ID: 902222922

View in Genome Browser
Species Human (GRCh38)
Location 1:14978203-14978225
Sequence TTGAAGAAAAGCTCTGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902222922_902222925 -2 Left 902222922 1:14978203-14978225 CCTGAATCAGAGCTTTTCTTCAA 0: 1
1: 0
2: 1
3: 21
4: 236
Right 902222925 1:14978224-14978246 AAGATCTTCATGGCTCAGATGGG 0: 1
1: 0
2: 0
3: 12
4: 134
902222922_902222924 -3 Left 902222922 1:14978203-14978225 CCTGAATCAGAGCTTTTCTTCAA 0: 1
1: 0
2: 1
3: 21
4: 236
Right 902222924 1:14978223-14978245 CAAGATCTTCATGGCTCAGATGG 0: 1
1: 0
2: 1
3: 14
4: 709

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902222922 Original CRISPR TTGAAGAAAAGCTCTGATTC AGG (reversed) Intronic
901952297 1:12758689-12758711 CTTAGGAAAAGCACTGATTCAGG + Intronic
902222922 1:14978203-14978225 TTGAAGAAAAGCTCTGATTCAGG - Intronic
902728130 1:18350854-18350876 TTGAAGGAAAGCTCTGAGCCAGG + Intronic
902816757 1:18920835-18920857 TTGCACAAGAGCTCTGATGCAGG - Intronic
903089884 1:20904141-20904163 ATGAAGAAAAGTTATGTTTCTGG + Intronic
904307259 1:29598230-29598252 TGAAAGGAAAGCTCTGCTTCAGG - Intergenic
905650335 1:39652327-39652349 TTGAAGAGAAGCTGGGAATCTGG - Intergenic
907642479 1:56205052-56205074 TTGAACAAAAGTTCTGATACTGG + Intergenic
908337429 1:63141592-63141614 TTGAAAACAAGCTCTCATTTAGG + Intergenic
908396704 1:63731688-63731710 TTAATGAAAAGTTCTGACTCAGG - Intergenic
908651011 1:66333180-66333202 TTAAAGAAAACCTCTGGTTTTGG - Intronic
908673213 1:66571949-66571971 TTGAAGAAAATGACTAATTCTGG - Intronic
908905376 1:69002712-69002734 GTGAAGAAAATATCTGATTCTGG - Intergenic
911825261 1:102476120-102476142 TTAAAGAAAAACTGTGATTAAGG + Intergenic
912154498 1:106900588-106900610 TTCAAGAAAAGCTGTAAATCCGG + Intergenic
912331864 1:108827459-108827481 TTGTAGAAAAGCTCTCAAACAGG - Intronic
914374363 1:147060774-147060796 ATGAAGAAAAGCTCTGATATGGG - Intergenic
914428232 1:147598898-147598920 CTGAATCAAAGCTCAGATTCGGG - Intronic
916611808 1:166398748-166398770 TTAGAGAAAAGCTCTGAGCCAGG - Intergenic
916783043 1:168056800-168056822 TTTTAGAAATGCTCTGCTTCTGG + Intronic
916808454 1:168283234-168283256 TTGTAGAAAAAGTCTGATTGCGG + Intronic
918516407 1:185368692-185368714 TTGAAGAATGGATGTGATTCAGG + Intergenic
920552983 1:206880385-206880407 TAGAATAAAAGCTCTGAGGCTGG - Intergenic
920648222 1:207818510-207818532 GAGAAGAGAAGCTCTGATTTGGG + Intergenic
921371388 1:214426644-214426666 TTGAAGAATTTCTCTGATTTGGG - Intronic
922994816 1:229947441-229947463 TTGAGGAATGGCTTTGATTCTGG - Intergenic
923115059 1:230928614-230928636 TTACAGAGAAGCACTGATTCTGG + Intronic
924273473 1:242359439-242359461 ATGAAGAAAAGCATTGACTCAGG + Intronic
