ID: 902224689

View in Genome Browser
Species Human (GRCh38)
Location 1:14989141-14989163
Sequence CAGTGACTCGGGGTCACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902224682_902224689 16 Left 902224682 1:14989102-14989124 CCTTCCCACACAAGCTCAGAGGA 0: 1
1: 1
2: 3
3: 33
4: 243
Right 902224689 1:14989141-14989163 CAGTGACTCGGGGTCACCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 130
902224683_902224689 12 Left 902224683 1:14989106-14989128 CCCACACAAGCTCAGAGGAGCAG 0: 1
1: 0
2: 2
3: 14
4: 208
Right 902224689 1:14989141-14989163 CAGTGACTCGGGGTCACCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 130
902224679_902224689 29 Left 902224679 1:14989089-14989111 CCTCATGTACCTGCCTTCCCACA 0: 1
1: 0
2: 1
3: 37
4: 272
Right 902224689 1:14989141-14989163 CAGTGACTCGGGGTCACCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 130
902224680_902224689 20 Left 902224680 1:14989098-14989120 CCTGCCTTCCCACACAAGCTCAG 0: 1
1: 0
2: 3
3: 23
4: 315
Right 902224689 1:14989141-14989163 CAGTGACTCGGGGTCACCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 130
902224684_902224689 11 Left 902224684 1:14989107-14989129 CCACACAAGCTCAGAGGAGCAGT 0: 1
1: 0
2: 2
3: 16
4: 154
Right 902224689 1:14989141-14989163 CAGTGACTCGGGGTCACCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902224689 Original CRISPR CAGTGACTCGGGGTCACCCT GGG Intronic
901218144 1:7566214-7566236 GAGTGCCTGGGGGTCACCCAGGG - Intronic
901311232 1:8270951-8270973 CAGTGTCTGAGGGTCACGCTGGG + Intergenic
902224689 1:14989141-14989163 CAGTGACTCGGGGTCACCCTGGG + Intronic
902225586 1:14994518-14994540 CAGTGACTCCGGGTCACCCCGGG + Intronic
905168936 1:36098757-36098779 CAGGGACCCGGGGCCCCCCTGGG - Exonic
907240947 1:53080765-53080787 AAGTGACTCGGGGAGCCCCTCGG - Exonic
908102815 1:60808802-60808824 CAGTATCTCAGAGTCACCCTTGG - Intergenic
908975739 1:69895571-69895593 CAGTGCCTTGGGGACACCGTTGG - Intronic
912950687 1:114118408-114118430 CAGTGCCTCGGCTTCTCCCTGGG - Intronic
914860481 1:151381811-151381833 CAATCATTTGGGGTCACCCTGGG - Intergenic
919823955 1:201490662-201490684 CTGTGGCTTGGGGTCAGCCTAGG - Intronic
919981380 1:202644423-202644445 CTGTGCCTCAGTGTCACCCTTGG + Intronic
923189400 1:231606183-231606205 CAGTTACTCCAGCTCACCCTGGG + Intronic
1062854723 10:774151-774173 CAGTGATTCGGGGACATTCTTGG + Intergenic
1063093165 10:2885970-2885992 CTGGGACTCAGGGGCACCCTAGG + Intergenic
1067091520 10:43267964-43267986 GAGTCACTCTGGGCCACCCTGGG - Intergenic
1069720138 10:70544593-70544615 CAGAAACTCGAGGTCATCCTAGG - Intronic
1072420837 10:95289965-95289987 CACTGAGTCTGGGTCTCCCTGGG + Intronic
1072519057 10:96214282-96214304 CAGTGTCTTGGGCTCAGCCTTGG + Intronic
1072720188 10:97775599-97775621 AAGAGTCTCGGGGTCCCCCTGGG - Intergenic
1074115819 10:110456965-110456987 CAGTGACTGTGTTTCACCCTGGG - Intergenic
1076667020 10:132099046-132099068 CTGTGATTCGGGGGCATCCTGGG - Intergenic
1077453340 11:2663873-2663895 CACTGGCTTGGGGTCACCCTTGG - Intronic
