ID: 902219789

View in Genome Browser
Species Human (GRCh38)
Location 1:14957706-14957728
Sequence ACAGCTCTGCGGAGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 345}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902219789 Original CRISPR ACAGCTCTGCGGAGGCCCTG AGG Intronic
900165021 1:1241102-1241124 ACAGCAGTGTGGGGGCCCTGAGG - Intergenic
900762804 1:4484083-4484105 ACAGCTCAGGGGAGGCCAAGGGG - Intergenic
901020756 1:6254188-6254210 AGAGGCCTGGGGAGGCCCTGTGG - Intronic
901145418 1:7061646-7061668 CCAGCTGTGCAAAGGCCCTGAGG + Intronic
901196334 1:7442028-7442050 ACAGCGCTGGGGAAGTCCTGGGG - Intronic
901205971 1:7496105-7496127 ACAGCTCTGAGCCGGCCCTCTGG - Intronic
901463909 1:9408364-9408386 TCAGCTCAGCGATGGCCCTGTGG - Intergenic
901624687 1:10617334-10617356 GCAGCACTGGGGAGGCTCTGAGG - Intronic
901667481 1:10835003-10835025 ACAGCTTTGCAGAAGCCCTCAGG + Intergenic
902219789 1:14957706-14957728 ACAGCTCTGCGGAGGCCCTGAGG + Intronic
902554116 1:17236891-17236913 ACAGCTGTGCAAAGGCCCTGAGG + Intronic
903057052 1:20643311-20643333 ACAGCCCTGCTGAGGCACAGTGG - Intronic
903213126 1:21829616-21829638 ACAGCTCAGCTGAGGCAGTGGGG + Intronic
904363409 1:29993366-29993388 ACAGCCATGCAAAGGCCCTGTGG + Intergenic
905769047 1:40625603-40625625 ACAGTCCTCCTGAGGCCCTGAGG - Exonic
906645188 1:47469793-47469815 TAAGCTCTGGGGAGACCCTGAGG + Intergenic
907333122 1:53684254-53684276 TGAGTTCTGGGGAGGCCCTGAGG - Intronic
907606145 1:55819067-55819089 ACAGCTCCTCAGAGGCCCAGTGG + Intergenic
907952174 1:59194271-59194293 ACATCTCTGCAGAGGCCTTCAGG - Intergenic
912525595 1:110280505-110280527 ACAACTCTGCGAAACCCCTGAGG + Intronic
912629936 1:111238221-111238243 ACAGCTCTCAGGAGATCCTGAGG - Intronic
915765032 1:158354102-158354124 GAAGCTCTGGGGAGGTCCTGGGG + Intronic
915937608 1:160098482-160098504 CCAGCTCTGGGGAGGCTCCGGGG + Exonic
917776864 1:178346942-178346964 ACAGTTCTACTGAGGCACTGGGG - Intronic
919639133 1:200032242-200032264 TGTGCTCTGGGGAGGCCCTGGGG + Intronic
919746249 1:201010793-201010815 ACAGCTCTGAGTGGGCCTTGGGG - Intronic
919929864 1:202214275-202214297 CCAGGGCTGCGGAGGACCTGTGG - Intronic
920356999 1:205381111-205381133 ACAGCTCTGCCTGGTCCCTGAGG + Intergenic
920495003 1:206448259-206448281 ACAGCTGTGGGGAGGCCATGTGG - Intronic
921069887 1:211649963-211649985 ACAGATCTGGGGAGGCCTGGGGG - Intergenic
922505507 1:226123334-226123356 ACTTGTCTGCTGAGGCCCTGGGG + Intergenic
922564640 1:226593713-226593735 ACAGAGCTCCAGAGGCCCTGTGG - Intronic
923092571 1:230751273-230751295 CCAGCACTGTGGAGGCCATGGGG - Intronic
1065812213 10:29452554-29452576 ACAGCTCTGCTGAGGCTGGGAGG + Intergenic
1065959574 10:30723589-30723611 ACAGCTCTGCTGAGGCTGGGAGG - Intergenic
1067414607 10:46094047-46094069 TGAGAGCTGCGGAGGCCCTGGGG - Intergenic
1067434668 10:46268602-46268624 TGAGAACTGCGGAGGCCCTGCGG - Intergenic
1067439064 10:46298064-46298086 TGAGAGCTGCGGAGGCCCTGGGG + Intronic
1067540123 10:47144891-47144913 GCAGCCCTGGTGAGGCCCTGGGG + Intergenic
1068732649 10:60376170-60376192 ACAGATTTTTGGAGGCCCTGTGG - Intronic
1069778701 10:70941661-70941683 AGAGCTCTCCTGATGCCCTGAGG - Intergenic
1069921189 10:71816704-71816726 CTAGCTCTCCGAAGGCCCTGCGG - Exonic
1070307004 10:75245680-75245702 ATGGATCTGCAGAGGCCCTGGGG - Intergenic
1070498663 10:77049342-77049364 ACATCTCTCAGGAGGCCATGTGG + Intronic
1071361120 10:84846860-84846882 ACAGCCTTTCTGAGGCCCTGAGG - Intergenic
