ID: 902233370

View in Genome Browser
Species Human (GRCh38)
Location 1:15042507-15042529
Sequence CACAGGACTGGGCTCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 10, 3: 66, 4: 428}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902233370_902233373 -9 Left 902233370 1:15042507-15042529 CCTGCTGGGAGCCCAGTCCTGTG 0: 1
1: 0
2: 10
3: 66
4: 428
Right 902233373 1:15042521-15042543 AGTCCTGTGCAGAGCTCTCCAGG 0: 1
1: 0
2: 3
3: 13
4: 205
902233370_902233375 -6 Left 902233370 1:15042507-15042529 CCTGCTGGGAGCCCAGTCCTGTG 0: 1
1: 0
2: 10
3: 66
4: 428
Right 902233375 1:15042524-15042546 CCTGTGCAGAGCTCTCCAGGTGG 0: 1
1: 0
2: 1
3: 25
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902233370 Original CRISPR CACAGGACTGGGCTCCCAGC AGG (reversed) Intronic
900516781 1:3085897-3085919 CTCAGGGCTGGGCGCCCTGCTGG - Intronic
900610434 1:3542373-3542395 CACAGGACTGAACTCCAACCCGG + Intronic
900642987 1:3696150-3696172 CACAGGACTGAGCCACCAGGTGG - Intronic
901225984 1:7613304-7613326 CACAGTGCTGGGCACACAGCTGG - Intronic
901457805 1:9373390-9373412 AACAGCACTTGCCTCCCAGCGGG + Intergenic
901723586 1:11220727-11220749 GACAGGACTGTGTTCCCATCTGG - Intronic
901936678 1:12631555-12631577 CTCAGGTCTGGGCTCCCTGAAGG - Intergenic
902233370 1:15042507-15042529 CACAGGACTGGGCTCCCAGCAGG - Intronic
902233645 1:15044090-15044112 CACGGCACTGCGCTCCCAGCTGG + Exonic
902480506 1:16708924-16708946 CAGAAGACTGAGTTCCCAGCGGG + Intergenic
902644695 1:17790251-17790273 CCCAGGTCTGGGCTCCCTGAAGG + Intronic
902820226 1:18938938-18938960 GCCAGGGCTGGACTCCCAGCTGG - Intronic
902831159 1:19013762-19013784 CACAGGGCTGGGCACAGAGCGGG - Intergenic
903182989 1:21614486-21614508 CTCAGGGCTGGGCACCCAGCAGG + Intronic
903440565 1:23384965-23384987 CACAGGAGTGAGCTGCAAGCAGG + Intronic
904081158 1:27873262-27873284 CACAGGGATGGGCACACAGCAGG + Intronic
904564865 1:31422765-31422787 CTGTGGACTGGGCTCCCAGGAGG + Intronic
905244799 1:36605209-36605231 GCCAGGACTGGGCTCTCACCTGG - Intergenic
905268386 1:36770681-36770703 CAGGAGACAGGGCTCCCAGCAGG + Intergenic
905884289 1:41483481-41483503 GACAGCACGGGGCTCCCACCCGG + Intronic
906189128 1:43884641-43884663 CACAGGCCTTGGCTCCCACAAGG - Intronic
906250556 1:44307740-44307762 CCCACCACTGGGCTCCCAGTTGG + Intronic
906798742 1:48718236-48718258 CACTGGACTGGGCTCTCTGAAGG + Intronic
907329751 1:53663275-53663297 TACAGGGCTGGGCCCACAGCAGG + Intronic
908748213 1:67395853-67395875 CCCTGGACGGTGCTCCCAGCAGG + Exonic
908799185 1:67861349-67861371 CACAGCAATGGCCTCCTAGCTGG - Intergenic
910259952 1:85284887-85284909 CCTAGGTCTGGGCTCCCAGAAGG - Intergenic
912431676 1:109631385-109631407 CCCAGGACAGGGCCACCAGCAGG - Exonic
913329577 1:117656023-117656045 CACAGCACTTGGCACCCAGGGGG - Intergenic
913671099 1:121097813-121097835 GACGGCGCTGGGCTCCCAGCAGG + Intergenic
914022866 1:143885234-143885256 GACGGCGCTGGGCTCCCAGCAGG + Intergenic
914661353 1:149793178-149793200 GACGGCGCTGGGCTCCCAGCAGG + Intronic
915163338 1:153934334-153934356 CAGGGGACTGGGTTCCTAGCTGG - Intronic
916583475 1:166129168-166129190 CACAGGAGTGCGCCCACAGCAGG - Intronic
919262717 1:195218517-195218539 CCCAGGTCTGGGCCCCCAGAAGG - Intergenic
920214173 1:204350483-204350505 CGCAGGGCTGGGCTCAGAGCAGG + Intronic
920733724 1:208512492-208512514 CAGAGGTCTGGTCTCACAGCTGG + Intergenic
921080051 1:211732043-211732065 CAGAGCCCTGGGCTGCCAGCTGG + Intergenic
922709350 1:227815634-227815656 CACAGGATTGCGCCCCCAACAGG - Intergenic
924039150 1:239966367-239966389 CACAGCACTAAGGTCCCAGCAGG + Intergenic
924416216 1:243859450-243859472 CACAGAACTTGGCTCCCAGCAGG - Intergenic
924642683 1:245849094-245849116 CACAGGACTGGGGTCCCTCCAGG + Intronic
1062993903 10:1847279-1847301 CAAAGGACAGGGCCCCCACCTGG - Intergenic
1063080891 10:2766193-2766215 CACAAGACTGGTCTCTAAGCTGG + Intergenic
1063180193 10:3591103-3591125 CACAGGACTGTCCTCCCTTCTGG - Intergenic
1063671864 10:8105489-8105511 CCCCGGACTGGGCTTCCACCCGG - Intergenic
1064928653 10:20598759-20598781 CACAGGGCTGAGATCCCACCAGG + Intergenic
1066295029 10:34046662-34046684 CACAGGGCTGGCCTCCCTGTGGG - Intergenic
1066705725 10:38175632-38175654 CACAAGCCTGGGCTTCCACCTGG + Intergenic
1066984717 10:42454728-42454750 CACAAGCCTGGGCTCCCACCTGG - Intergenic
1067018108 10:42772564-42772586 CCCAGGTCTGGGCTCCCTGAAGG - Intergenic
1067370576 10:45678434-45678456 CACATGCCTGGGCTCCCACCTGG + Intergenic
1067389205 10:45847722-45847744 CACATGCCTGGGCTCCCACCTGG - Intronic
1067416865 10:46109236-46109258 CACATGCCTGGGCTCCCACCTGG + Intergenic