1083645149 11:64167809-64167831 TGGTGACACGGGCTCACCCTTGG + Intergenic
1090314546 11:125773597-125773619 CATTGGCTGTGGGTCACCCTTGG + Intergenic
1095566497 12:43630287-43630309 CTGTGACTGGGGCTCACCCCTGG + Intergenic
1096115041 12:49050668-49050690 CAGTGACCCTGAGTCACCGTTGG - Exonic
1097780377 12:63696673-63696695 CAGTACCTCGTGGTCACCCAGGG - Intergenic
1101987827 12:109461306-109461328 CAGTGTCTAGGGCTCAGCCTTGG - Intronic
1102164437 12:110795176-110795198 CAGGCAGTCAGGGTCACCCTTGG + Intergenic
1103924665 12:124416845-124416867 CTGTGCCACGGGGTCTCCCTGGG - Intronic
1108467321 13:50729442-50729464 CAAAGACATGGGGTCACCCTAGG - Intronic
1110640607 13:77819669-77819691 CAGTGACTGGTGGTCACTCTTGG + Intergenic
1113886091 13:113659008-113659030 CAGTACCTCGGGGTCACCGGGGG + Intergenic
1117452460 14:55865089-55865111 CAGTGGCTCTGGGTGTCCCTGGG - Intergenic
1121111191 14:91314201-91314223 CAGTGACATGGGCTCACACTGGG + Intronic
1122283185 14:100636267-100636289 CAGTGACCCGGGGTGGCCCTTGG + Intergenic
1123222950 14:106873349-106873371 CAGTCTTTCGGGTTCACCCTGGG + Intergenic
1123937295 15:25200135-25200157 CAGGGACTCTGGGACACCATGGG + Intergenic
1125735753 15:41924414-41924436 CAGTGTCTTGGGGCTACCCTAGG + Intronic
1132313908 15:100877404-100877426 CAGTGACATGGGACCACCCTGGG + Intergenic
1132980512 16:2736680-2736702 CAGTGACTGGGGGGCATCCCGGG + Intergenic
1136398831 16:30006957-30006979 CACAGACTCAGGGTCAGCCTGGG + Intronic
1136626844 16:31466666-31466688 CACTGACTCCGGGCCACCCTGGG - Exonic
1144455175 17:15412739-15412761 GAGTGACTGGCGGTCACTCTGGG + Intergenic
1144947682 17:18978163-18978185 CAATGGCTCAGGGTCCCCCTGGG + Exonic
1145994156 17:29096050-29096072 CAGTGACCCTGGGTTACCCCCGG - Intronic
1146492617 17:33293089-33293111 CAGCGAGTCCGGGTCACCCCCGG - Intronic
1148980118 17:51566485-51566507 CAGTGCCCCGTGGTCACCCTTGG + Intergenic
1150608390 17:66713787-66713809 CAGTGACTGGGGGCCAGACTCGG - Intronic
1151784761 17:76270139-76270161 CAGTGGCTCGGGGACCCCCGAGG + Intronic
1152278471 17:79371758-79371780 CTGGGGCTTGGGGTCACCCTTGG + Intronic
1153842354 18:9018053-9018075 CAGTGGCTCCGGTTCACCCTGGG - Intergenic
1156381327 18:36564073-36564095 CACTGACTCGGTGTCACCCCAGG + Intronic
1156466144 18:37348857-37348879 CAGTCACTCAAGGCCACCCTGGG + Intronic
1157404263 18:47410204-47410226 CAGTGCCTGGGGGTCTCTCTGGG + Intergenic
1157860334 18:51135410-51135432 CAGTTACCCGAGGTCAGCCTCGG + Intergenic
1160660949 19:298779-298801 CAGTGACTGTGGGACACCCATGG + Intergenic
1160660967 19:298858-298880 CAGTGACTGTGGGTCACCCAGGG + Intergenic
1160660993 19:298978-299000 CAGTGACTGTGGGACACCCATGG + Intergenic
1160661137 19:299590-299612 CAGTGACTGTGGGACACCCATGG + Intergenic
1160661177 19:299790-299812 CAGTGACTGTGGGACACCCAGGG + Intergenic
1160661199 19:299910-299932 CAGTGACTGTGGGACACCCATGG + Intergenic
1160661383 19:300729-300751 CAGTGACTGTGGGACACCCATGG + Intergenic
1161297047 19:3525386-3525408 CAGTCACTCGTGGTCACTCATGG - Intronic