1072051911 10:91713095-91713117 ACAGCCCTGCTGACACCCTGAGG + Intergenic
1073150063 10:101305427-101305449 ACAGCTCTGCACAGTCCGTGTGG - Intergenic
1073761460 10:106632962-106632984 ACAGATGTGCAAAGGCCCTGTGG + Intronic
1074123500 10:110510384-110510406 AGAGCTCAGCAGAAGCCCTGTGG + Exonic
1074427147 10:113361405-113361427 ACAGCTCTGCCGAGGAAGTGGGG + Intergenic
1074901536 10:117820213-117820235 ACACCTCTGTGGAGGCCCTCAGG - Intergenic
1075784874 10:125042266-125042288 TCAGCTCTAAGGAGGGCCTGTGG - Intronic
1076043336 10:127270088-127270110 GCAGCTCGGAGGAGGCGCTGGGG - Intronic
1076590105 10:131577014-131577036 ACCGCTCAGCGCAGGGCCTGGGG - Intergenic
1076611391 10:131727957-131727979 ACACCTGTGCGGAGGTCCTTTGG + Intergenic
1076737459 10:132465207-132465229 GCGGCCCTGCGGATGCCCTGTGG + Intergenic
1076873216 10:133203602-133203624 TCAGCACTGCGGGTGCCCTGGGG + Intronic
1076894903 10:133305972-133305994 ACAGCTCTACGCAGGACCTAGGG - Intronic
1077112719 11:869034-869056 CAGGCTCTGGGGAGGCCCTGGGG - Exonic
1077221409 11:1419289-1419311 ACAGCTCAGCGAAGGCCCCCCGG - Intronic
1077321140 11:1942602-1942624 ACAGCTCTGGGGAGGGCCGCAGG + Intergenic
1078546887 11:12253276-12253298 GCAGCTCTGCCTGGGCCCTGGGG - Intronic
1078652822 11:13211862-13211884 AGTGCTCTGCAAAGGCCCTGTGG + Intergenic
1079099201 11:17530294-17530316 CCATCTCTGCTCAGGCCCTGAGG + Intronic
1080893044 11:36426073-36426095 CCAGCTGGGTGGAGGCCCTGTGG + Intronic
1081705481 11:45180414-45180436 ACAGCGCCGCGGAGGCCGGGCGG - Intronic
1081966401 11:47172790-47172812 GGAGCTCTGTGGAGGCTCTGGGG - Intronic
1083193125 11:61066742-61066764 AAAGCTCTGGGGAGGACCTCTGG - Intergenic
1083325273 11:61869902-61869924 ACAGCTCCCAGGAGGCCCAGCGG + Intergenic
1084343667 11:68527827-68527849 ACAGCAGTGAGAAGGCCCTGAGG - Intronic
1084483314 11:69434365-69434387 ACGGCTCTGCAGATGTCCTGCGG - Intergenic
1084726399 11:70945254-70945276 ACAGCAGTGCAAAGGCCCTGGGG + Intronic
1085306970 11:75492060-75492082 ACAGCCCTGGGGAGACTCTGCGG - Intronic
1089696254 11:120218131-120218153 ACTGCTCTGGGGAGGGGCTGGGG + Intronic
1089696265 11:120218162-120218184 ACTGCTCTGGGGAGGGGCTGGGG + Intronic
1090081014 11:123612755-123612777 GCAGCTCTGTGGAGACCCTGAGG - Exonic
1090404207 11:126467413-126467435 ACTGCCCAGAGGAGGCCCTGGGG - Intronic
1090736730 11:129617420-129617442 TTAGCTCTGCAGAGCCCCTGTGG - Intergenic
1091714905 12:2770166-2770188 ACAGCTCTGCGGTGGGGATGAGG - Intergenic
1091980344 12:4859592-4859614 ACCGCCCTGCAGAGGCCCTAAGG - Intergenic
1092160881 12:6314932-6314954 ACAGCCCTCCCGGGGCCCTGTGG + Intronic
1093213727 12:16337999-16338021 ACAGTCCTGGGGAGGCTCTGTGG + Intergenic
1093704835 12:22263074-22263096 ACAGATATGAGGAGGCTCTGAGG + Intronic
1095698189 12:45164357-45164379 ACAGCTCTGGAGAGTCCATGGGG + Intergenic
1096427581 12:51517146-51517168 CCAGCTCTGCAGAGGCCCCGTGG - Intergenic
1096799945 12:54103808-54103830 TCAGCTCCTGGGAGGCCCTGTGG + Intergenic
1099796741 12:87409573-87409595 ACAGCCCTGCAGAGGCACAGGGG + Intergenic
1101420312 12:104545292-104545314 CCAGCTCTGCAGAAGCCCTGAGG - Intronic
1101903908 12:108811484-108811506 ACAGGTCTGGGATGGCCCTGTGG + Intronic
1103728221 12:123009512-123009534 ACAGGTCTGAGTAGCCCCTGGGG - Intronic
1104651653 12:130538983-130539005 ACGGCTCTGCAGAGCTCCTGGGG + Intronic
1104663322 12:130628103-130628125 ACAGCCGTGCAAAGGCCCTGAGG - Intronic