1063385048 10:5611212-5611234 TTGGGGAAATGCTCAGATTCAGG + Intergenic
1066711244 10:38237215-38237237 ATGAAGAAAAGCATTGACTCAGG - Intergenic
1067980535 10:51079394-51079416 TTGAAGAAGGGCTATGATTTAGG + Intronic
1069018235 10:63455594-63455616 TTGAAAAAAAAATCTGAATCTGG - Intronic
1070011752 10:72482202-72482224 TTGAACTAAAGTTCTAATTCTGG + Intronic
1070760660 10:79022231-79022253 TCGAAGAAAAGCAGTGACTCAGG - Intergenic
1072784687 10:98271721-98271743 CTGAACAAAAGCCCTGTTTCTGG - Intergenic
1073560697 10:104494131-104494153 TTGTAGCAAACCTCTGAATCTGG + Intergenic
1073855241 10:107665814-107665836 TTGAACACAAGCTCTGTTGCAGG + Intergenic
1074501740 10:114031101-114031123 TTGATGACAAGCTCTGACTTTGG + Intergenic
1074840959 10:117350564-117350586 TTGATGAAGAGCACAGATTCTGG - Intronic
1075608596 10:123834111-123834133 GTGAATAAGAGCTCAGATTCTGG - Intronic
1078063942 11:8065719-8065741 TGGAAGAGCAGCTCTGCTTCAGG + Intronic
1079105250 11:17567727-17567749 TTGTACAAAAGCTCTGTTACAGG - Intronic
1081849650 11:46266101-46266123 TTGCAGAAAAGCTCTGCTCCAGG - Intergenic
1085643233 11:78206474-78206496 GTGAAAATAAGCTTTGATTCTGG + Intronic
1086245671 11:84749171-84749193 TTGAAGAAAAGCCTGGAGTCAGG - Intronic
1086515588 11:87608869-87608891 TTGAAGAGAAGTTCTGAGACTGG - Intergenic
1087707512 11:101511670-101511692 GTCAAGAAAATCTCTGCTTCTGG - Intronic
1087765979 11:102154230-102154252 CTGAACAAATGTTCTGATTCTGG + Intronic
1089426937 11:118385395-118385417 TGAAAGAAAATCTCTGATTTGGG + Intronic
1090088594 11:123673525-123673547 TTGAACAAAAGCACTGACTTTGG - Intergenic
1091158493 11:133397051-133397073 TTTGAGAAAAGCATTGATTCTGG + Intronic
1091363519 11:134998034-134998056 GTGCAGAAAAGCTCTGCTTCTGG + Intergenic
1091372587 11:135073265-135073287 TTGAAGGGAAGCTCTGAGCCTGG - Intergenic
1093050184 12:14495405-14495427 TTGAAGCCAAGCTATGATCCAGG - Intronic
1094463950 12:30730569-30730591 TTGAAAAAAAGCTGTGTTTTAGG - Intronic
1095464094 12:42472623-42472645 TTCAATAAAAGCTCTGGGTCGGG - Intronic
1096462337 12:51828988-51829010 TTCCAGAAATTCTCTGATTCTGG + Intergenic
1097224039 12:57466424-57466446 TTGAAGGAGAGCCCTGATTTAGG - Intronic
1097991201 12:65836097-65836119 TTGAAGAAAAACTCCCTTTCTGG + Intronic
1099313392 12:81055702-81055724 GTGAAGAAAAGAGCAGATTCGGG + Intronic
1099796301 12:87404778-87404800 TTTAAGAATAGCTATGATTAAGG + Intergenic
1101616663 12:106344492-106344514 TTGAAGGATGCCTCTGATTCTGG + Intronic
1101810161 12:108100984-108101006 CTGAAGAAAATCTCTGACTGTGG - Intergenic
1102299019 12:111757875-111757897 TTGAAGAAAACCTCTCCTCCCGG - Intronic
1104367715 12:128192948-128192970 TTGGGGAAAAGCTCGGATTGGGG + Intergenic
1106145432 13:27045486-27045508 TTTAAGAAAAGCTGTTGTTCCGG - Intergenic