1161932569 19:7350439-7350461 CTGTGACTGGGAGTCACTCTGGG + Intronic
1164848133 19:31451986-31452008 CAGTTACCCAGGGTCAACCTTGG - Intergenic
1167360545 19:49028234-49028256 AGGTGAATCGGGGTCTCCCTAGG - Intronic
1167363103 19:49040566-49040588 AGGTGAATCGGGGTCTCCCTAGG + Intergenic
1168669166 19:58228449-58228471 CAGGGACTCAGGGACAGCCTGGG - Intergenic
927135594 2:20094091-20094113 CAGTGAGTGGGGGGCAGCCTGGG + Intergenic
928603053 2:32920220-32920242 CAGTAACTGGTGGTCACCCCAGG + Intergenic
933403112 2:81823656-81823678 AAGTGACTCAGGGTCACATTTGG - Intergenic
933906172 2:86895502-86895524 CAGTGAGCCGAGATCACCCTGGG - Intergenic
937890446 2:126934578-126934600 CAGTTACTCGTGGTCAACCTTGG - Intergenic
944210885 2:197205519-197205541 CAGTGACTGGCAGTCACCTTGGG - Intronic
1171334247 20:24369407-24369429 TAGTGACTCTGTGTCACCTTTGG + Intergenic
1171386684 20:24774201-24774223 CAGTGACTCTGGCTCAACCTGGG - Intergenic
1172135746 20:32685568-32685590 CACTGACTTGGGGCCACTCTGGG - Intergenic
1172894241 20:38288275-38288297 CAGTTACCCGTGGTCAACCTCGG - Intronic
1174702534 20:52623635-52623657 CAGGAATTCGGGGCCACCCTGGG + Intergenic
1175637605 20:60598763-60598785 ACGTGACTTGGGGTCACCCTGGG - Intergenic
1175915798 20:62425186-62425208 AGGTGAATCGGGGTCTCCCTCGG - Intronic
1179584594 21:42366511-42366533 CCCTGACTCGGGGTCGCCTTTGG - Exonic
1180079695 21:45481004-45481026 TGCTGACTCGGGGCCACCCTGGG + Intronic
1181571765 22:23771789-23771811 CACTGACGAGGGGACACCCTGGG + Intronic
1184390389 22:44200273-44200295 CAGTGACCCGGGGTAAGCCTTGG - Intronic
1184734080 22:46387958-46387980 CAGAGGCTGAGGGTCACCCTCGG - Intronic
951893964 3:27593578-27593600 CTGTGAGTCGAGGTCAGCCTGGG - Intergenic
953855621 3:46497397-46497419 CAGTGACTCTGGGTTTGCCTAGG + Intergenic
955266685 3:57450943-57450965 CATTGACTAAGGGTCACCCCTGG - Intronic
956319446 3:67980342-67980364 CAGTGATTGGGATTCACCCTGGG - Intergenic
956798665 3:72738162-72738184 CAGTGAGTAGGGGTCACCCAGGG - Intergenic
961408321 3:126699157-126699179 CAGAGTCTCATGGTCACCCTTGG + Intergenic
961480262 3:127174943-127174965 CAGTCACTGGGGGTCAACCAGGG + Intergenic
968461158 4:725772-725794 CAGCGACTCGGGTTTCCCCTGGG - Intronic
968619151 4:1595929-1595951 CAGTGACCAGGGGTCACACCCGG - Intergenic
972667917 4:41184722-41184744 CAGTTCCTTGGGGTCAGCCTTGG + Intronic
973706774 4:53588888-53588910 CAATGACTCAAGGTCACCCAAGG + Intronic
978081378 4:104596420-104596442 CAGTTACTTGTGGTCAACCTTGG + Intergenic
978443457 4:108758692-108758714 CAGCGCCTCGGGGTCAGCGTGGG - Intronic
981288180 4:143044732-143044754 CAGTCACGTGGGGTCAGCCTTGG - Intergenic
985016508 4:185641459-185641481 CAGTGCCTCCAGGTCACCATAGG - Intronic
985665943 5:1181597-1181619 CAGTGACTCAGGGTCCACCGTGG + Intergenic
986304750 5:6506859-6506881 CACTGACTCGGGGCCAGCCTGGG + Intergenic
986443272 5:7799470-7799492 CAGTGACCTGAGCTCACCCTGGG + Intronic
990083112 5:51941122-51941144 CAGTGAGTCAGGGTCATTCTTGG - Intergenic
996648794 5:125848350-125848372 GAGTGACTCTGGGTAGCCCTGGG + Intergenic