1104756269 12:131271158-131271180 ACAGCAATGCAAAGGCCCTGGGG - Intergenic
1104910667 12:132238697-132238719 ACAGCCCTGGGGAGGAGCTGAGG - Intronic
1105655123 13:22428392-22428414 ACAGCTGTACAGAGGCCATGTGG - Intergenic
1106330484 13:28734795-28734817 AGTGCACTGAGGAGGCCCTGGGG - Intergenic
1113087054 13:106579620-106579642 ATAGCTCTGCTGAGGACCTGTGG - Intergenic
1113788760 13:113016405-113016427 ACAGCTCTGCCAAGCCCCTGGGG + Intronic
1113940366 13:114015748-114015770 ACAGCTCTGGGGACAGCCTGGGG + Intronic
1114229463 14:20767514-20767536 ACAGCTCTCAGGAGGTCCTGAGG - Intergenic
1114349544 14:21835416-21835438 TCAGCACAGAGGAGGCCCTGGGG + Intergenic
1118320248 14:64748659-64748681 CCAGTTCTGCGGAAGCCCAGTGG + Exonic
1118500239 14:66355615-66355637 ACAGCTCTGGGCAGGTCATGAGG + Intergenic
1121241942 14:92437268-92437290 ACAGCAGTGCAAAGGCCCTGAGG - Intronic
1121683471 14:95814123-95814145 TCAGCTCAGCAGAGACCCTGTGG - Intergenic
1122051747 14:99065577-99065599 AGAGCCCTGGTGAGGCCCTGGGG + Intergenic
1122205796 14:100147354-100147376 TCAGCACTGCGCAGGCGCTGCGG - Intronic
1122320381 14:100851851-100851873 ACAGAACCGGGGAGGCCCTGGGG - Intergenic
1122688319 14:103520421-103520443 ACATCCCTGCTGGGGCCCTGGGG + Intronic
1122781392 14:104145330-104145352 GCAGCCCTGCGGAGGGCCTCGGG - Intronic
1124146712 15:27134535-27134557 CTAGCACTGCTGAGGCCCTGTGG + Intronic
1128672978 15:69588070-69588092 AGAGCTCAGCTGAGGCCCAGAGG - Intergenic
1128910406 15:71508534-71508556 CCAGCTCTGCAAAGGGCCTGCGG + Intronic
1129457351 15:75682997-75683019 CCATCCCTGCGGAGGCTCTGAGG - Exonic
1129726438 15:77903948-77903970 CCATCCCTGCGGAGGCTCTGAGG + Intergenic
1132574199 16:657180-657202 ACAGCTGTGCGGACCCCCAGTGG + Exonic
1132658204 16:1049978-1050000 GCAGCCCTGGGGAGGCCCGGTGG + Intergenic
1132755391 16:1482039-1482061 CCACCTCTGCCGAGTCCCTGAGG + Intergenic
1133354654 16:5127018-5127040 CCAGCACTGCAGAGGCCATGAGG + Intergenic
1134104713 16:11477311-11477333 ACAGCTCAGCTGAGGGGCTGGGG + Intronic
1134689424 16:16181520-16181542 ACAGCAGTGCAAAGGCCCTGGGG + Intronic
1134827333 16:17295180-17295202 ACTGCTGTGCAAAGGCCCTGAGG + Intronic
1135246762 16:20863334-20863356 ACAGCCTTGCTGAGGACCTGGGG - Intronic
1137625923 16:49908538-49908560 ACAGCAGTGCAGAGGCCCAGAGG + Intergenic
1137709345 16:50555532-50555554 TCAGGGCTGCGGAGGACCTGTGG + Intronic
1138297194 16:55897077-55897099 ACAGCAGTGAGAAGGCCCTGAGG - Intronic
1138348805 16:56335628-56335650 CCAGATCTGCGGAGGCCTAGGGG - Intronic
1140410110 16:74736249-74736271 ACAGCCTTGGGGAGGCCCTTTGG + Intronic
1141430986 16:83970063-83970085 GGAGCTCTGCGGGGGTCCTGAGG - Intronic
1141704789 16:85658820-85658842 ACACCTGTGCTGGGGCCCTGGGG - Intronic
1142223484 16:88866326-88866348 ACAGCTGTGTGGAGGCCCTGGGG - Intronic
1142997302 17:3768527-3768549 ACAGCGCCGTGGAGGGCCTGAGG - Intronic
1144852589 17:18251550-18251572 ACAGCTGTGCAAAGGCCCTGAGG - Intronic
1144998683 17:19288550-19288572 GCAGCTGTGCAAAGGCCCTGAGG + Intronic
1145012756 17:19378935-19378957 ACGGCTCTGCGGAGCCCCCCGGG + Exonic
1145200316 17:20938773-20938795 ACAGCTCCCCGGTGGCCATGGGG - Intergenic
1145258893 17:21343131-21343153 ACCACTCTGCTGGGGCCCTGGGG + Intergenic
1145317731 17:21744873-21744895 ACCACTCTGCTGGGGCCCTGGGG - Intergenic
1145974140 17:28974709-28974731 CCAGTTCTGGGGAGGGCCTGGGG - Intronic
1145984063 17:29032550-29032572 AAAGCTCTCCAGATGCCCTGGGG - Intronic