1106243488 13:27927971-27927993 TCCAAGCAAAGCTCTGATCCCGG - Intergenic
1106528978 13:30569856-30569878 ATGAACACAAGCACTGATTCAGG - Intronic
1107030409 13:35845665-35845687 TTGATGAAAAATTCTGTTTCAGG - Intronic
1107035194 13:35894783-35894805 ATGAACAAGAGCTCAGATTCTGG + Intronic
1107368675 13:39715996-39716018 GTGAAGAAAAGATCATATTCTGG + Intronic
1107687934 13:42922885-42922907 TTAAATACAAGCTCTGATTCAGG + Intronic
1111067176 13:83108282-83108304 TTGAGGAAAACTTCTTATTCAGG + Intergenic
1111482875 13:88855117-88855139 TGGAAGAATGGCCCTGATTCAGG + Intergenic
1111797279 13:92938593-92938615 GTGAAGAAAAGAACTGACTCAGG - Intergenic
1112297953 13:98205149-98205171 TTGAAGACCAGCTATGACTCAGG + Intronic
1112564264 13:100539290-100539312 CAGAAGAAAAGCTTTCATTCTGG + Intronic
1112630167 13:101152306-101152328 ATGAAGAGAAGCTCTGTTTTCGG + Intronic
1114405077 14:22449025-22449047 TTGGAGAAAACATCTGGTTCTGG + Intergenic
1114925105 14:27386703-27386725 TTGAAGAAAACATCTGCTTATGG + Intergenic
1115407684 14:33036585-33036607 TTTAAGAAAATCTCTGTTTCAGG - Intronic
1115982308 14:39067022-39067044 GTGAAGAAAATCTCTAACTCAGG + Intronic
1120939154 14:89929795-89929817 TAGAAGAAAAGCTATGCTACAGG - Intronic
1122019029 14:98821088-98821110 TTGAAGACAAGCGGTGATTGTGG - Intergenic
1124970364 15:34483796-34483818 ATGAAGAAAAGCAATGTTTCAGG - Intergenic
1125396316 15:39251970-39251992 TTGAATAATAACTATGATTCTGG - Exonic
1125498681 15:40222842-40222864 GTGAAGTAAAGCTTTGTTTCTGG + Intergenic
1127281083 15:57493829-57493851 TTGTTGAAAACCTCTGATTGTGG - Intronic
1128055749 15:64699048-64699070 CTGAAGCATAGCTCTGATTTTGG + Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133643188 16:7737787-7737809 CTGAAAAAAAGATCTGGTTCAGG - Intergenic
1133901126 16:9976038-9976060 TTGAAGAGAAACTGTGATTGTGG - Intronic
1135521947 16:23184300-23184322 TTCAACAGAAGCTGTGATTCTGG - Intronic
1137021342 16:35431053-35431075 ATGAATAGAAGCTCTGTTTCAGG + Intergenic
1138361319 16:56430808-56430830 TTGAGAAAAACCTTTGATTCAGG - Exonic
1140373186 16:74424204-74424226 TTGAAGAAAGGAGCTGCTTCAGG - Intergenic
1141200129 16:81891365-81891387 GGGAAGAACAGCTCTGATGCGGG - Intronic
1144087714 17:11825888-11825910 GTCAAGAAAAGTCCTGATTCTGG - Intronic
1146142710 17:30381477-30381499 TTGAAGAACAGATATGATTAGGG - Intronic
1146979960 17:37151195-37151217 TTCAAGAAATGCTCTCATTTGGG + Intronic
1149095389 17:52833588-52833610 TTGAAGACAAGCTCTGAAACAGG + Intergenic
1149284102 17:55142894-55142916 TTCCAGAAGAGGTCTGATTCTGG - Intronic
1153501504 18:5754747-5754769 ATGAGGAAAAGATCTGTTTCGGG + Intergenic
1155214992 18:23635398-23635420 TGGTAGAAAAGCTCTAATTTAGG - Intronic
1155505759 18:26531155-26531177 TTGAAGAACTACTCTGATTATGG + Intronic