1067419643 10:46134617-46134639 CACAGGACAGGGCTCCCAGAAGG + Intergenic
1067426375 10:46214794-46214816 CACAGGACAGGGCTCCCAGAAGG - Intergenic
1067445052 10:46336827-46336849 CACATGCCTGGGCTCCCACCTGG + Intergenic
1067502268 10:46816119-46816141 CACATGCCTGGGCTCCCACCTGG + Intergenic
1067504995 10:46841214-46841236 CACAGGACAGGGCTCCCAGAAGG + Intergenic
1067592320 10:47523901-47523923 CACATGCCTGGGCTCCCACCTGG - Intronic
1067639436 10:48031974-48031996 CACATGCCTGGGCTCCCACCTGG - Intergenic
1067693209 10:48517711-48517733 CACAGGACTCCTCTCCAAGCAGG + Intronic
1067874059 10:49988331-49988353 CACATGCCTGGGCTCCCACCTGG + Intronic
1068287811 10:54962459-54962481 CCAAGGTCTGGGCTCCCAGAAGG - Intronic
1069004074 10:63297875-63297897 CTGAGGTCTGGGCTCCCAGTAGG - Intronic
1069957929 10:72062980-72063002 CCCAGGCCTGGGCCCCCAGCAGG + Intronic
1070136423 10:73698124-73698146 CACATGCCTGGGCTCCCACCTGG - Exonic
1070695689 10:78561548-78561570 GCCTGGACTGGGCCCCCAGCAGG + Intergenic
1070749865 10:78957627-78957649 CATAGGACTGGACTCCCTGCTGG + Intergenic
1070829873 10:79411714-79411736 CACTGGCCTGGGATCCCAGGAGG - Intronic
1071574961 10:86718525-86718547 CACAGAACCTGGCACCCAGCTGG + Intronic
1072913461 10:99522950-99522972 CCCAGCAGTGGGCTCCCAGCGGG + Intergenic
1073063642 10:100746089-100746111 CGCAGCACTGCGCTCCCCGCTGG - Exonic
1073453518 10:103623142-103623164 CACAGGGCCGGGCACACAGCTGG + Intronic
1073467074 10:103700526-103700548 GACAGGCCTGGGTTCCCATCAGG + Intronic
1073766086 10:106684464-106684486 CTCAGGATTGGGCTCCCAAGGGG - Intronic
1073890549 10:108096399-108096421 CTGAGGTCTGGGCTCCCAGAAGG + Intergenic
1073930304 10:108567118-108567140 CCCAGGTCTGGGCTCCCCGAAGG - Intergenic
1074159749 10:110827913-110827935 TCAAGGACTGGGCTCCCAGATGG + Intronic
1074458969 10:113619828-113619850 CACAGGACAAGGCTCCCAGGAGG - Intronic
1075528281 10:123203991-123204013 CACAGCACTGGGCACTCACCAGG + Intergenic
1075690804 10:124392935-124392957 CACAGGGGTGGGCTCCATGCGGG + Intergenic
1077208266 11:1354455-1354477 CACAGCACTGGCCTCCCAGCTGG - Intergenic
1077208278 11:1354513-1354535 CACAGCACTGGCCTCCCAGCTGG - Intergenic
1077208308 11:1354643-1354665 CATAGCACCGGCCTCCCAGCTGG - Intergenic
1077358676 11:2130195-2130217 CACAGGAGGGGGCTCCTGGCTGG - Intronic
1077376841 11:2209240-2209262 CTCAGGACTGGGCACGGAGCGGG + Intergenic
1078033686 11:7780620-7780642 CCTGGGACTGAGCTCCCAGCAGG + Intergenic
1078315081 11:10288128-10288150 CCCAGGTCTGGGCTCCCAGAAGG + Intronic
1079077675 11:17393933-17393955 CACAGAGCTGAGCTCCCAACAGG - Intronic
1079352354 11:19702460-19702482 CACAGGGCTTGGTTCACAGCAGG + Intronic
1079710629 11:23679341-23679363 CCCAGGTCTGGGCTCCCCACAGG + Intergenic
1081082188 11:38756228-38756250 CATAGGTCTGGGCTCCCTGAAGG + Intergenic
1081098387 11:38969655-38969677 CACAACACTGGGCTGGCAGCAGG + Intergenic
1081163854 11:39785280-39785302 CCCAGGTCTGGGCTCCCAGAAGG + Intergenic
1083106132 11:60360438-60360460 CACAGGAGTGGGCTCTGTGCAGG + Intronic
1083366390 11:62143919-62143941 CACAGCAATGGGCAGCCAGCAGG - Intronic
1083388677 11:62332473-62332495 CACACCACTGGGCTCCAACCTGG - Intergenic
1083476637 11:62919688-62919710 CAGAAGCTTGGGCTCCCAGCAGG - Intronic
1083625772 11:64071314-64071336 CGCAGGTCTGGGATCCCAGCTGG - Intronic
1083737487 11:64690024-64690046 CCCTGGACTGGGCACCTAGCAGG + Intronic
1084231567 11:67757315-67757337 CACAGAATGGGGCTCACAGCAGG - Intergenic
1084544889 11:69810322-69810344 TTCGAGACTGGGCTCCCAGCTGG - Exonic
1085100688 11:73797431-73797453 CCCAGGTCTGGGCTCCCTGAAGG - Intronic
1085791852 11:79503311-79503333 CAGAGGACTGGGCTCCCAGGGGG + Intergenic
1086305286 11:85472926-85472948 CTGAGGTCTGGGCTCCCAGAAGG - Intronic
1086818607 11:91406139-91406161 CTCAGCTCTGGGCCCCCAGCTGG + Intergenic
1087014579 11:93543101-93543123 CCCAGGCCTGGGCGCCCGGCGGG - Intronic
1087767639 11:102173557-102173579 CACAGGTCATGGCTCCCAGTAGG - Intronic
1089970234 11:122687423-122687445 CACAGCACTGGGCGTCCAGTGGG + Intronic
1090395256 11:126414458-126414480 CACGGCACTGGCCTCCCAGGAGG + Exonic
1091968246 12:4763807-4763829 CAGAGGGCTGGGATCCCGGCAGG - Intronic
1093492924 12:19725497-19725519 CCCAGGTCTGGGCTCCCTGAAGG + Intergenic
1096498284 12:52051094-52051116 CACCGGACTCGGGTCCCAGCTGG - Intronic
1097140710 12:56900532-56900554 CTCAGGTCTGGGCTCCCTGAAGG - Intergenic
1097181696 12:57175373-57175395 CCCAGGACTTGGGGCCCAGCAGG + Intronic
1097836225 12:64275503-64275525 CACAGCACTGTACTCCCACCTGG - Intronic
1098597764 12:72294119-72294141 CCCAGGTCTGGGCTCCCAGAAGG + Intronic