1146794910 17:35774024-35774046 AGAGCTCTCCAGAGTCCCTGAGG - Intronic
1147808705 17:43151055-43151077 AGACCTCTGCAAAGGCCCTGAGG - Intergenic
1147995493 17:44358098-44358120 TCAGCTCAGGGGAGGCCCTGTGG + Intronic
1149299720 17:55293912-55293934 GCACCTCTGGGGAGGCCCTAAGG + Intronic
1149773321 17:59338561-59338583 ACAGTTGTGCAGAGGCACTGAGG + Intronic
1149797178 17:59531274-59531296 ACAGCTTTACAGAGGCCCTTAGG - Intergenic
1150281631 17:63932414-63932436 CCAGCTCTCCGGGGACCCTGGGG + Intergenic
1151388412 17:73769692-73769714 AATGCCCTGCGGAGGCCATGGGG - Intergenic
1151719503 17:75847341-75847363 ACAGCCCTGCTGGGCCCCTGGGG + Intronic
1152233207 17:79125237-79125259 ACAGCCCAGGCGAGGCCCTGTGG - Intronic
1152435441 17:80273523-80273545 GCAGCTCTGCTGCTGCCCTGTGG - Intronic
1153291845 18:3509472-3509494 CCAGCTCTGCAGTGTCCCTGGGG + Intronic
1153380863 18:4438087-4438109 AAAGCTCTGTGGAGGCGCTAAGG - Intronic
1153681709 18:7507377-7507399 ACAGCTCCCAGGAGTCCCTGGGG - Intergenic
1154411070 18:14142641-14142663 AAAGCTGTGCAGAGGCCCTGGGG - Intergenic
1156463992 18:37337145-37337167 ACAGGCCTGCGGTGGCCCTGGGG + Intronic
1157770226 18:50339192-50339214 TCAGCTCTGCTGAGGCACTCAGG - Intergenic
1158521855 18:58177584-58177606 GCAGCTTTGGGGAGGCCGTGAGG + Intronic
1160017241 18:75154294-75154316 ACTGCTCTGCAGGGCCCCTGAGG - Intergenic
1160236965 18:77093353-77093375 GCAGGTGTGTGGAGGCCCTGTGG + Intronic
1160590977 18:79944541-79944563 CCAGCTCTGTGGTGGCTCTGGGG - Intronic
1160694396 19:475549-475571 GCAGCCGTGCAGAGGCCCTGGGG + Intergenic
1160695952 19:484660-484682 ACCGCTGTGCAAAGGCCCTGGGG + Intergenic
1160797789 19:953734-953756 ACAGCGCCGCGGAGGCCCTGGGG + Intronic
1160802613 19:977275-977297 ACAGCTGTGTGAAGGCCCTGAGG - Intergenic
1160877156 19:1302045-1302067 ACAGCTCTGGGGATCCCCAGAGG - Intergenic
1160894360 19:1395729-1395751 GCTGCTCTGCGAAGACCCTGGGG + Intergenic
1161300008 19:3537974-3537996 ACAGCCATGCAAAGGCCCTGGGG + Intronic
1162864868 19:13538138-13538160 ACAGCTATGCGAAGGCTCTGGGG + Intronic
1163032342 19:14552967-14552989 AGTGCTCCTCGGAGGCCCTGAGG + Intronic
1163634584 19:18432130-18432152 ATAGCTCTGCGGAGGCAAAGGGG - Exonic
1165391285 19:35540364-35540386 ACAGCCTTGGGGAGGGCCTGGGG + Intronic
1165410576 19:35658349-35658371 ACAGCTCTGCAGTGGGCCTGGGG + Intronic
1166932309 19:46308646-46308668 ACAGGGCTGGGGAGGCCCGGGGG - Exonic
1166946905 19:46402956-46402978 ACAGCAGTGCAAAGGCCCTGAGG - Intergenic
1167458184 19:49609668-49609690 ACAGCTGTGCAAAGGCCCTGTGG + Intronic
1167687271 19:50964163-50964185 ACAGCAGTGCAAAGGCCCTGAGG - Intronic
1168692122 19:58383508-58383530 ACACCTCTCCTGAGGGCCTGGGG + Intergenic
925226736 2:2189991-2190013 CCAGCTGTGCAGTGGCCCTGAGG - Intronic
925410159 2:3635158-3635180 ACAGCTCTGGAGAGGCACAGAGG - Intronic
927688679 2:25191695-25191717 TCAGATCAGGGGAGGCCCTGTGG + Intergenic
927805061 2:26139713-26139735 ACAGTTCTCAGGAGGGCCTGGGG + Intergenic
928084789 2:28339224-28339246 ACAGTGCTGCAGAGGCCCAGAGG - Intergenic
928682134 2:33713624-33713646 ACAGCCCTCAGGAGGTCCTGAGG + Intergenic
931541429 2:63333779-63333801 ACAGCCCTCCGGAGGTCCTGAGG - Intronic
931624841 2:64247969-64247991 GCAGGTGTGTGGAGGCCCTGAGG - Intergenic
931690549 2:64831575-64831597 ACAATTCTCCGGAGGGCCTGAGG + Intergenic
933066836 2:77808250-77808272 ACAGCCCTTAGGAGGTCCTGAGG - Intergenic
935678877 2:105619187-105619209 ACAGCTCTGTGGAGACCCCAGGG + Intergenic