1156912713 18:42429503-42429525 TTGCAAAAGAGCTCTGACTCGGG + Intergenic
1157108841 18:44800509-44800531 TTGAAGAAAACCTGTGGTGCTGG + Intronic
1158188795 18:54801925-54801947 TTGAGGACAAGCTCTAATTTGGG + Intronic
1158414779 18:57240465-57240487 TTTAAGAAAAGCCCTGAGACAGG + Intergenic
1159078048 18:63703601-63703623 TAAAAGAATAGCTCTGATTTAGG + Intronic
1159782317 18:72674656-72674678 TGGAAGAAAACCTCTGACTCTGG + Intergenic
1160209371 18:76863464-76863486 TTGCAGAAGAACACTGATTCAGG + Intronic
1164997564 19:32733717-32733739 CTGAATAAAAGAGCTGATTCAGG - Intronic
1165114283 19:33519761-33519783 TGCTAGAAAAGCTCTCATTCTGG + Intronic
1167634302 19:50645195-50645217 TTGGAGGAAAACGCTGATTCAGG + Intronic
1168393837 19:56032038-56032060 TTGAAGCAAAGATCTGATGCAGG + Intronic
1202646636 1_KI270706v1_random:148026-148048 TTGGAGAAATGCACAGATTCTGG - Intergenic
925824746 2:7836730-7836752 TGGAAGAAAGGCTCTGCTTCTGG + Intergenic
929376906 2:41298696-41298718 TTGAGGACAAGCACTGATCCTGG - Intergenic
931845179 2:66196295-66196317 TTAAAGAAAACCTCTCATTCTGG + Intergenic
934510016 2:94930425-94930447 TGGGAGAAATGCACTGATTCTGG - Intergenic
935182025 2:100700121-100700143 TTGAGGGAAAGATCTGTTTCAGG - Intergenic
939062290 2:137437186-137437208 TTGAAGTATAGCTCTGATCCAGG - Intronic
941217581 2:162732981-162733003 TTCGAGACAAGCTCTGAATCTGG - Intronic
943242193 2:185399554-185399576 GTGAGGAAAAGATCTGTTTCAGG - Intergenic
943569378 2:189555147-189555169 TTTAAGAAAAGGTCTCACTCTGG - Intergenic
945634828 2:212335066-212335088 TTACAGAATAGCTCTCATTCAGG - Intronic
946108419 2:217392416-217392438 TTGAGGAAAAGCTGTGCTTATGG - Intronic
946851965 2:223916563-223916585 CTGAAGAAAATCACTGATTAAGG + Intronic
946969044 2:225071251-225071273 TTCAAGAAAAGCTATAAATCTGG + Intergenic
947374839 2:229485153-229485175 TAGAAGAAAAGTTGTGACTCAGG + Intronic
1169330868 20:4715209-4715231 TGGAGGAAAAGCTCTATTTCAGG + Intergenic
1174046095 20:47734841-47734863 TTGAATAAAAGCACTTATTTAGG + Intronic
1177819814 21:26018646-26018668 CTGAACAAAAGCTCTAATTGAGG - Intronic
1178231199 21:30786825-30786847 TAGAAGAAAATCTGTGCTTCAGG + Intergenic
1180027228 21:45173337-45173359 TTGAAGAAAAGCTGTGAAAGTGG + Intronic
1184321633 22:43746388-43746410 ATGAAGCAAAACTCTGGTTCGGG + Intronic
950981753 3:17314647-17314669 TTGAAGTGAAGCTCTGACCCAGG - Intronic
952161270 3:30695685-30695707 ATGAAGAAAAGCTCTGCTACTGG + Intergenic
952833530 3:37585227-37585249 TTGAAGGAAACATCTGCTTCTGG + Intronic
953156574 3:40380629-40380651 TTGAAAAAAATTTGTGATTCTGG - Intergenic
953208690 3:40854972-40854994 TTTAAGCAAAGCTCTGATCGAGG - Intergenic
955021212 3:55123150-55123172 TAGAAGAAAAGATCAGATTTAGG + Intergenic