1099051649 12:77788397-77788419 CACAGGATTGTTGTCCCAGCGGG - Intergenic
1099326166 12:81217267-81217289 TAAAGTACTGGGCTCCCAGCAGG - Intronic
1099618966 12:84976292-84976314 CACAGGAGTGGGATCCTTGCGGG - Intergenic
1101306110 12:103529564-103529586 CACAGGTCTGGGCTGGCAGCAGG + Intergenic
1101398318 12:104367257-104367279 CAGAGGACAGGGCTCCTGGCTGG + Intergenic
1102159688 12:110758459-110758481 CACAGCACTGGGCTCCCAGTGGG + Intergenic
1102711551 12:114932517-114932539 CACAGGACTGTGCTCCCCCTGGG + Intergenic
1103331026 12:120154127-120154149 CACAGGGCTGGTCACCCAGTAGG - Intronic
1103400599 12:120640762-120640784 CAGAGAACGGGGCTCCCGGCGGG - Exonic
1103721042 12:122975641-122975663 CTCAGGACAGGGCTCCGGGCTGG - Intronic
1103723145 12:122985341-122985363 CACTGGCCTGGGCTCCAGGCGGG + Exonic
1104586776 12:130053972-130053994 CCGGGGACTGGGCTCCCTGCCGG - Intergenic
1104668731 12:130666539-130666561 CACAGGATTGAGCTCACAGCAGG - Intronic
1104692575 12:130838561-130838583 CAAAGGACTGTGCACCAAGCGGG - Intronic
1104797198 12:131528072-131528094 CAGAACACAGGGCTCCCAGCAGG + Intergenic
1104829367 12:131739007-131739029 CACATGCCTGTGGTCCCAGCTGG - Intronic
1105323406 13:19348014-19348036 CTCAGGAGAGGGCTACCAGCAGG - Intergenic
1105821573 13:24085485-24085507 CACAGGGCAGGGCTTCCAGACGG - Intronic
1105873982 13:24537823-24537845 CTCAGGAGAGGGCTACCAGCAGG + Intergenic
1107229172 13:38087076-38087098 CCGAGGTCTGGGCTCCCAGAAGG - Intergenic
1107447208 13:40480004-40480026 AACAGGACCGGGCTGCCAGAGGG - Intergenic
1107891981 13:44921888-44921910 TGCAGGACTGGGTTCCCAGGGGG - Intergenic
1108267962 13:48731103-48731125 CACAGCTCTGGGCACCCAGGTGG - Intergenic
1110730681 13:78876201-78876223 CTGAGGTCTGGGCTCCCAGAAGG + Intergenic
1110810743 13:79808448-79808470 CCCAGGTCTGGGCTCCCTGAAGG - Intergenic
1110948267 13:81451775-81451797 CACAGTACTGGGCACCTAGTAGG + Intergenic
1113503161 13:110794074-110794096 CCGAGGGCTGGGCTCCCAGAAGG - Intergenic
1113588784 13:111483672-111483694 CACAGCACTGGGCCACCTGCAGG + Intergenic
1114189449 14:20429651-20429673 CTCTTGACTGGGCTCCCACCTGG + Exonic
1114599233 14:23941018-23941040 CACAGGGATGGTCTCCCAGAGGG - Intergenic
1115591488 14:34869943-34869965 CACAGGTCTGGGAACTCAGCTGG - Intronic
1116050875 14:39801664-39801686 CACAGGTCTTGGCTCTCACCAGG - Intergenic
1117720053 14:58620254-58620276 CACAGGGCTTGGCACCCAGCTGG - Intergenic
1118760969 14:68879943-68879965 CACAGGATGGGGCTCTCACCCGG + Exonic
1119400940 14:74361893-74361915 CACACCACTGTGTTCCCAGCAGG + Intergenic
1119432683 14:74578707-74578729 CACAGGACAAGGCTCCCTGCAGG - Intronic
1122598368 14:102908669-102908691 CACATGACCAGACTCCCAGCAGG + Exonic
1123990468 15:25679722-25679744 CACTGTGCTGGGCTCCCCGCTGG + Exonic
1124001413 15:25763452-25763474 TCCAGTACTGGGCTCCCAGAAGG + Intronic
1124699075 15:31895399-31895421 CACAGGACATGGCACACAGCAGG - Intergenic
1125750423 15:42023995-42024017 CACAGAGATGGGCACCCAGCAGG - Intronic
1126175447 15:45731126-45731148 CACAGCACTGGGGGCCCAGAAGG + Intergenic
1128237872 15:66079887-66079909 CAAAGGTCTGGGCTCCCACAAGG + Intronic
1128466658 15:67918360-67918382 CACAGGAGTGGGATCCATGCAGG + Intergenic
1128601283 15:68997446-68997468 CACAGGCCTTGGCTCACAGTGGG + Intronic
1129340438 15:74882363-74882385 CACAGGAGTGGGTTCCATGCAGG + Intergenic
1129343888 15:74904565-74904587 CACAGTGCTGTGCTCACAGCGGG + Intronic
1129585776 15:76863163-76863185 TACTGGACCTGGCTCCCAGCTGG - Intronic
1129879231 15:78996124-78996146 CACAGGACTGGACATTCAGCAGG + Intronic
1131108011 15:89747685-89747707 CACAGGTCTGGAGTCACAGCCGG + Intergenic
1131568251 15:93505972-93505994 CCCAGGTCAGGGCTCCCAGAAGG + Intergenic
1132930409 16:2456200-2456222 CACAGGGCAGTGATCCCAGCAGG - Intronic
1133046329 16:3090301-3090323 CACAGGAAGGAGCGCCCAGCCGG + Exonic
1133747186 16:8696230-8696252 CACAGCACTGGGAACCCAGGAGG + Intronic
1134078355 16:11308080-11308102 CCCAGGTCTGGGCTCCCTGAAGG + Intronic
1134137139 16:11684812-11684834 CACAGAGCTGGGCACACAGCTGG + Intronic
1134761111 16:16716023-16716045 ATCAAGACTGGGCTCCCGGCCGG - Intergenic
1134984948 16:18643153-18643175 ATCAAGACTGGGCTCCCGGCCGG + Intergenic
1135303999 16:21353462-21353484 CAGAGGACAGGGCTCATAGCTGG + Intergenic
1136283564 16:29228603-29228625 CCCAGGGCTGGGCACACAGCAGG - Intergenic
1136300733 16:29332599-29332621 CAGAGGACAGGGCTCATAGCTGG + Intergenic
1136450699 16:30352961-30352983 CACCAAACTGGGCCCCCAGCAGG + Exonic
1137977174 16:53041865-53041887 AACAGGCCTGGGCTTGCAGCTGG - Intergenic
1141523074 16:84594312-84594334 CACAGGGCGGGGCTGCCAGGTGG + Intronic
