ID: 902230431

View in Genome Browser
Species Human (GRCh38)
Location 1:15023930-15023952
Sequence GTTGCTCTGGCCTTAAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902230431_902230436 12 Left 902230431 1:15023930-15023952 CCAGAGTTTAAGGCCAGAGCAAC 0: 1
1: 1
2: 0
3: 8
4: 151
Right 902230436 1:15023965-15023987 GCCACTGTGAACTGAGTTTGAGG 0: 1
1: 0
2: 0
3: 21
4: 166
902230431_902230435 -10 Left 902230431 1:15023930-15023952 CCAGAGTTTAAGGCCAGAGCAAC 0: 1
1: 1
2: 0
3: 8
4: 151
Right 902230435 1:15023943-15023965 CCAGAGCAACAGGAAGGCTAAGG 0: 1
1: 0
2: 1
3: 27
4: 267
902230431_902230438 13 Left 902230431 1:15023930-15023952 CCAGAGTTTAAGGCCAGAGCAAC 0: 1
1: 1
2: 0
3: 8
4: 151
Right 902230438 1:15023966-15023988 CCACTGTGAACTGAGTTTGAGGG 0: 1
1: 0
2: 0
3: 14
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902230431 Original CRISPR GTTGCTCTGGCCTTAAACTC TGG (reversed) Intronic
901555202 1:10026374-10026396 GATTCTCTGGCCTCAACCTCCGG + Intergenic
902230431 1:15023930-15023952 GTTGCTCTGGCCTTAAACTCTGG - Intronic
903782458 1:25829985-25830007 GTTGCTCTTTCCTCAAACTGGGG - Intronic
906523007 1:46478311-46478333 GTTGCTGTGACCTCACACTCAGG - Intergenic
906775911 1:48529531-48529553 GTTGGCCTGACTTTAAACTCGGG + Intergenic
907533191 1:55122730-55122752 GTTGCTCTGGCCAAAAACCTTGG - Intronic
908161466 1:61412514-61412536 GTTGCTCAGGTCATAAACACAGG - Intronic
909331830 1:74422598-74422620 GTTGAAGTGGCCCTAAACTCAGG - Intronic
913104332 1:115597913-115597935 GTTCCTATGGCCTTATGCTCAGG - Intergenic
913464321 1:119124101-119124123 GTTGCTCTGGCCAGAAACTTTGG + Intronic
916549651 1:165837907-165837929 GTTGCTCAGGCCTAAAACCTCGG + Intronic
921907621 1:220511935-220511957 GTTGCTATTGCCTCACACTCAGG + Intergenic
923555547 1:234997857-234997879 GCAGCTCTGGCCTGAAACTGGGG + Intergenic
924022394 1:239798126-239798148 GTTGCTCAGGCTTAAAACTTGGG + Intronic
1062902323 10:1155874-1155896 GCTGCTCTGGCCATAAAACCAGG - Intergenic
1065168931 10:23009120-23009142 CTGGCTCTGGCCAAAAACTCTGG + Intronic
1065263357 10:23949857-23949879 GGTGAACTGGCATTAAACTCTGG + Intronic
1065308924 10:24395515-24395537 GGTGCACTGGCCTTAAGCACTGG - Intronic
1065484587 10:26225518-26225540 GTTGCTCTGGCCTCTCTCTCAGG - Intronic
1070114643 10:73516788-73516810 TCTTCTCTTGCCTTAAACTCTGG - Exonic
1071599412 10:86950391-86950413 GGTGCTCAGGCCCTAAGCTCAGG - Intronic
1073083782 10:100875638-100875660 GTTGCTCTGACCAGAAACTAAGG - Intergenic
1075197926 10:120377423-120377445 GATGCTTAGGCCATAAACTCAGG + Intergenic
1077711760 11:4544382-4544404 GTTGCTCTGGACTTCAAGTAAGG + Intergenic
1078132143 11:8621610-8621632 TTTGCCTTGGCCTTAAACCCTGG - Intronic
1078325983 11:10381128-10381150 GTTGCTCTTGACTGAAGCTCTGG - Intronic
1078666734 11:13331959-13331981 GTTGGTCTGGGCCTAAACTAAGG + Intronic
1079072066 11:17356039-17356061 GATCCTCTGGCCTCAGACTCTGG + Intronic
1081603482 11:44511817-44511839 GTTGGTGTGACCTTGAACTCAGG - Intergenic
1083193392 11:61068548-61068570 GGTGCTCTGGCCAAAAACTGTGG + Intergenic
1083946533 11:65926386-65926408 GTGGGTCTGGACTTAAACACAGG + Intergenic