955678530 3:61475365-61475387 AGGAAGAAAAACTGTGATTCAGG - Intergenic
956484995 3:69712612-69712634 TGGAAGAAAATCTCTGTTTCAGG - Intergenic
956585248 3:70857270-70857292 TTGAAGGAATGATTTGATTCAGG + Intergenic
956897238 3:73675214-73675236 TGGAAGAAAAGTTCTGCTTAGGG + Intergenic
958659322 3:97045245-97045267 TTAAAGAAAATATCTGATACTGG + Intronic
959317669 3:104829022-104829044 AAGAAGAAAAGCTCTGAATAAGG - Intergenic
961338414 3:126199998-126200020 CTCCAGAAAAGCCCTGATTCTGG + Intergenic
962260364 3:133898283-133898305 TCAAAGAAAAGCTAAGATTCTGG - Intergenic
963452970 3:145508072-145508094 TTGAAGCAAAGATCAGATTAAGG - Intergenic
964747879 3:160028822-160028844 TTGAATAAAAACTCTGATTTTGG + Intronic
964907571 3:161736655-161736677 TTGAAGAGGAGATCTGATTTAGG - Intergenic
966207701 3:177421756-177421778 GTCAAGAAAAGCTATTATTCTGG - Intergenic
966503186 3:180669525-180669547 TTATAGAAATGCTCTGAATCTGG - Intronic
966504921 3:180689198-180689220 TTATAGAAATGCTCTGAATCTGG - Intronic
967253165 3:187563865-187563887 TTGAGGAGGAGCTGTGATTCGGG + Intergenic
967300211 3:188005146-188005168 CTGCAGAAAGACTCTGATTCAGG + Intergenic
968789885 4:2652258-2652280 TTGCAGAGAAGCTTTGAGTCTGG + Intronic
971401398 4:26279144-26279166 TTGAAGAAAATGTCTGTTACAGG + Intronic
971916879 4:32882344-32882366 ATGAAGAAAAGCAGTGATTTAGG + Intergenic
973690985 4:53431340-53431362 ATGAAAGAAAGCTATGATTCAGG + Intronic
973720075 4:53714507-53714529 ATGCAGAGAAGCTCTGATTTAGG - Intronic
974895683 4:67935369-67935391 TTGAAGGATAGTTGTGATTCAGG - Intronic
976683803 4:87788070-87788092 TTGAATACATGCTCTAATTCAGG + Intergenic
977445851 4:97130979-97131001 ATAAAGAAAAGCTCTGGCTCTGG - Intergenic
977554603 4:98476108-98476130 TTTAAGCAAAGCTCCGATCCTGG + Intronic
978588200 4:110295234-110295256 TTGAAGAGATGTGCTGATTCTGG - Intergenic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
980098435 4:128517530-128517552 TTGAATAAGAGCTTTGAGTCAGG - Intergenic
980105798 4:128587265-128587287 CCGCAGAAAAACTCTGATTCTGG - Intergenic
980410856 4:132416404-132416426 ATGAAGAAAAGCTGTGATATGGG - Intergenic
981091764 4:140739587-140739609 TTGCCGAAAATCTGTGATTCAGG - Intronic
981144306 4:141307314-141307336 TTGAAGAGAAGTTCTGCTGCTGG + Intergenic
983053323 4:163074057-163074079 TAGAAGAAAAGCTCTAGATCTGG + Intergenic
983981302 4:174000640-174000662 TTGAAGAAAAATTATGACTCTGG + Intergenic
984191762 4:176614071-176614093 TTTAGCAAAAGCTCTGATGCAGG + Intergenic
984528251 4:180882916-180882938 TTGAAGAGAGTCTCTGATTTTGG - Intergenic
987409813 5:17603849-17603871 GAGAAGAAAATCTCTGACTCAGG - Intergenic
988211129 5:28205206-28205228 TTGTTCAAAAGCTCTGAATCAGG + Intergenic
989701251 5:44267489-44267511 TTGCTGAAAAGTTCTGACTCAGG - Intergenic