1141665989 16:85465369-85465391 GCCAGGCCTGGGCTCCCATCTGG + Intergenic
1142062458 16:88039389-88039411 CAGAGGACAGGGCTCATAGCTGG + Intronic
1142088595 16:88198114-88198136 CCCAGGGCTGGGCACACAGCAGG - Intergenic
1142186529 16:88697459-88697481 CACCGGACTGAGCTCACAGGAGG - Exonic
1142600489 17:1051339-1051361 AACAGGGCTGGGAACCCAGCTGG + Intronic
1142630206 17:1220836-1220858 CACAGGGCTGGGCTCATGGCCGG - Intronic
1142667391 17:1470732-1470754 CACGGCACCAGGCTCCCAGCTGG - Intronic
1142673686 17:1500075-1500097 CACATGCCTGTGGTCCCAGCTGG - Intronic
1142760439 17:2039040-2039062 CAGAGGACTGAGTTCACAGCTGG - Intronic
1142962919 17:3562419-3562441 CACACCACTGTGCTCCCACCTGG + Intergenic
1143100227 17:4500480-4500502 CATAGGAAGGGGCTCCCTGCAGG + Intronic
1144576788 17:16434704-16434726 CACAGGACAGGGCTCCAAGTGGG + Intronic
1144771462 17:17761899-17761921 CTCAGGACAGGGGGCCCAGCAGG + Intronic
1144892445 17:18501678-18501700 CTCAGCTCTGGGCTCACAGCGGG - Intergenic
1145139769 17:20442610-20442632 CTCAGCTCTGGGCTCACAGCGGG + Intergenic
1145214404 17:21041831-21041853 CGCAAGACTGGGCTCCCCGAGGG + Intronic
1145971479 17:28959046-28959068 CTCAGTGCTGGGCTACCAGCAGG - Exonic
1146359256 17:32160530-32160552 CCCAGGTCTGGGCTCCCTGAAGG - Intronic
1146793544 17:35766153-35766175 AACAGCACTGGGATCCAAGCAGG - Intronic
1146948165 17:36888180-36888202 CAGAGGCCTGGTCTCCCTGCAGG - Intergenic
1147522718 17:41189951-41189973 CACAGTGGTGGGCTTCCAGCAGG - Exonic
1147526256 17:41226719-41226741 CACAGTGGTGGGCTTCCAGCAGG - Exonic
1147526791 17:41232551-41232573 CACAGTGGTGGGCTGCCAGCAGG - Exonic
1147527295 17:41238101-41238123 CACAGTGGTGGGCTTCCAGCAGG - Exonic
1147528419 17:41249785-41249807 CACAGTGGTGGGCTTCCAGCAGG - Exonic
1147528939 17:41255435-41255457 CACAGTGGTGGGCTTCCAGCAGG - Exonic
1147530428 17:41271375-41271397 CACAGTGGTGGGCTTCCAGCAGG - Intergenic
1147530840 17:41275747-41275769 CACAGTGGTGGGCTTCCAGCAGG - Exonic
1148360800 17:47010571-47010593 CACAGAACTGGGGTTCCAGAAGG + Intronic
1149329933 17:55570324-55570346 CCCAGGTCTGGGCTCCCTGAAGG - Intergenic
1149460066 17:56821540-56821562 CCCAGCACCAGGCTCCCAGCTGG + Intronic
1150143587 17:62750245-62750267 CACAGCACAGGGGTCTCAGCCGG + Intronic
1150724126 17:67637713-67637735 CACAGAGCTGGGCTATCAGCTGG - Intronic
1150785737 17:68161587-68161609 CACAGAACTGGGGTTCCAGAAGG - Intergenic
1151225981 17:72648740-72648762 CCCAAGGCTGGGGTCCCAGCTGG + Intronic
1151305566 17:73260899-73260921 GACAGGCCTGGGCCCCAAGCTGG - Intronic
1151374740 17:73679517-73679539 CCCAGGACTGTGCTCAGAGCTGG + Intergenic
1151697362 17:75724396-75724418 CTCAGCACTGGGCTCCCTGAGGG - Intronic
1151719969 17:75849463-75849485 CCCAGCTCTGGGCTGCCAGCTGG - Intronic
1151768705 17:76145823-76145845 GAAAGGACTGGCCACCCAGCAGG + Intronic
1151773175 17:76178190-76178212 CCCAGGTCTGGGCTCCCCGACGG - Intronic
1151831337 17:76553738-76553760 CACATGCCTGTGGTCCCAGCTGG - Intergenic
1151832389 17:76561772-76561794 CTCTAGACTGGGCTCTCAGCAGG - Intergenic
1152011718 17:77723125-77723147 CCCAGGACTAGGCTCCCAGCGGG + Intergenic
1152077102 17:78166551-78166573 CATAGGACTGGGCCACCAGGAGG - Intergenic
1152181361 17:78823668-78823690 CACAGGCATGGGCTCTCAGGGGG + Intronic
1152199191 17:78935272-78935294 CACTGGGCTGGGCTCCCTGCTGG + Intergenic
1152337922 17:79708397-79708419 CACTGCACTGGGCCCCCCGCAGG + Intergenic
1153230074 18:2926704-2926726 CAGAGGACAGGGCACCCACCTGG + Exonic
1155765960 18:29633111-29633133 CACACGACTGTACTCCAAGCTGG - Intergenic
1157512948 18:48291521-48291543 CGCAGGCCTGGGCTCCCTGTGGG - Intronic
1158055679 18:53277338-53277360 CACACGCCTGTGGTCCCAGCTGG + Intronic
1160950908 19:1666939-1666961 CACAGCACTGGGATCCCAGGTGG + Intergenic
1161171063 19:2812736-2812758 CACAGGGCTGGGCTCAAACCTGG + Intronic
1161202861 19:3025539-3025561 CCCAGGACTGATCTACCAGCTGG + Intronic
1161763957 19:6196249-6196271 CAGAGCCCTGGGCTCCCAGAAGG - Intronic
1162359348 19:10208442-10208464 CACACCACTGTGCTCCCACCTGG + Intronic
1162792694 19:13071223-13071245 CACAGGACTGGGGTCTGAGGAGG + Intronic
1162968376 19:14166309-14166331 CCCAGGGCTGGGCCCCCAGCTGG + Intronic
1163128606 19:15258062-15258084 CACAGGCCTGGCTTCCCAGCAGG + Intronic
1163773787 19:19206252-19206274 AGCAGCTCTGGGCTCCCAGCAGG + Intergenic
1164044265 19:21521969-21521991 CACAGCACAGGGCTCACAGCTGG - Intronic
1164094765 19:21997572-21997594 CACAGCACAGGGCTCACAGCTGG + Intronic
1164102192 19:22066453-22066475 CACAGCACAGGGCTCACAGCTGG - Intronic
1164114336 19:22203051-22203073 CACAGCACAGGGCTCACAGCTGG + Intergenic