1084143685 11:67251468-67251490 GTTGGTTTTTCCTTAAACTCTGG + Intronic
1086157690 11:83685895-83685917 GTTGCTCTGGCCAAAAACCTGGG + Intronic
1086657634 11:89379688-89379710 GTTGCTCGGACCAAAAACTCTGG + Intronic
1087162191 11:94959572-94959594 GTTGCTCAGGCCCCACACTCAGG - Intergenic
1093005123 12:14043324-14043346 TTTGCTCTTGCCTTCATCTCAGG - Intergenic
1095246913 12:39933761-39933783 GTTGCTCAGGCCTCAAATCCAGG - Intronic
1095802220 12:46281242-46281264 GTGGCCATGGCCTTAGACTCTGG - Intergenic
1097356399 12:58607241-58607263 GTTGCTCAGGCCAAAAACTTAGG + Intronic
1100614456 12:96220273-96220295 GGTGCTATGGCCATAACCTCAGG - Intronic
1100828660 12:98498032-98498054 GTTGCTCAGGCCAAAAATTCTGG + Intronic
1101397382 12:104360225-104360247 GTTGCTCTGTGGTTAAGCTCTGG + Intergenic
1102481612 12:113227630-113227652 GTTGCTCAGGCCTTGGGCTCAGG + Intronic
1110416844 13:75262415-75262437 CTTTCTCTAGCCTTATACTCTGG - Intergenic
1111610647 13:90602769-90602791 GCTGCTCTGGCCATAGACTATGG - Intergenic
1113127812 13:106999830-106999852 GTTGCTTGGGTCTAAAACTCCGG + Intergenic
1113164247 13:107420010-107420032 GTGACTCTGGGTTTAAACTCCGG + Intronic
1117833619 14:59779242-59779264 GTTGGCCTTGCCCTAAACTCTGG - Intronic
1118091238 14:62481806-62481828 GTTGTTCTTGTCTTATACTCTGG + Intergenic
1122838393 14:104442541-104442563 ATAGCCCTGGCCTGAAACTCTGG - Intergenic
1125685748 15:41562243-41562265 GATCCTCTGGCCTTAGCCTCCGG - Intronic
1134313479 16:13097280-13097302 TTAGATCTGGCCTTAAACCCAGG + Intronic
1138015742 16:53426768-53426790 GTTGGGCTGGTCTTGAACTCTGG - Intergenic
1138243407 16:55447078-55447100 GTTTCTCTGGCTCTGAACTCTGG - Intronic
1138593462 16:58016267-58016289 GTTGTTCTAGCCTCAAACCCAGG - Intronic
1139762305 16:69195374-69195396 GATCCTCTTGCCTTAACCTCTGG + Intronic
1144490308 17:15702972-15702994 TTTTCTCTGGCCTTCAACACAGG - Intronic
1144685530 17:17223627-17223649 TTTCCTCTGGCCTTCATCTCAGG - Intronic
1144910656 17:18678989-18679011 TTTTCTCTGGCCTTCAACACAGG + Intronic
1153158514 18:2176713-2176735 GTTGCATTGGATTTAAACTCAGG + Intergenic
1155086560 18:22464478-22464500 GGTGACCTGGCCCTAAACTCAGG - Intergenic
1155986971 18:32240011-32240033 GATCCTCTTGCCTAAAACTCTGG + Intronic
1163374990 19:16924536-16924558 GTTGCTCTAGGCTGAAAGTCTGG - Intronic
1164503237 19:28836793-28836815 GTTGCTCGGGCCTCGAACTTAGG + Intergenic
927085342 2:19669694-19669716 GTTGCTCTGCCTTTGACCTCAGG + Intergenic
927092091 2:19719856-19719878 GATGCTCTGGCCCTTATCTCAGG - Intergenic
930905505 2:56561752-56561774 GTTGGCCAGGCCTTGAACTCTGG + Intergenic
930920365 2:56746263-56746285 GTTGGTCTGGCCTATAACCCTGG - Intergenic
935817389 2:106859552-106859574 GTTGCCCAGGTCTAAAACTCTGG + Intronic
937094793 2:119228462-119228484 GCTGCTCTGGCCTTTCACCCAGG - Intronic
937730637 2:125224656-125224678 GTTTCTCTGGTCTTGAACACAGG + Intergenic
938173345 2:129102288-129102310 GTTGGCCTGGCCTAACACTCAGG - Intergenic
938741235 2:134234497-134234519 GTGGCTCTGTCCTTCAACTAGGG + Intronic
940147559 2:150562956-150562978 GATGCTCTTGTCTTAAAATCTGG + Intergenic