935953181 2:108349632-108349654 AGAGCCCTGTGGAAGCCCTGTGG + Intergenic
936526280 2:113243722-113243744 ACAGTTATGCAAAGGCCCTGTGG - Intronic
937986681 2:127641198-127641220 ACACCTCTGTGAATGCCCTGGGG + Intronic
938230532 2:129654991-129655013 ACTGCTCTGCGGCTGCTCTGTGG - Intergenic
938341889 2:130541359-130541381 ACAGCACTGAAGAGGCCCCGAGG + Intronic
938347941 2:130579352-130579374 ACAGCACTGAAGAGGCCCCGAGG - Intronic
938409810 2:131054705-131054727 ACATCTCCGCGGAAGCCCTGGGG - Intronic
938727287 2:134120129-134120151 CCCGCTCGGCGGCGGCCCTGCGG + Intronic
939189707 2:138902033-138902055 AGAGCTGTGCCCAGGCCCTGCGG - Intergenic
942034742 2:171999883-171999905 GCAGCCCTGCCGAAGCCCTGAGG - Exonic
944551841 2:200851283-200851305 ACAGCCCTCAGGAGGTCCTGAGG + Intergenic
945066938 2:205955499-205955521 ACATCTCTGAGGCGGGCCTGGGG - Intergenic
946046653 2:216827015-216827037 GCTGCTCTGCAGAGGCCCTATGG - Intergenic
946185098 2:217976349-217976371 AGAGCTCTGCTGTGGCTCTGTGG + Intronic
946193811 2:218021728-218021750 ACATGTCTGCTGGGGCCCTGAGG - Intergenic
946366932 2:219254170-219254192 GCATCTCCGCGGAGGCCCTCGGG - Intronic
946391559 2:219419492-219419514 TCAGCTGTGATGAGGCCCTGGGG + Intronic
947723561 2:232383035-232383057 ACAGCAGTGCCAAGGCCCTGGGG + Intergenic
947912549 2:233810996-233811018 AGAGCTCTGCAGATGCCCTCAGG - Intronic
947975501 2:234362358-234362380 ACAGCCCTCAGGAGACCCTGAGG - Intergenic
948808272 2:240462243-240462265 ACAGCTCTCCGAAGGCGCCGGGG - Exonic
948894369 2:240921426-240921448 ACAGCTGTGGGGAGGCCTTGGGG + Intronic
1171350707 20:24500902-24500924 AGAACTCTGGGGAAGCCCTGAGG + Intronic
1171796501 20:29570534-29570556 TCAGCTCCTGGGAGGCCCTGTGG - Intergenic
1171851741 20:30313635-30313657 TCAGCTCCTGGGAGGCCCTGTGG + Intergenic
1173284120 20:41655058-41655080 ACAGCTCCCCAGTGGCCCTGTGG - Intergenic
1173618017 20:44415507-44415529 ACATCTCTTTGGAGGCCCAGGGG - Intronic
1173823489 20:46032859-46032881 AGAGCTCTTCTGAGACCCTGGGG + Intronic
1173927814 20:46793700-46793722 ACAGCATTACGGAGGCTCTGGGG + Intergenic
1174284271 20:49461217-49461239 GCAGCTCTGCCAAGCCCCTGGGG - Intronic
1174452562 20:50629094-50629116 ACACATGTGCTGAGGCCCTGAGG + Intronic
1175462096 20:59159457-59159479 ACATCGCTGAGGTGGCCCTGAGG + Intergenic
1175918121 20:62436999-62437021 GCAGCTGTGCAAAGGCCCTGGGG - Intergenic
1175921936 20:62454274-62454296 CCAGCTCTGCAGAGGAGCTGGGG - Intergenic
1176861985 21:14015774-14015796 AAAGCTGTGCAGAGGACCTGGGG + Intergenic
1177012283 21:15743865-15743887 ACAGCTCTGCGCAGGCCTCCTGG + Intronic
1179606780 21:42521599-42521621 ACATCTCTGAGGAGGCCCAGAGG + Intronic
1179712344 21:43270526-43270548 CCAGCTCTGTGGAGGGTCTGCGG - Intergenic
1179982401 21:44903215-44903237 GCAGCCCTGTGGATGCCCTGGGG + Intronic
1180001234 21:44996471-44996493 TCAGCTTTGCGGGTGCCCTGAGG + Intergenic
1181275457 22:21685078-21685100 ACAGCCCTGGGGCTGCCCTGAGG + Intronic
1181808545 22:25390124-25390146 TCAGATCTGCGGAAGCGCTGGGG + Intronic
1181920869 22:26319551-26319573 ACAGCAGTGCAAAGGCCCTGAGG - Intronic
1183195891 22:36353048-36353070 GCAGCTCTGCTGCAGCCCTGTGG - Intronic
1183437096 22:37802590-37802612 CCAGCTCTGCAGTGTCCCTGAGG + Intergenic
1184148856 22:42627195-42627217 ACAGCTCTGCTGAGATTCTGGGG - Intronic
1184550542 22:45202208-45202230 ACAGCTCTGGGCAGTCCCTCTGG + Intronic
1184894450 22:47399134-47399156 TCAGGTCTGTGAAGGCCCTGGGG - Intergenic