1164160607 19:22623494-22623516 CCCTGGGCTGGGCTCCCCGCGGG - Intergenic
1164198480 19:22994894-22994916 CACAGCACAGGGCTCACAGCTGG + Intronic
1164240149 19:23379883-23379905 CACAGCACACGGCTCACAGCTGG + Intronic
1164284325 19:23799551-23799573 CACAGCACAGGGCTCACAGCTGG - Intronic
1164669189 19:30063254-30063276 TACAGGCCTGGTCTCCCACCTGG - Intergenic
1164921992 19:32095167-32095189 CACAGGACTGGGTTCCTCGTGGG - Intergenic
1165307182 19:35009994-35010016 CACAGGGCTGGGCTAGGAGCTGG - Intronic
1165345975 19:35249049-35249071 CAGAGGGCTGGGCTCCCACCCGG + Exonic
1166066049 19:40359574-40359596 CAGAGGACTGTGGTCTCAGCGGG - Intronic
1167592012 19:50409253-50409275 AACAGGTCTGAGCTCCAAGCAGG - Intronic
1168324626 19:55531566-55531588 CGCAGGCCTGAGCCCCCAGCTGG - Intronic
1202714548 1_KI270714v1_random:34832-34854 CAGAAGACTGAGTTCCCAGCGGG + Intergenic
924981291 2:223873-223895 CACTGGAGTGGGCTCCCAGAAGG + Intronic
926239595 2:11074745-11074767 CACAGTCCTGGGCTCCCTGTGGG + Intergenic
926625527 2:15086538-15086560 CACAGGTCTGGGCTCCCCAAGGG - Intergenic
927178296 2:20425524-20425546 CACAGGACAGGAGTCACAGCAGG - Intergenic
927515432 2:23669217-23669239 CCCAGCACTGAGCACCCAGCAGG - Intronic
927533773 2:23836397-23836419 CCCAGGTCTGGGCTCCCTGAAGG + Intronic
928182626 2:29080265-29080287 CTGAGGTCTGGGCTCCCAGAAGG + Intergenic
928388127 2:30886595-30886617 CACATAACTGGGCTACCACCAGG + Intergenic
929469532 2:42177577-42177599 CACACTACTGGGCTCCAACCTGG + Intronic
929619901 2:43343838-43343860 CACAGGACTGGGCACGCAGCAGG + Intronic
930612100 2:53554823-53554845 CCCAGGTCTGGGCTCCCTGAAGG - Intronic
932423632 2:71615485-71615507 AACAGAACTGGTCTCCCTGCTGG - Intronic
932493280 2:72134518-72134540 CCCAGGCCTGAGCTCCCTGCAGG + Intronic
932819737 2:74889350-74889372 CACAGAGCTGGGCTGCCCGCCGG - Exonic
933089586 2:78104267-78104289 CACAGGAGTGGGTTCCATGCAGG - Intergenic
933661293 2:84929084-84929106 CACAGCACTGCACTCCCACCTGG + Intergenic
933801070 2:85960855-85960877 CCCAGGTCTGGGCTCCCCGAAGG + Intergenic
933842431 2:86298295-86298317 CACAGGGATGGGCTCCCAACTGG + Intronic
934696440 2:96403980-96404002 CCCAGGTCTGGGCTCCCCGAAGG + Intergenic
935623821 2:105152090-105152112 CACTGGACTGGGCACCCAGGGGG + Intergenic
936461189 2:112714708-112714730 CCCAGCACTGGGCTCCTTGCTGG + Intergenic
937370778 2:121295824-121295846 CTGAGGTCTGGGCTCCCAGAAGG + Intergenic
937710842 2:124978419-124978441 AACAGGGCTGGGCTCCCAGAGGG - Intergenic
941131139 2:161651516-161651538 CATAGGTCTGGGCTCCCTGAAGG - Intronic
941928344 2:170917370-170917392 CACAGGAGCGGGCTCCGTGCAGG + Intergenic
943801003 2:192057327-192057349 CTCAGGCCTGTACTCCCAGCAGG - Intronic
943928427 2:193819164-193819186 CTTAGGTCTGGGCTCCCAGAGGG + Intergenic
944303089 2:198146839-198146861 CACAGGACAGGCATGCCAGCTGG - Exonic
944654011 2:201859622-201859644 CTCTCGACTGGGCTCCCCGCTGG - Intronic
944662468 2:201932693-201932715 CCCAGGGCTGGCTTCCCAGCAGG + Intergenic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
945286384 2:208086838-208086860 CTCAGAACTGGGCCCACAGCAGG - Intergenic
945902819 2:215557826-215557848 CTCAGCACTGGGCTCCCTGCTGG - Intergenic
948127783 2:235577481-235577503 CACAGGACTCTGCTCCAAGCAGG - Intronic
948502784 2:238407161-238407183 CACAGGACTAGACTCCCAAGAGG + Intergenic
948792108 2:240384456-240384478 CAGAGGGCTGGGCTCCATGCTGG - Intergenic
948984468 2:241511775-241511797 GAAAGGAGTGGGTTCCCAGCAGG + Intergenic
1168996219 20:2135172-2135194 CATAGGAATGTGCTCCCAGGAGG - Intronic
1169081701 20:2801164-2801186 GAGAGGACTGAGCTCCCTGCGGG - Intergenic
1171204539 20:23268516-23268538 CACAGCCCTGGACACCCAGCAGG + Intergenic
1172314051 20:33939872-33939894 CTCAGGCATGGGCTCCCAGCAGG + Intergenic
1173014314 20:39211009-39211031 CTCCGTGCTGGGCTCCCAGCTGG + Intergenic
1173667512 20:44773522-44773544 CCCATGACTGGGCACCCTGCAGG + Intronic
1174462482 20:50692347-50692369 CACAGGGCTGGCCTCCCCTCCGG - Intergenic
1174467569 20:50730024-50730046 CACAGAACCCGACTCCCAGCGGG - Intergenic
1174542886 20:51303785-51303807 CACAGGGGTAGGCTCCCTGCTGG + Intergenic
1175265193 20:57698702-57698724 CACAGGTCTGGGAACCCTGCAGG - Intronic
1175389359 20:58616524-58616546 GAGAGGACTTGGCTCCCAGCTGG - Intergenic
1175851512 20:62096651-62096673 GGCAGGACTGGGGTCCCAGAGGG - Intergenic
1175946612 20:62562007-62562029 GCCAGGTCTGGGCACCCAGCCGG + Intronic
1176161549 20:63651327-63651349 CTCATGACTGGGCTCTCACCCGG - Intronic
1176411202 21:6450476-6450498 CCCAGGACTGAGCTCTGAGCAGG + Intergenic
1176510738 21:7745582-7745604 CCGAGGCCTGGGCTTCCAGCAGG + Intronic