989813535 5:45707953-45707975 ATGCTGAAAAGCTCAGATTCTGG - Intergenic
990704100 5:58508147-58508169 TTGATGAGAAGCTCTGGTTGTGG - Intergenic
990832930 5:59980863-59980885 TTCAAGAATTGCCCTGATTCTGG + Intronic
991450026 5:66741834-66741856 TGAAAGAACAGCTCTGATTTAGG - Intronic
995233453 5:109798239-109798261 TTGAAGAAAAACTATTATTTAGG - Intronic
995282874 5:110355367-110355389 TTGAGGTACAGCTCTGATTAGGG + Intronic
995433638 5:112110627-112110649 TGGAAGCAAAGTTCTGATCCAGG + Intergenic
995953562 5:117746798-117746820 TTGAATAAAAATTCTGATTCAGG + Intergenic
996003710 5:118394568-118394590 CTGAAACAAAGCTCTGAATCTGG + Intergenic
996447831 5:123577208-123577230 TTGGAGAAAAGGACTGATTATGG - Intronic
998706605 5:144769204-144769226 TGGAAGAAACTTTCTGATTCTGG - Intergenic
999684759 5:154092221-154092243 TTACAGAAAAGGTCAGATTCTGG - Intronic
1001225730 5:169943257-169943279 TTGAAGAAAACCCAGGATTCTGG + Intronic
1002845185 6:939159-939181 TAGAAGGAAAGCTATTATTCAGG - Intergenic
1002953230 6:1836758-1836780 TTGCAGCCAAGCTCTCATTCAGG + Intronic
1004246043 6:13977058-13977080 TTGAAGAATGGCTTTGATTAAGG - Exonic
1004444263 6:15683751-15683773 TTGAAGAAAACCTCTCTTCCTGG + Intergenic
1004891591 6:20106191-20106213 TTTAAGAAAATCCCTGAATCTGG - Intronic
1005326370 6:24705041-24705063 ATGAAGAAAAGCTTTGCTTAAGG - Exonic
1005671404 6:28109609-28109631 TTGAAGAATAGCTATGAATTGGG - Intergenic
1006540588 6:34736805-34736827 TGGAAGACAAGCTCTCAATCTGG - Intergenic
1006873884 6:37278632-37278654 TAGAAGAAAAGCTATGGATCAGG + Intronic
1007232664 6:40359209-40359231 CAGAAGAAAACCTCTGGTTCTGG - Intergenic
1008086460 6:47250339-47250361 GGGAAGAATAGCTATGATTCTGG + Intronic
1010192758 6:73210326-73210348 GTGAAGAAAATTTTTGATTCCGG - Intronic
1011690232 6:89860097-89860119 CTGAAGGAAGGATCTGATTCAGG + Intronic
1011859356 6:91736017-91736039 TAGAATAAAACTTCTGATTCTGG - Intergenic
1012327955 6:97947047-97947069 TTAAAGCAAATCTCTAATTCTGG - Intergenic
1012531798 6:100246716-100246738 TTGAAGATATGCTTTGATTCTGG - Intergenic
1012985448 6:105870833-105870855 TAGAGGAAAAGCTCTGAGGCAGG - Intergenic
1017687101 6:156924468-156924490 TTGAACACAAGCACTGATACTGG + Intronic
1018992252 6:168683088-168683110 GGAAGGAAAAGCTCTGATTCTGG - Intergenic
1019690320 7:2406827-2406849 CTGAAGAAAACCTCTGCTACAGG + Intronic
1020445590 7:8263605-8263627 TTGTTGAAAAGCTAAGATTCAGG + Intergenic
1022941676 7:35247785-35247807 TTAAAGAAAAGCTATGAGGCTGG + Intronic
1024162531 7:46691801-46691823 TTGAAGACAGGCTCTGACTGAGG - Intronic
1025023419 7:55497370-55497392 GGGAAGAAGAGCTCTGCTTCTGG - Intronic
1026192321 7:68140572-68140594 TTGAGAAATAGCTCTGCTTCTGG - Intergenic
1027388845 7:77685207-77685229 TTGAAGAAAAGCTGTGATACCGG + Intergenic