1185052874 22:48562927-48562949 CCGTCTGTGCGGAGGCCCTGGGG + Intronic
1185079452 22:48701662-48701684 AAGGCTGTGCGGAGGACCTGTGG + Intronic
1185085322 22:48737777-48737799 TTTGCCCTGCGGAGGCCCTGGGG - Intronic
1185199397 22:49492269-49492291 ACAGCTCCTTGAAGGCCCTGAGG - Intronic
1185367156 22:50441947-50441969 ACAGCTGTGCAAAGACCCTGAGG + Intronic
950447192 3:13045133-13045155 ACAGCGGTGCAGAGGCCCTGGGG - Intronic
952960951 3:38588840-38588862 TCAGCTCAGAAGAGGCCCTGTGG + Intronic
954652682 3:52174992-52175014 ATAGCTGTGCAAAGGCCCTGAGG - Intergenic
954806696 3:53224790-53224812 ACAGCTCTGAGGATTTCCTGGGG + Intronic
955353953 3:58215189-58215211 ACAGCTGTGCCAAGGCCCTGAGG - Intergenic
955363456 3:58292594-58292616 ACAGCTCTGGGGATCCCCAGAGG + Intronic
956030312 3:65030198-65030220 AGAGCTGTGCAAAGGCCCTGTGG + Intergenic
956779163 3:72590870-72590892 AGAGCACAGCGGAGGCCCCGGGG + Intergenic
959930770 3:111979373-111979395 AGAGCTCTGCCGCGGCCCTGCGG + Intronic
960455917 3:117871900-117871922 ACTTCTCTGCTCAGGCCCTGTGG + Intergenic
960617541 3:119609542-119609564 ACAGCTCTTCGGAGGCCAGCTGG + Exonic
960969655 3:123130437-123130459 AGAGCTCAGAGCAGGCCCTGGGG - Intronic
961551698 3:127673319-127673341 ACTGCTCAGCGGAGGCCCGAAGG + Intronic
961562519 3:127740555-127740577 GGGGCTCTGCGGGGGCCCTGAGG + Intronic
961669411 3:128518001-128518023 CCAGCTCTGGGGAAGCCCTGGGG + Intergenic
962184674 3:133245443-133245465 ACTGCTGTGGGGAGGTCCTGGGG - Intronic
962302373 3:134253662-134253684 ACAGCAGTGCAAAGGCCCTGAGG - Intergenic
963952276 3:151215963-151215985 ACAGCTAAGCTGAGGCCTTGAGG - Intronic
963960862 3:151307237-151307259 ATAGCTCTGCTGAAGGCCTGGGG + Intronic
965347147 3:167565658-167565680 ACAGCAGTGCAAAGGCCCTGAGG + Intronic
965688166 3:171327532-171327554 GCAACTCTGAGGAGGCCCTAGGG + Intronic
966735041 3:183181269-183181291 TCTGCTCTGGGGAGGGCCTGGGG - Intronic
968508315 4:982588-982610 ACTGGTCGGCGGAGGCCCTCAGG - Intronic
968812672 4:2807039-2807061 ACCGCTCTGTGAAGCCCCTGGGG + Intronic
969010350 4:4056585-4056607 ACAGCACAGTGAAGGCCCTGAGG - Intergenic
969612708 4:8236152-8236174 ACAGCTGTGTCGAGGCCCAGGGG + Intronic
975197373 4:71541540-71541562 AAAACTCTGAGGAGGCCCTCAGG - Intronic
976732837 4:88281879-88281901 ACAGCTCTGCCGATGCCCATGGG + Intronic
977163344 4:93664138-93664160 ACAGCAGTGCAAAGGCCCTGAGG + Intronic
980701776 4:136441919-136441941 ACAGCTGTGGGGAGGGCATGGGG + Intergenic
985009409 4:185567223-185567245 AGAACACTGCAGAGGCCCTGTGG - Intergenic
985484350 5:140339-140361 GCAGCTCTGAGGAGGCCCTCGGG + Exonic
985527809 5:415807-415829 TCACGTCTGCGCAGGCCCTGAGG + Intronic
986207006 5:5634382-5634404 ACAGCACTGTGCAGGACCTGAGG - Intergenic
987335561 5:16895393-16895415 GCAGCTCACCGGAGGCTCTGAGG + Intronic
995612385 5:113924015-113924037 ACAGCTCTGCAAAGCCACTGTGG + Intergenic
996042262 5:118828339-118828361 ACTGCTCTGCTGACGCTCTGAGG - Intergenic
997414653 5:133716331-133716353 ACATCTCTGCTGATGGCCTGTGG - Intergenic
998072292 5:139207574-139207596 GCATCTCTGCAGAGGCCATGGGG - Intronic
998250733 5:140550497-140550519 ACATCTCTGCGGTGGGCCTTGGG - Exonic
998390498 5:141784198-141784220 TCAGCCCTGGGAAGGCCCTGAGG + Intergenic
999367618 5:151033398-151033420 ACAGCTGTGGGGCAGCCCTGCGG + Intronic
999424818 5:151477992-151478014 ACAGCTCTCCAGAGGCTTTGGGG + Intronic
1000907231 5:166978096-166978118 TCAGCTCTGTGCAGGCTCTGTGG - Intergenic