1176976581 21:15327795-15327817 CCCAGGTCTGGGCTCCCTGAAGG - Intergenic
1178644851 21:34376111-34376133 CCGAGGCCTGGGCTTCCAGCAGG + Intronic
1179516638 21:41913023-41913045 CACAAGCGTGGGCTCCCAGGGGG + Intronic
1179686695 21:43058798-43058820 CCCAGGACTGAGCTCTGAGCAGG + Intronic
1180003182 21:45004285-45004307 CATTGGCCTGGGCTCGCAGCTGG + Intergenic
1180871503 22:19149593-19149615 CACTGGACTGGGGTCCTGGCGGG - Intronic
1181474621 22:23160661-23160683 CACTGGCCTGGCCTCCCACCTGG - Intronic
1181582273 22:23834932-23834954 CACAGGACTGGGCCCTCCGCAGG - Exonic
1181854911 22:25774690-25774712 CGCAGGCCTGTGCTCCCACCTGG - Intronic
1181858704 22:25801551-25801573 CACAGGACTTGGCTCCTGGCGGG + Intronic
1182128738 22:27835182-27835204 CACATGTCTCGGCTCCCTGCAGG - Intergenic
1183436332 22:37797769-37797791 CACAGGACTGGGCTGAGAGGAGG + Intergenic
1183726090 22:39590425-39590447 CACAGGCCTGGGTCCCCAGCAGG + Intronic
1184354398 22:43969379-43969401 CACAGGGCTGGCCTCGAAGCAGG - Intronic
1185077279 22:48690178-48690200 AAGGGGACGGGGCTCCCAGCGGG + Intronic
1185178504 22:49345897-49345919 CCCAGGACAGCGGTCCCAGCAGG - Intergenic
949355395 3:3175406-3175428 CAGAGGACTGGGGTCCGTGCTGG + Intronic
950439325 3:12999535-12999557 CACAGCACTGGGCGCCCACGTGG + Intronic
951566736 3:24019209-24019231 CTGAGGTCTGGGCTCCCAGAAGG + Intergenic
952871669 3:37906257-37906279 CAAAGGTCTGGGCTCCTGGCAGG + Intronic
953233508 3:41085470-41085492 CACAAGATTGGGCTGCCAGATGG + Intergenic
954366676 3:50150144-50150166 CCCAGGACTGGGCTCCCCAGTGG + Intergenic
954395921 3:50293264-50293286 CCCAGGCCTGGGCTCCTGGCAGG + Exonic
956930172 3:74034594-74034616 CACAAAACTGGGCTTCTAGCTGG + Intergenic
958894732 3:99817152-99817174 CCCAGCACTTGGCGCCCAGCGGG + Intergenic
961311469 3:126004598-126004620 CTAAGGTCTGGGCTCCCAGAAGG - Intergenic
961358106 3:126351582-126351604 CACTGGCCTGTGCTGCCAGCTGG - Intronic
963805236 3:149715242-149715264 CCCAGGTCTGGGCTCCCTGAAGG - Intronic
966885891 3:184378003-184378025 AAGAGAAATGGGCTCCCAGCTGG - Intronic
967319601 3:188182583-188182605 CACAGGACTTGGCACATAGCAGG - Intronic
968229873 3:196999204-196999226 CACAGGGCTGTGCACACAGCAGG + Intronic
968268155 3:197378525-197378547 CACGGGGCTGGGCTCAGAGCCGG - Intergenic
968441161 4:625206-625228 CCCAGGTCTGGGCTCCCAGGAGG + Intergenic
968832895 4:2942387-2942409 AACATTACTGGGCTCCCAGCAGG + Intronic
969109291 4:4831932-4831954 CACAAGACTGGGCTGCCCACAGG + Intergenic
969453111 4:7286162-7286184 CACAGGCCTGGAGACCCAGCTGG - Intronic
969603477 4:8190250-8190272 CCCAGGAGATGGCTCCCAGCTGG + Intronic
969631434 4:8340900-8340922 CACAGGCCTGGGCTGGCTGCCGG + Intergenic
971362927 4:25953451-25953473 CACAGCACTGGCTTCACAGCAGG - Intergenic
972928464 4:44040966-44040988 CACAGCAGTGGGCTCCCCTCTGG - Intergenic
973777713 4:54258226-54258248 CTCAGACCTGGGCACCCAGCCGG - Intronic
974913329 4:68149263-68149285 CCTAAGACTGAGCTCCCAGCGGG - Intergenic
975850214 4:78564505-78564527 CTGAGCACTGGGCTCCCAGCTGG + Intronic
976178889 4:82380852-82380874 CTGAGGTCTGGGCTCCCAGAAGG + Intergenic
976316868 4:83667797-83667819 AGCAGGACTGGGCTGCCACCTGG + Intergenic
976729231 4:88245204-88245226 CTGAGGTCTGGGCTCCCAGAAGG - Intergenic
979419941 4:120491142-120491164 TACAGGTCTGTGCTCCAAGCTGG - Intergenic
980076466 4:128298953-128298975 CACAGGGCCTGGCACCCAGCAGG - Intergenic
981152489 4:141395548-141395570 CACAAGACTGTTCTTCCAGCAGG - Intergenic
982453484 4:155579434-155579456 CACAGCACTGGGAACACAGCAGG + Intergenic
982611127 4:157575307-157575329 CCTAGGCCTGGGCTCCCAGAAGG - Intergenic
982646109 4:158026858-158026880 CCTGGGACTGAGCTCCCAGCAGG + Intergenic
982802522 4:159722486-159722508 CCTAGGTCTGGGCTCCCAGAAGG + Intergenic
984103259 4:175513335-175513357 TACAGTAATGGGCTCCCAGTTGG + Intergenic
984510635 4:180674475-180674497 CACTGGGCTGGGTACCCAGCAGG + Intergenic
984818110 4:183857180-183857202 CACAGGACTGGTCATCCTGCAGG + Intronic
984818154 4:183857418-183857440 CACAGGACTGGTCATCCTGCAGG + Intronic
985394264 4:189525463-189525485 CACAGGACTGGGGGCCAAGGAGG + Intergenic
985580714 5:693906-693928 CAGGGGACTGGGCTTCCAGGTGG + Intergenic
985595337 5:785238-785260 CAGGGGACTGGGCTTCCAGGTGG + Intergenic
985785890 5:1894319-1894341 GCCAGGGCTGGGCTCTCAGCGGG + Intergenic
985879627 5:2628503-2628525 CACAGCACTGGCTTCCCAGGAGG + Intergenic
986173434 5:5332192-5332214 CTCAGGCCTGGGTTCCCACCAGG - Intergenic
988196404 5:28011491-28011513 CACAGGCCTGGAGTCCCAGAAGG + Intergenic
988565829 5:32319608-32319630 CCCAGGTCTAGGCTCCCTGCAGG + Intergenic