1031163187 7:118193791-118193813 TTTGAGAAAAGATCTGACTCTGG - Intergenic
1031516060 7:122700539-122700561 TTGATGAAAATTTCTGTTTCTGG - Intronic
1031822605 7:126523154-126523176 TTAAAGAAAATCTTTGATGCAGG - Intronic
1032022720 7:128418821-128418843 TTGAAGAAGAGCTAGGATTTAGG + Intergenic
1035560155 8:598267-598289 TTGAAGATAAGCTAGGGTTCTGG - Intergenic
1035750695 8:1994116-1994138 TTGTATAAAAGCTCTTCTTCAGG + Intronic
1037005179 8:13769368-13769390 TTGAAGAAAATCACTTCTTCTGG + Intergenic
1037972552 8:23183660-23183682 ATGAAGAAAAACTGTGATACGGG - Intergenic
1038667571 8:29553235-29553257 TTAAAGAAAGGCTCTTATTTTGG - Intergenic
1039038128 8:33381949-33381971 TTGAAGGTGCGCTCTGATTCGGG - Intronic
1041516577 8:58705975-58705997 TTGAAAAAAAGCTATGTTTGTGG - Intergenic
1042094331 8:65196208-65196230 TTGAAGAAAAGTTCTAAATGAGG + Intergenic
1044388975 8:91626365-91626387 TTCAATAAAAACTCTGATTCTGG - Intergenic
1046306986 8:112381748-112381770 TTGATTAAGAGCTCTAATTCTGG + Intronic
1050204489 9:3182354-3182376 TTGAAGAAAAGGTCCGTTTATGG - Intergenic
1050833882 9:10051222-10051244 TTGAAGAAAAGAGTTGTTTCGGG + Intronic
1051967909 9:22851403-22851425 TTGAAGAAAGGATCTTACTCTGG + Intergenic
1052631083 9:31040006-31040028 TACAATAAAAGCTCTGATTTCGG + Intergenic
1052791686 9:32880831-32880853 TAGAAATAAAACTCTGATTCTGG + Intergenic
1053655376 9:40213861-40213883 TGGGAGAAATGCACTGATTCTGG + Intergenic
1053905755 9:42843085-42843107 TGGGAGAAATGCACTGATTCTGG + Intergenic
1054367493 9:64360074-64360096 TGGGAGAAATGCACTGATTCTGG + Intergenic
1054675118 9:67849813-67849835 TGGGAGAAATGCACTGATTCTGG + Intergenic
1054931828 9:70642985-70643007 TTGAAGAGCATTTCTGATTCTGG + Intronic
1056995450 9:91453112-91453134 GTGAAGGAAAGATCTGTTTCAGG + Intergenic
1057372337 9:94485422-94485444 TGGGAGAAATGCACTGATTCTGG + Intergenic
1057693826 9:97309896-97309918 TGGCAGAAAAGCTCTGATTAAGG + Intronic
1060444276 9:123673513-123673535 TTGAAGAAATAACCTGATTCTGG - Intronic
1060579015 9:124726759-124726781 TTGAGAAAAACCTTTGATTCAGG + Intronic
1061472701 9:130839742-130839764 TTGAGGGAAAGCTCTGAAACTGG + Intronic
1203612588 Un_KI270749v1:23021-23043 TTGAAGAAAAACTTTGAATGTGG - Intergenic
1187313029 X:18164787-18164809 TTGATGACAACCTCTGATTGAGG - Exonic
1187587813 X:20683542-20683564 TTGCAGAAGAGCTGGGATTCAGG + Intergenic
1189166308 X:38864544-38864566 TTCTTGAAAAGCTCTGATTAGGG - Intergenic
1190259922 X:48791191-48791213 GGGAAGAAAACCCCTGATTCTGG - Exonic
1197020587 X:121683224-121683246 TTGAAAGGAAGATCTGATTCTGG - Intergenic
1197166079 X:123379159-123379181 TAGGAGAAATGTTCTGATTCAGG - Intronic
1198141034 X:133803607-133803629 ATGAAAAATAGGTCTGATTCAGG + Intronic