1001705715 5:173739928-173739950 ACAGCAGTGCAAAGGCCCTGAGG + Intergenic
1002089250 5:176794695-176794717 ACAGCCGTGCAAAGGCCCTGTGG - Intergenic
1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG + Intergenic
1002782695 6:379524-379546 ACAGCTTTGGCGTGGCCCTGGGG - Intergenic
1002807583 6:591853-591875 CCACCTGTGTGGAGGCCCTGAGG - Intronic
1006514271 6:34537389-34537411 ACAGCACTGCTGAGGCCTTCAGG + Intergenic
1006792836 6:36714896-36714918 ACAGCACTGCAGGGGCCCTGAGG - Intronic
1007105413 6:39280243-39280265 ACAGCTCTGAGGAGGACATCAGG + Intergenic
1007465096 6:42046158-42046180 ACAGGTTTGGGGAGGCCTTGAGG - Intronic
1007474110 6:42107525-42107547 ACAGCTCTGTGGGTGACCTGAGG - Exonic
1007518194 6:42430023-42430045 ACGGCTGTGCAAAGGCCCTGAGG + Intronic
1007833424 6:44656033-44656055 ACAGAGCTGCGGAGGGGCTGAGG - Intergenic
1010540053 6:77082344-77082366 ACACCTCTGTGGAGCCCATGAGG + Intergenic
1013587355 6:111591395-111591417 AGAGGTCTGGGGAGGTCCTGGGG + Exonic
1016310585 6:142729137-142729159 ACAGCCCTGCAGACCCCCTGGGG + Intergenic
1016961121 6:149673787-149673809 CCAGCTATATGGAGGCCCTGAGG - Intronic
1017742694 6:157420920-157420942 TCAGCTCAGGGGAGGGCCTGAGG + Intronic
1018907324 6:168083094-168083116 ACAGCCCTGCGGAAGCCACGGGG + Intergenic
1019134415 6:169899291-169899313 ATCGCTCTGCTGAGGCCCTGTGG + Intergenic
1019428740 7:988910-988932 ACTGCTCTGGGAGGGCCCTGAGG + Exonic
1019791151 7:3014739-3014761 ACATCTCTGTGGAGCCCCCGAGG + Intronic
1020018035 7:4842943-4842965 CCAGCTATTCTGAGGCCCTGAGG - Intronic
1020136022 7:5588504-5588526 ACAGCTGTCCTGTGGCCCTGTGG + Intergenic
1020268245 7:6576264-6576286 ATAGCCCTGAGAAGGCCCTGTGG - Intergenic
1020277545 7:6634084-6634106 ACAGCACTGCTGAGGGGCTGAGG - Intergenic
1021908888 7:25364503-25364525 ACAGCTCTGGAGAGTCCCTTCGG - Intergenic
1023861762 7:44220964-44220986 ACAGCCCAGGGGAGGGCCTGGGG + Intronic
1024460625 7:49656013-49656035 GCAGCTCTGCCAAGCCCCTGGGG + Intergenic
1026770301 7:73192784-73192806 ACAGCTTTGTTGAGCCCCTGTGG + Intergenic
1026914550 7:74112061-74112083 CCAGTTCTGGGAAGGCCCTGAGG - Intronic
1027011168 7:74746170-74746192 ACAGCTTTGTTGAGCCCCTGTGG + Intronic
1027076873 7:75199870-75199892 ACAGCTTTGTTGAGCCCCTGTGG - Intergenic
1028772928 7:94647732-94647754 AGACCTCTGTAGAGGCCCTGGGG - Intronic
1029188902 7:98758348-98758370 ACAGCAGTGCAAAGGCCCTGAGG + Intergenic
1033344628 7:140517635-140517657 ACAGCTCTTAGGTCGCCCTGAGG + Intergenic
1034851588 7:154499000-154499022 ACAGCTCTACAGAAGCCTTGTGG + Intronic
1035401709 7:158570121-158570143 ACGGCTCCGCGGAGAGCCTGGGG - Intronic
1036333293 8:7848652-7848674 ACACGTCTGCGGATGCTCTGAGG - Intronic
1036756921 8:11477065-11477087 CCACCCCTGGGGAGGCCCTGAGG + Intergenic
1037554583 8:20009785-20009807 ACAGCTCTCAGGAGATCCTGAGG + Intergenic
1038486646 8:27940110-27940132 AAAGCTATGTGGAGCCCCTGGGG - Intronic
1038898110 8:31810529-31810551 ACAGCTGTGCAAAGGCCCTGAGG - Intronic
1039549007 8:38429925-38429947 CCAGCCCTGGGGAGCCCCTGTGG - Exonic
1040276588 8:46017018-46017040 CCTGCTTTGCGGTGGCCCTGTGG + Intergenic
1041004222 8:53483699-53483721 ACAGCTTTGAGCAGGACCTGGGG + Intergenic
1042192039 8:66196867-66196889 ACAGCTCTGAGGAGGCTTTCGGG - Intergenic
1043734981 8:83730796-83730818 ACAGCTTAGAGGAGACCCTGGGG + Intergenic
1044279172 8:90336755-90336777 AGAGCCCTGGAGAGGCCCTGTGG - Intergenic