942050983 2:172140853-172140875 CTTACTATGGCCTCAAACTCTGG + Intergenic
943697371 2:190950763-190950785 CTTGCTCAGGCCACAAACTCAGG - Intronic
944162127 2:196674508-196674530 GGTGATTTGGCCTTACACTCAGG + Intronic
944958764 2:204843703-204843725 GCTTCTCTGGCTTTAAACTCTGG - Intronic
1168917837 20:1505775-1505797 CTTGTTCTGGCCTCAAACCCAGG - Intergenic
1169390894 20:5190135-5190157 GCTGATCTGGCCGTAAAGTCAGG - Exonic
1179935905 21:44603165-44603187 GAGGCTGTGGCCTGAAACTCTGG + Intronic
1181545282 22:23598915-23598937 GAGGCTCTGGCCTGAAAGTCAGG + Intergenic
1182418697 22:30238062-30238084 CTGGCCCTGGCCTTGAACTCAGG + Intergenic
1184583388 22:45431561-45431583 CTAGCTCTTGGCTTAAACTCAGG + Intronic
949661235 3:6281387-6281409 CTTGCTCTTGCTTTTAACTCTGG + Intergenic
952518674 3:34132216-34132238 GTTGCCCTGGCCTAAAGCCCTGG + Intergenic
961011208 3:123437332-123437354 CTTTCTCTGGCCTTAAACCTTGG - Intronic
963553514 3:146755828-146755850 GCTGCTTTGGCCTCAAACTTTGG + Intergenic
965229895 3:166037125-166037147 GTGGCCCTGGCCTTGATCTCTGG + Intergenic
966553651 3:181233415-181233437 CTTGATCTGGCCTAGAACTCTGG - Intergenic
969977561 4:11119565-11119587 GTTGCTCTTGAAGTAAACTCTGG - Intergenic
970004103 4:11394475-11394497 GTTGCTCTGGCCTTTAACTCAGG + Exonic
970012933 4:11480526-11480548 GTTGCTCAGGGCAAAAACTCTGG - Intergenic
970332222 4:14999003-14999025 GTTGCTCAGGCCAAAAACCCTGG - Intergenic
972035057 4:34509431-34509453 GTTGGTCTGGCCGTAATTTCTGG - Intergenic
973969774 4:56201437-56201459 GATGCTCTTCCCTTAAACTGAGG + Intronic
975083394 4:70307688-70307710 ATTGCTCTGGCCATAACTTCTGG + Intergenic
975483577 4:74909342-74909364 GTTTCTGTGGCTTGAAACTCAGG + Intergenic
976763769 4:88578311-88578333 GTTGCTCATGCCTTTAATTCCGG + Intronic
978606131 4:110481761-110481783 GTTTCTCTGCCTTTAAACTACGG - Intronic
979463728 4:121012461-121012483 ATTGCTCTGGTCTTGAATTCTGG - Intergenic
981053231 4:140332330-140332352 GTTGCTCATGCCAAAAACTCTGG + Intronic
981258003 4:142686386-142686408 GTTGGTCTGGCCCTGAACTTGGG - Intronic
984954145 4:185029002-185029024 GTGACTCTGGCCTTGAACCCAGG + Intergenic
988664303 5:33308394-33308416 ATTTATCTGGCCTTAAATTCAGG + Intergenic
990365171 5:55063235-55063257 GTTGCTTTGGGCTAAAACCCTGG + Intergenic
991350560 5:65716598-65716620 GTTGCTCAGGCCAGAAACTTGGG - Intronic
993157784 5:84248715-84248737 GTTGCTCAGGCCAGAAACTGGGG + Intronic
993281489 5:85930822-85930844 GTTGCTCTGGCATTTTCCTCAGG - Intergenic
993598908 5:89895389-89895411 GTTGCTCTGGGCATAAAGTTAGG - Intergenic
994059381 5:95457146-95457168 GTGGCACTGGGTTTAAACTCTGG - Intergenic
994833784 5:104821543-104821565 GCTGCTCTGGCTTTAAATTTTGG - Intergenic
994983530 5:106905843-106905865 GTTGCCCTGTCATTAGACTCTGG - Intergenic
995536757 5:113144222-113144244 GTTCCTCAGGATTTAAACTCTGG - Intronic
995953410 5:117744476-117744498 TTTGCTCTGGCCTAAGAATCTGG + Intergenic
996589915 5:125135206-125135228 ATTGCTCTGGCCTTACTCTAGGG - Intergenic
996762615 5:127001525-127001547 GTTGCTCAAGCCAAAAACTCAGG + Intronic
997703043 5:135918302-135918324 GTTGCTCAGGCCCAAAACTTTGG - Intergenic
