAGAGGAAGGAGG + Intergenic
1018515341 6:164573486-164573508 CAGAGAAAGTGATAGCATAGTGG + Intergenic
1019776943 7:2917482-2917504 CTAAGAAAGCGTTAGCATGGAGG - Intronic
1020607761 7:10359981-10360003 CAGAAGCAGCAGTAGCATGGCGG + Intergenic
1020637121 7:10710487-10710509 CATATAAAGCATTAACATGGTGG - Intergenic
1023368479 7:39488964-39488986 CAAAGAAAGCTGTTGCATAGAGG - Intronic
1026378529 7:69775943-69775965 CAGAGAAAGAAGTGGGGTGGGGG - Intronic
1028427102 7:90701947-90701969 CAGAGAAAGCATTCGCTTAGAGG - Intronic
1028486125 7:91359497-91359519 CAGAGATAGCAGCATAATGGAGG + Intergenic
1028870030 7:95760500-95760522 CAGAGACAGCAGTTACATTGAGG - Intergenic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1029884951 7:103858958-103858980 CAGAGAAAGAAGAAGACTGGAGG + Intronic
1029893439 7:103956127-103956149 TAGATAAAGCAGTAGCTAGGAGG - Intronic
1031294350 7:119983336-119983358 CACTGACAGCAGTGGCATGGTGG - Intergenic
1031362768 7:120866903-120866925 CGGTGAAAGCAGGAGCAAGGAGG - Intergenic
1031903065 7:127430581-127430603 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1032189761 7:129757884-129757906 CAGGGCATGCAGAAGCATGGAGG - Intergenic
1032966369 7:137103246-137103268 GAGAGCAAGCAGAAGCAAGGTGG + Intergenic
1033664205 7:143425156-143425178 GAGAGAAAGAAAAAGCATGGGGG - Intergenic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1034974879 7:155442268-155442290 CAGAGAGGTAAGTAGCATGGAGG - Intergenic
1035228644 7:157447510-157447532 CAGAGACAGAAGTAGAATGGTGG - Intergenic
1037510815 8:19580048-19580070 AAGAGCAAGCAGTAGAAAGGAGG - Intronic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1040500152 8:47998431-47998453 CAGAGGAACCAGAAGCCTGGAGG + Intergenic
1040660859 8:49573447-49573469 GAAAGAAGCCAGTAGCATGGTGG - Intergenic
1041792849 8:61715533-61715555 CAGAGAGAGCAGTTGCATTGTGG + Intergenic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1045169284 8:99646002-99646024 CAGAGAGAGCAGTAAGTTGGGGG + Intronic
1045227082 8:100259227-100259249 CAGAGAAGGCAACAGTATGGAGG - Exonic
1045981266 8:108191030-108191052 CTGAAAAAGCATTGGCATGGCGG - Intergenic
1046558687 8:115810519-115810541 CAGAGAGAGTAGCAGCATGTGGG - Intergenic
1048456614 8:134584247-134584269 CAGAGAAAGCTGCAGGGTGGAGG - Intronic
1051298200 9:15618802-15618824 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1053486449 9:38460350-38460372 CAGAGGAAGCAGTTGCATTTGGG - Intergenic
1057444724 9:95105474-95105496 CAGAAAAAGCACCAGCATGCTGG - Intronic
1057470999 9:95356144-95356166 CAGAGAAAGCAACAGCAGAGAGG - Intergenic
1058620629 9:106879200-106879222 CTGGGCAAGCAGCAGCATGGGGG + Intronic
1059251826 9:112892647-112892669 CAGAGAACTCAGAAGCCTGGGGG - Intergenic
1060192968 9:121604509-121604531 CAGAGAAAGAAGAGGCAGGGAGG - Intronic
1060583120 9:124770228-124770250 CAGGGAAAGCCGTTGCCTGGCGG + Intronic
1060724296 9:125997019-125997041 CAGAAAGAGCAGTAGAAAGGAGG - Intergenic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062415648 9:136448280-136448302 CAGAGACACCAGGAGAATGGAGG + Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415748 9:136448686-136448708 CAGAGACACCAGGAGAATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1203427484 Un_GL000195v1:54805-54827 CTGAGCAATCAGTAGCATAGTGG - Intergenic
1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1186645229 X:11499787-11499809 AAGAGGAAGCAGCGGCATGGAGG + Intronic
1186822235 X:13301987-13302009 CAGAGAAGGCAGGAAAATGGGGG - Intergenic
1187032277 X:15500233-15500255 CAGAGAAAATAGTGGAATGGGGG + Intronic
1187265706 X:17731068-17731090 CAGAGAAAGCAAGTGGATGGAGG - Intronic
1187798203 X:23028076-23028098 ATTAGAAAGCAGTAGCATGAGGG - Intergenic
1187811263 X:23180089-23180111 CAGAGAAAGCAATTGCACAGTGG - Intergenic
1188168457 X:26892226-26892248 CAGGACACGCAGTAGCATGGTGG - Intergenic
1188641361 X:32509609-32509631 CATTGAATGCAGTAGCTTGGGGG - Intronic
1188938305 X:36204718-36204740 CACTGAAAGCATTAGCACGGGGG + Intergenic
1189266951 X:39724493-39724515 CAGAGGAAGCAGGGGCGTGGGGG - Intergenic
1189566117 X:42242890-42242912 CAGAACAAGCAGAAGCCTGGTGG - Intergenic
1190244303 X:48680951-48680973 CCGAGAAAGAAGTAGAAAGGTGG + Intronic
1190487433 X:50941864-50941886 CAGAGAAGGCTGTAACATTGTGG - Intergenic
1191132703 X:57031301-57031323 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1192321824 X:70095990-70096012 CAGAGAAGGAAGTAGCATCATGG - Intergenic
1194253482 X:91606700-91606722 CAGAAAAAGCAGTACTAAGGTGG + Intergenic
1194807814 X:98351131-98351153 CAGAGAAAGCAATAAAATGTGGG + Intergenic
1195421766 X:104683455-104683477 CAGAGAAAGAAGCAGAATGACGG + Intronic
1197072783 X:122320867-122320889 CATAGAAATGAGTAGAATGGTGG + Intergenic
1197360833 X:125501473-125501495 CAGCAAAAGCAGTAGCAAGAGGG - Intergenic
1197990107 X:132308681-132308703 AAGAGAAAGCAGTAGAGTCGGGG - Intergenic
1199559304 X:149146254-149146276 CAGAGCTTGCAGTATCATGGTGG + Intergenic
1199753974 X:150847530-150847552 GAGAGAAAGCAGTATCAAGATGG - Intronic
1200572261 Y:4846285-4846307 CAGAAAAAGCAGTACTAAGGTGG + Intergenic
1200740347 Y:6847096-6847118 GAGAGCAAGCAGGAGCAGGGTGG - Intergenic
1201668256 Y:16484438-16484460 CAGCTAAAGCAGTACCCTGGGGG - Intergenic
1202051425 Y:20784723-20784745 CAGTGCAAACATTAGCATGGTGG + Intergenic