989537677 5:42582684-42582706 CACAGGTCTGGGCTCCCCAAAGG - Intronic
990383125 5:55234503-55234525 CCAAGGACTGGGCTGCCGGCGGG - Intergenic
990878847 5:60517943-60517965 CCCAGGTCTGGGCTCCCTGAAGG - Intronic
992622825 5:78610491-78610513 CACAGTTCTGGGTCCCCAGCAGG - Intronic
993404970 5:87499969-87499991 CACAGGAATAGGCTCCATGCAGG - Intergenic
994641924 5:102421176-102421198 CACAAAACTGGGCTGCCAGTTGG + Intronic
996133569 5:119810916-119810938 CATTTGACTAGGCTCCCAGCAGG + Intergenic
997597537 5:135117098-135117120 CACAGCTCTGGGCACACAGCTGG - Intronic
997662939 5:135603488-135603510 GGCAGGACAGGCCTCCCAGCAGG + Intergenic
999742352 5:154565967-154565989 CACTGCAATAGGCTCCCAGCAGG - Intergenic
999877681 5:155826231-155826253 TACAGCATTGGGCTCCCAACTGG + Intergenic
1000280003 5:159773979-159774001 CACAGGCCTGGGCACACGGCAGG - Intergenic
1000283468 5:159803709-159803731 CACAATACTGGGCTCAGAGCCGG + Intergenic
1000973232 5:167737555-167737577 CAAAGGACTGGACCCTCAGCGGG - Intronic
1001689134 5:173619464-173619486 CACTGGATTGGAATCCCAGCTGG + Intergenic
1001708886 5:173762188-173762210 CTCAGTCCTGGGCTCCCAGAGGG - Intergenic
1002136944 5:177113427-177113449 CACAGCACCGGGCACACAGCAGG + Intergenic
1002535472 5:179873365-179873387 CAGAGGACTGGGCACCCTGCAGG + Intronic
1002641104 5:180631013-180631035 CACAGGCCTTGGATCACAGCTGG + Intronic
1003229722 6:4241123-4241145 CACAGGAGTGGGCTCACTGATGG + Intergenic
1005377032 6:25193263-25193285 CAAAGGATTGGTTTCCCAGCAGG + Intergenic
1006329830 6:33382454-33382476 CACATGATTGGGCTACCGGCTGG - Intergenic
1007303919 6:40889955-40889977 CAAAGTTCTGGGCTCCCAACTGG + Intergenic
1007650046 6:43413663-43413685 CCCAGGTCTGGGCTCCCTGAAGG - Intergenic
1008294302 6:49757124-49757146 CACGGGACAGAGCTCCCAGTGGG - Intergenic
1009684393 6:66937165-66937187 CTGAGGTCTGGGCTCCCAGAAGG - Intergenic
1012100947 6:95084769-95084791 CCAAGGTCTGGGCTCCCAGGAGG - Intergenic
1016185706 6:141195853-141195875 CAGAGGAGTGGGCTCCCCTCTGG + Intergenic
1017054580 6:150425528-150425550 CACAGGTCTGGGCCCCCTGAAGG - Intergenic
1017536086 6:155349352-155349374 CCTAGGACAGAGCTCCCAGCAGG - Intergenic
1017889154 6:158624952-158624974 CAGAACAATGGGCTCCCAGCCGG - Intronic
1017894583 6:158668192-158668214 CCCAGGACAAGGCTCCTAGCAGG - Intronic
1018073864 6:160191809-160191831 CACATGCCTGTGCCCCCAGCCGG + Intronic
1018660972 6:166087318-166087340 CATGGGGCTGGGCTCCCACCAGG - Intergenic
1019058213 6:169237700-169237722 CACAGGACCGGCCTCTCTGCTGG + Exonic
1019175416 6:170157000-170157022 CCCAAGGCTGGGCTCCCACCAGG + Intergenic
1019333953 7:473880-473902 CAAAGCACTGGGATCCCAGTTGG - Intergenic
1019794111 7:3037174-3037196 CACAGGACTGGACCCTCAGTGGG - Intronic
1020017329 7:4838580-4838602 CCCAGGGCTGGGCTCTCTGCAGG + Intronic
1020598919 7:10248052-10248074 CACTGGCTTGGGTTCCCAGCTGG + Intergenic
1020796821 7:12686919-12686941 CAGAGGACTGGGCGCCTGGCGGG - Intronic
1022465510 7:30650500-30650522 GGCAGGCCTGGCCTCCCAGCAGG + Intergenic
1023699492 7:42878366-42878388 CCCAGGTCTGGGCTCCCTGAAGG - Intergenic
1023841070 7:44097739-44097761 GAGAGGAAGGGGCTCCCAGCAGG - Intergenic
1024306885 7:47937059-47937081 CACAGTGCTGGGCGCACAGCAGG - Intronic
1025803046 7:64805573-64805595 CACAGCACAGGGCTCACAGCTGG - Intronic
1027251547 7:76401735-76401757 CAGAGGAAGGGGCTCCAAGCTGG - Intronic
1027779771 7:82507117-82507139 CCCAGGTCTGGGCTCACAGGAGG + Intergenic
1028177048 7:87671860-87671882 CCCAGGACAGTGCTCCCAGGGGG - Intronic
1028388294 7:90285207-90285229 CCCAGCACTGGGCCTCCAGCAGG + Intronic
1029116864 7:98242040-98242062 CCCAGGACTGAGCCCCCATCGGG - Intronic
1029625773 7:101719290-101719312 CCCAGGACTGGGGCCCGAGCTGG + Intergenic
1029737329 7:102472116-102472138 CACAGGGCAGGGTCCCCAGCAGG + Intronic
1030149292 7:106386937-106386959 CCCAGGTCTGGGCTCCCTGAAGG - Intergenic
1030966360 7:115996954-115996976 TACAGGCCCTGGCTCCCAGCTGG + Intronic
1031401178 7:121328060-121328082 CACAGGACTAGGCACACAGCAGG + Intronic
1031968120 7:128042777-128042799 GACAGGCCTGGTCTCCCATCAGG - Intronic
1032665667 7:134033686-134033708 CACTGAACTGGGCACCCAACAGG - Intronic
1033210183 7:139454379-139454401 CACAGAACCTGGCACCCAGCAGG - Intronic
1034481335 7:151322169-151322191 CACAGGTCTGGGCTCCCTGAAGG - Intergenic
1034513307 7:151553600-151553622 CACAGCAGTGGGCTCTCAGCCGG - Intergenic
1034677425 7:152901937-152901959 CTCAGGGCTGGGCCCCTAGCAGG + Intergenic
1034970172 7:155413761-155413783 CACAGCACTCGGCTCACAGCAGG - Intergenic
1035037127 7:155902725-155902747 CTCAGAACTGAGCTCACAGCAGG - Intergenic