1045342980 8:101270827-101270849 ACAGCCATGCAAAGGCCCTGAGG + Intergenic
1047521933 8:125601634-125601656 GCAGAGCTGGGGAGGCCCTGAGG + Intergenic
1047724516 8:127672244-127672266 ACAGCAGTGCATAGGCCCTGAGG - Intergenic
1048395471 8:134010367-134010389 ACAGCACGGACGAGGCCCTGAGG + Intergenic
1048867535 8:138771840-138771862 AGAGCTCTCCGCAGGCCCCGGGG - Intronic
1049006387 8:139858365-139858387 GCAGCTGGGCGGAGGCCCCGGGG - Intronic
1049154437 8:141058282-141058304 ACAGCTCTGAGAGGGACCTGGGG - Intergenic
1049385731 8:142342074-142342096 ACAGCAAAGGGGAGGCCCTGGGG + Intronic
1049409454 8:142465973-142465995 AGAGCCCTGTGGAGGCCCCGTGG + Intronic
1049409959 8:142468633-142468655 ACAGCTGTGTGAAGGCCCTGAGG - Intronic
1049618911 8:143589074-143589096 ACCACGCTGCCGAGGCCCTGCGG - Exonic
1049684834 8:143935130-143935152 GCAGCTCAGCGGTGGCTCTGGGG + Intronic
1049865945 8:144935810-144935832 ACAGCCCAGCCGAGGCTCTGAGG - Intronic
1050388204 9:5111881-5111903 GCAGCTCTGGGGACGCCCTCGGG + Intronic
1052654202 9:31334787-31334809 ATAGCTCAGAGGAGGCCCTGGGG + Intergenic
1053789521 9:41676888-41676910 TCAGCTCCTGGGAGGCCCTGTGG + Intergenic
1054155620 9:61637864-61637886 TCAGCTCCTGGGAGGCCCTGTGG - Intergenic
1054177861 9:61888579-61888601 TCAGCTCCTGGGAGGCCCTGTGG + Intergenic
1054475389 9:65568874-65568896 TCAGCTCCTGGGAGGCCCTGTGG - Intergenic
1054659670 9:67692245-67692267 TCAGCTCCTGGGAGGCCCTGTGG - Intergenic
1056507489 9:87270930-87270952 ACAGCTTTGCGGTGGCCAAGGGG + Intergenic
1057553063 9:96066255-96066277 ACTGCTCTGCAGATGCCATGAGG + Intergenic
1058903338 9:109460595-109460617 ACAGCAGTGCAAAGGCCCTGAGG - Intronic
1059355065 9:113692335-113692357 AGAGCTGTGTGGAGGCCCTTGGG + Intergenic
1059430103 9:114244845-114244867 ACAGATCTGCTGTGGGCCTGAGG + Intronic
1059568879 9:115412907-115412929 ACAGCTTTGTGGAGTACCTGAGG + Intergenic
1060407338 9:123379406-123379428 TCAGCCCTGCGGGGGCCATGGGG - Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060588951 9:124803955-124803977 CCAGGTGTGAGGAGGCCCTGAGG + Intronic
1060758556 9:126229788-126229810 AGAGCTGTGCAAAGGCCCTGAGG + Intergenic
1060795628 9:126510801-126510823 AGAGGTCTGGGAAGGCCCTGAGG + Intergenic
1060993937 9:127865207-127865229 ACAGCTCTGCAGAGCCACAGAGG - Intergenic
1061852303 9:133423432-133423454 CCAGCTCAGCAGAGGCCATGGGG - Intronic
1061994075 9:134175292-134175314 ACAGCTCTGCAAAGGCCCTGAGG + Intergenic
1062187851 9:135228118-135228140 CCAGCTGTGCAAAGGCCCTGAGG + Intergenic
1062219802 9:135409132-135409154 ACATCTCAGCAGAGGCCCTGAGG + Intergenic
1062290374 9:135791725-135791747 CCAGCTCTGCAGGGGCCCAGAGG - Intronic
1062376472 9:136264040-136264062 CCAGCCCTGCGTGGGCCCTGGGG - Intergenic
1062534596 9:137015914-137015936 GCAGGTGGGCGGAGGCCCTGGGG - Intronic
1062633599 9:137478436-137478458 ACAGCTCTGAGGATGCCTTCTGG - Intronic
1202804392 9_KI270720v1_random:37583-37605 ACCACTCTGCAGAGGCCTTGTGG - Intergenic
1203449028 Un_GL000219v1:92865-92887 GCCACTCTGCAGAGGCCCTGTGG - Intergenic
1187806794 X:23129356-23129378 ACAGCCCTCAGGAGGTCCTGAGG - Intergenic
1192834096 X:74780903-74780925 ACAGCACAGTGGGGGCCCTGGGG + Intronic
1193397602 X:81003907-81003929 ACAGCTCTGCGGAGGTTTAGCGG + Intergenic
1197424760 X:126282348-126282370 ACAGGGCTGCAGAAGCCCTGGGG + Intergenic
1198230554 X:134685041-134685063 GCTGCTCTGCTGAGGCCCTCTGG - Intronic
1199935268 X:152567293-152567315 ACACCACTGGGGAGGTCCTGAGG + Intergenic