997065676 5:130556095-130556117 CAGTGGCTCTGTGTCTCCCTGGG + Intergenic
997350833 5:133230327-133230349 CACTGACTCAGGGTCTCCCTTGG - Intronic
998490314 5:142540817-142540839 CAGAGACTCAGGGTCTCACTTGG + Intergenic
999559368 5:152783529-152783551 CAGTGACTCAGAGTCCCACTAGG - Intergenic
1002347110 5:178555787-178555809 TAGTGACTCGGGGGCATCCCAGG - Intronic
1003596877 6:7481794-7481816 CAGTGAGGGGGAGTCACCCTTGG - Intergenic
1004330045 6:14713138-14713160 CAGGGTCTCGGAGTCACCCTGGG - Intergenic
1004479371 6:16004312-16004334 CAGTGATCCGGAGTGACCCTAGG + Intergenic
1006884057 6:37365454-37365476 CAGTGCCTAGGTTTCACCCTCGG - Intronic
1007609780 6:43142006-43142028 CAGCGGCTTGGGGTCCCCCTGGG - Exonic
1013111498 6:107068665-107068687 CAGAGATTCGGGGTCACCAGAGG - Exonic
1018851988 6:167647307-167647329 CAATGACTGGGAGTCACCATGGG - Intergenic
1019299896 7:297630-297652 CAGTGTCCCGGGGTCAGCCCAGG + Intergenic
1019449956 7:1092371-1092393 CAGTGGCTCGAGGTCACGCTGGG + Exonic
1022938955 7:35212748-35212770 CAGTAACTTGTGGTCACCCAGGG - Intronic
1026477767 7:70751465-70751487 CAGTGCCTTGGTCTCACCCTTGG + Intronic
1029362804 7:100099676-100099698 CACCAACTCGGGGTCATCCTCGG + Exonic
1030640549 7:112001234-112001256 CAGTTACTCATGGTCAACCTGGG + Intronic
1034585032 7:152083015-152083037 CAATTACTGGGGGTCACCTTAGG - Intronic
1035401490 7:158569265-158569287 CAGGGACACGGGGCCTCCCTGGG - Intronic
1035712789 8:1731274-1731296 CAGTGCCTTGGGGTCTTCCTTGG - Intergenic
1035757556 8:2045467-2045489 CACTGACTGGGGGGCCCCCTGGG - Intronic
1037817591 8:22120250-22120272 CAGCCCCTCGGGGTCACCCTGGG + Intronic
1043020041 8:74988806-74988828 CAGTGTCTCGCTGTCACCCAGGG - Intronic
1045363301 8:101452728-101452750 TAGAGACTCGGGGTAACTCTGGG - Intergenic
1048931478 8:139318891-139318913 CAGTGGCTCTGAGTCACCATGGG + Intergenic
1049322393 8:142003488-142003510 AAGTGACTTGGGGTCACCAGAGG + Intergenic
1050706363 9:8403423-8403445 CAGTCAACCTGGGTCACCCTTGG - Intronic
1050851843 9:10297513-10297535 CTGTTACTCAGGCTCACCCTGGG - Intronic
1053034180 9:34810265-34810287 CAGTGACACGGGGGCCACCTTGG - Intergenic
1055004621 9:71491481-71491503 CAGTTACTCTGGGTCAACCATGG + Intergenic
1056243054 9:84668660-84668682 CAGAGCCTCGGGGTCTCACTAGG - Intronic
1057305646 9:93910662-93910684 CAGTGACTCTGGGTCTGACTGGG + Intergenic
1057842410 9:98496568-98496590 CAGTTCCGAGGGGTCACCCTGGG + Intronic
1058816372 9:108686372-108686394 CAAGGATTGGGGGTCACCCTAGG - Intergenic
1062615889 9:137395516-137395538 CAGCGACTGGGGGTCCCACTTGG - Intronic
1186286963 X:8055342-8055364 GAGTAACTTGGGGTAACCCTTGG + Intergenic
1187936597 X:24342235-24342257 GAGTGTCTGGGGGTCTCCCTGGG + Intergenic
1189740280 X:44110778-44110800 CAGTGACTGGGGCTAGCCCTAGG + Intergenic
1190116549 X:47629410-47629432 CAGGGCCTCAGGGCCACCCTTGG + Intronic
1197702546 X:129610169-129610191 CAGGGCCTCAGGGCCACCCTGGG - Intergenic
1201731449 Y:17208720-17208742 CAGTGACCAGGGGTCATCTTGGG + Intergenic