999048169 5:148492004-148492026 GGTGCCCTGGCCTTCAACCCTGG - Intronic
999791633 5:154945311-154945333 GTTGCTCAGGTCATAAACTTTGG - Intronic
1000177804 5:158775017-158775039 GGTGATCTGGCCTCAAACTGTGG - Intronic
1003233739 6:4277503-4277525 GGTTCTTTGGCCTTCAACTCTGG + Intergenic
1004471662 6:15934749-15934771 GCTGCTCTGGGTTGAAACTCAGG + Intergenic
1004766282 6:18731289-18731311 GTTACTCTGGACTTAAAGCCAGG - Intergenic
1005016253 6:21377967-21377989 CTTCCCCTGGCCTTAAACACAGG - Intergenic
1006153148 6:32000094-32000116 GTGGCTCTGGCCTGTAAATCCGG - Intronic
1006159456 6:32032831-32032853 GTGGCTCTGGCCTGTAAATCCGG - Intronic
1008776194 6:55040954-55040976 GTTGCTGTGGTCATAAACTTTGG - Intergenic
1008820165 6:55622735-55622757 TTTGGTCTGGCCTTAATATCAGG + Intergenic
1015747361 6:136524446-136524468 GTTGCTCTGGATGAAAACTCAGG - Intronic
1018148341 6:160914936-160914958 GTTGCTCTAGCCTTACACCAGGG - Intergenic
1018177132 6:161186742-161186764 GTTGCTCTGGGCTTTAGCTCAGG - Intronic
1019569406 7:1703757-1703779 TTTGCTTTGGACTGAAACTCAGG - Intronic
1020657507 7:10944945-10944967 GTGGCTCTTGCCTCACACTCTGG - Intergenic
1022712873 7:32868316-32868338 GCTGCTCTGGCATTAATCCCAGG - Exonic
1024189155 7:46987562-46987584 CTAGATCTGGCCTCAAACTCTGG - Intergenic
1024967061 7:55033399-55033421 TATGCCCTGGCCTTGAACTCAGG + Intronic
1025623983 7:63201679-63201701 GTTTCTCTGCCTTTAAACTACGG - Intergenic
1030344599 7:108418190-108418212 TTTGCACTGGCCTTGAACTGTGG - Intronic
1030978950 7:116163481-116163503 GTTTCTCTGGAATTAAACTCTGG - Intergenic
1031945616 7:127836732-127836754 GTGGCTGTGGCCAGAAACTCAGG - Intronic
1035430506 7:158816550-158816572 GTTCCTCTGGGCTAAAACTGAGG - Intronic
1043306932 8:78806438-78806460 GTTGCTCAAGCCTGAAACTTGGG + Intergenic
1045651186 8:104342834-104342856 CTTGCTCACCCCTTAAACTCGGG - Intronic
1046622087 8:116538733-116538755 GTAGCTGTGGGCTAAAACTCTGG - Intergenic
1048980459 8:139701140-139701162 TTTTCTCTGGCTTTAAACTGTGG - Intronic
1050569354 9:6921426-6921448 GTTGCTCAGGCCAAACACTCTGG + Intronic
1055803183 9:80063420-80063442 CTTGCTCCTGCCTTAAACTTAGG - Intergenic
1055981298 9:82004777-82004799 GTTTCTCAGGCCAGAAACTCTGG + Intergenic
1058417327 9:104802532-104802554 GCTGCGCTGGCCTTATACACAGG + Intronic
1060332273 9:122683667-122683689 GTTGCTCTGGGCTTAAAAACAGG + Intergenic
1060480305 9:124013446-124013468 CTTGTCCTGGCCTTAACCTCTGG + Intronic
1060520134 9:124289710-124289732 GTTGCTCTGGAATTAAACTGGGG - Intronic
1187328321 X:18312680-18312702 GTTGCTCAGGCCTCAAACCTTGG - Intronic
1188465266 X:30472489-30472511 CTTGCTCTCGGTTTAAACTCTGG + Intergenic
1189162013 X:38819038-38819060 GTTGCTCAGGCTTAAAACTTTGG + Intergenic
1190370067 X:49731829-49731851 GTTGTTCTGGTCTTAAACTAAGG - Intergenic
1199063279 X:143385293-143385315 GTTTCTCTGGCTTTAAAATCTGG - Intergenic
1200174097 X:154099723-154099745 GTTGCTCAGGCCCCAATCTCAGG - Intergenic
1201460199 Y:14213936-14213958 GTTCCTCAGTCCCTAAACTCAGG + Intergenic
1201652615 Y:16307118-16307140 GTTTCTCTGGCCTTCATGTCTGG + Intergenic