1035163146 7:156966105-156966127 GACAGGGCTGGGCCCCTAGCTGG + Intronic
1035252313 7:157605412-157605434 CCCAGGTCTGGGCTCCCTGAAGG + Intronic
1035418312 7:158707248-158707270 CCGAGGTCTGGGCTCCCAGAAGG + Intergenic
1035451098 7:158977431-158977453 CTCAGGCCTCTGCTCCCAGCTGG + Intergenic
1035774033 8:2173683-2173705 CAGAGCCCTGGGCTCCCTGCGGG + Intergenic
1036480083 8:9131789-9131811 CACAGGACTGAGGTTGCAGCTGG + Intergenic
1036642575 8:10593355-10593377 CACTGGACTGGGTCCCCAGCAGG + Intergenic
1036727051 8:11229848-11229870 CACAGGGCTGGGAGCCCAGCAGG + Intergenic
1037394635 8:18429088-18429110 CACAGGACTGAGATCCCTGAGGG + Intergenic
1037882306 8:22579183-22579205 CCCGGGCCTGGGCGCCCAGCCGG + Exonic
1039885191 8:41650351-41650373 CCCAGGGCTGGGCCCCCAGCTGG - Intronic
1039916682 8:41865400-41865422 CACAGGACTGAACTCACAGCTGG + Intronic
1040387043 8:46920858-46920880 CACAGGAGTGGGCTCTCGGGTGG - Intergenic
1040537410 8:48322428-48322450 CACACCTCTGAGCTCCCAGCTGG - Intergenic
1040693703 8:49970875-49970897 CACAGGACTCAACTCCCAGCTGG + Intronic
1041430629 8:57777554-57777576 CACAGGACTGGTATCCTAGAAGG + Intergenic
1041582857 8:59482998-59483020 CAGAGGAGTGGGCTCCCCTCTGG + Intergenic
1042687775 8:71461540-71461562 CCCAGGTCTGGGCTCCCTGGAGG + Intronic
1043756097 8:84005721-84005743 CCGAGGTCTGGGCTCCCAGAAGG + Intergenic
1044753802 8:95441074-95441096 GACTGAACTGGGCTCACAGCTGG - Intergenic
1045272164 8:100671111-100671133 CACAGGAGTGGGCTCTGTGCAGG - Intergenic
1047769655 8:128020617-128020639 CAGCGGACTGGGCTCCTATCAGG - Intergenic
1049095609 8:140546469-140546491 CACAGGCCTGTGCACACAGCAGG + Intronic
1049367745 8:142248892-142248914 CACAGGGCTGGGTACTCAGCAGG + Intronic
1051768292 9:20547906-20547928 CACATGACTGCACTCCCATCTGG + Intronic
1052141152 9:24986279-24986301 CACAGTGCTGGGCTCCTAGTAGG + Intergenic
1053003547 9:34590537-34590559 CATGGGCCTGGGCTCCCGGCAGG - Intergenic
1054458511 9:65449591-65449613 CCCAGGACTGGGCTCACCCCTGG - Intergenic
1055224845 9:73983965-73983987 CACTAGACAGAGCTCCCAGCAGG + Intergenic
1057128927 9:92640084-92640106 CAGAGTCCTGGGCTCCCTGCAGG - Intronic
1057794684 9:98146720-98146742 CCCAGGTCTGGGCTCCCATTCGG + Intronic
1057851018 9:98566879-98566901 CACAGTGCTGGGCACCCAGCAGG - Intronic
1057992318 9:99783187-99783209 ATGAGGACTGAGCTCCCAGCAGG - Intergenic
1060172719 9:121474949-121474971 CACAGGCCCTGGCTCCCAGTAGG + Intergenic
1060522421 9:124301236-124301258 CTCAGGACTGGGCACACAGTGGG + Intronic
1060930649 9:127487532-127487554 CCCAGGGCCCGGCTCCCAGCAGG + Intronic
1061267416 9:129514868-129514890 CTCAGGTCTGGGCTCCCTGAAGG - Intergenic
1061284093 9:129612501-129612523 CAGGGGACTGGGCTCCCAGTGGG + Intronic
1061373161 9:130209276-130209298 TGCAGGGCTGGCCTCCCAGCAGG + Intronic
1062272979 9:135718229-135718251 CACAGGAAGGGGGTCCCACCAGG - Intronic
1062273800 9:135721382-135721404 GGCAGGACTGGGATCCCACCTGG - Intronic
1062491320 9:136806423-136806445 CTCAGGACTGGGCTCCTGGGTGG + Intronic
1062511646 9:136909595-136909617 CACCGGCCTCGCCTCCCAGCGGG + Intronic
1187398021 X:18934881-18934903 CACAGCACTGGGCTCCGCCCTGG - Intronic
1188756601 X:33970028-33970050 CATAGGTCTGGGCTCCCTGAAGG - Intergenic
1189023958 X:37371548-37371570 CCTAGGTCTGGGCTCCCAGAAGG - Intronic
1189083667 X:37998326-37998348 CTCAGGTCTGGGCTCCCCGAAGG - Intronic
1189214327 X:39310386-39310408 CACAGGACTGGCATTCTAGCTGG - Intergenic
1189223191 X:39390265-39390287 CACAGATCTGGGCTTCCTGCAGG - Intergenic
1189856286 X:45228527-45228549 CCCAGGTCTGGGCTCCCCGAAGG + Intergenic
1190701178 X:52990912-52990934 CAAAGGACTGTGCTCGGAGCTGG + Intronic
1191694632 X:63977432-63977454 CAGGGCACTGGGCTCCCTGCTGG - Intergenic
1192170392 X:68851219-68851241 AACAGAGCTGGGGTCCCAGCAGG + Intergenic
1193046410 X:77059464-77059486 CACAGGACTTTGTTTCCAGCTGG + Intergenic
1193360200 X:80572122-80572144 CACAGAGCTGGGCTGCCCGCCGG + Intergenic
1194662679 X:96644159-96644181 CACAGGATTGTGCACCTAGCAGG - Intergenic
1195199385 X:102533041-102533063 CAGAGCACTGGGCTCCCCTCTGG - Intergenic
1197527305 X:127578322-127578344 CTGAGGTCTGGGCTCCCAGAAGG - Intergenic
1197593715 X:128441379-128441401 GACAGGAATGGGCTCCAAGGTGG + Intergenic
1197789754 X:130242197-130242219 CACATGACTGCACTCCCACCTGG + Intronic
1199197508 X:145048398-145048420 CAGAGCAGTGGGCTCCCATCTGG - Intergenic
1199614869 X:149648358-149648380 CCCAGGTCTGGGCTCCCGGATGG - Intergenic
1201073439 Y:10170035-10170057 CACAGTACTGGGATCCCCTCTGG - Intergenic
1201592612 Y:15631926-15631948 CACAGGACAGAGCACCCAGAGGG + Intergenic