ID: 902233691

View in Genome Browser
Species Human (GRCh38)
Location 1:15044268-15044290
Sequence GGGCAGAGCAGAACACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902233677_902233691 27 Left 902233677 1:15044218-15044240 CCGGGACGTCTGGCACCGACTCA 0: 1
1: 0
2: 0
3: 3
4: 46
Right 902233691 1:15044268-15044290 GGGCAGAGCAGAACACAAGCAGG 0: 1
1: 0
2: 1
3: 46
4: 257
902233679_902233691 12 Left 902233679 1:15044233-15044255 CCGACTCACATCGGAGACCTAGG 0: 1
1: 0
2: 0
3: 7
4: 46
Right 902233691 1:15044268-15044290 GGGCAGAGCAGAACACAAGCAGG 0: 1
1: 0
2: 1
3: 46
4: 257
902233690_902233691 -5 Left 902233690 1:15044250-15044272 CCTAGGGTGGGGTGGGTGGGGCA 0: 1
1: 0
2: 8
3: 100
4: 722
Right 902233691 1:15044268-15044290 GGGCAGAGCAGAACACAAGCAGG 0: 1
1: 0
2: 1
3: 46
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902233691 Original CRISPR GGGCAGAGCAGAACACAAGC AGG Intronic
900150650 1:1177945-1177967 GGGAGGAGCGGAACACAGGCTGG - Intronic
900342963 1:2197341-2197363 GGGCAGAGCCGAGCAGAAGCAGG + Intronic
900811299 1:4803289-4803311 GGGCAGAGCAGAAGACAGACAGG - Intergenic
901804035 1:11726518-11726540 GTGCAGAGAAGAGCAGAAGCGGG + Intergenic
902233691 1:15044268-15044290 GGGCAGAGCAGAACACAAGCAGG + Intronic
904396644 1:30226968-30226990 GGGCAGAGCAGAGCAGGACCAGG + Intergenic
905359988 1:37412579-37412601 GCTCAGAACAGAGCACAAGCCGG - Intergenic
905572113 1:39014324-39014346 AGGCAGAGCAGACCAGAGGCAGG + Intergenic
905923325 1:41733235-41733257 GGGAAGATGAGAACACAAGCAGG + Intronic
908404136 1:63797340-63797362 GGGCACAGCAGAAAAAAAGCTGG - Intronic
909754894 1:79213177-79213199 GGGCAGAGAAGAGCACAAAGAGG - Intergenic
911533254 1:99071100-99071122 AGGGAGAGCAGAGGACAAGCTGG - Intergenic
915583324 1:156829371-156829393 GGGCAGAGCAGGACTGAAGATGG + Intronic
915625101 1:157109583-157109605 GGTCAGAGCAGAACTGAAGTGGG + Intergenic
915822751 1:159042824-159042846 GGGCAGAACAAAAGGCAAGCTGG - Intronic
915823118 1:159046985-159047007 GGGCAGAACAAAAGGCAAGCTGG - Intronic
915991630 1:160523147-160523169 GGCCAAAGCAGAAGACAAACAGG + Exonic
917730869 1:177873361-177873383 AGGCAGAGTAGCACACAGGCGGG - Intergenic
921449672 1:215290361-215290383 GGGTGGAGCAGAACAAAACCAGG - Intergenic
921860114 1:220034083-220034105 GGTTAGAGCAGAATACAAACAGG + Intronic
922976689 1:229790740-229790762 AGGCAGAGGAGAACAAAAGAAGG - Intergenic
924027224 1:239847045-239847067 GGACAGAGTAGAACACCAGAAGG - Intronic
1062881131 10:979304-979326 GGGCAGAGGAAGACACAATCTGG - Intergenic
1063927302 10:10993085-10993107 GGGCAGGGCAGAACAATTGCAGG + Intergenic
1064574897 10:16734909-16734931 GGGCAAAGCTGAACACAGACAGG + Intronic
1065122804 10:22544805-22544827 GGGCAGAGCAGAGCTCAAGTGGG - Intronic
1065521113 10:26573856-26573878 GGGCACAGCACACCACAAGGGGG + Intergenic
1067297703 10:44984257-44984279 GGGCAGAGCACCTCACAGGCAGG - Intronic
1067577877 10:47419427-47419449 GGGCAGAGAAGGACACTTGCAGG + Intergenic
1070798376 10:79230393-79230415 GGGCAGAGCTAAACAACAGCAGG - Intronic
1071235220 10:83638073-83638095 ATGAAGAGCAGAACAGAAGCAGG + Intergenic
1072457338 10:95588227-95588249 GGGCAGGGCAGTGCAGAAGCTGG - Intergenic
1075132207 10:119749286-119749308 CAGCAGGGCAGAAAACAAGCGGG - Intronic
1076076708 10:127539040-127539062 GGGTGGAGCAGAACACAGGAGGG - Intergenic
1076283752 10:129274056-129274078 GGGCAGATGAGAACTCCAGCTGG + Intergenic
1077237412 11:1488394-1488416 GGGCAGAGCATAAAGGAAGCTGG + Intronic
1077598891 11:3558794-3558816 TGGGAGAGAAGAAGACAAGCTGG + Intergenic
1080873009 11:36253261-36253283 GGGCAGAGGATAAAACAGGCTGG + Intergenic
1083590562 11:63891493-63891515 GGGCAGAGCAGAGCTCAGGATGG + Intronic
1084254969 11:67934690-67934712 TGGGAGAGAAGAAGACAAGCTGG + Intergenic
1084817916 11:71661226-71661248 TGGGAGAGAAGAAGACAAGCTGG - Intergenic
1089355611 11:117850283-117850305 GGGCAGAACAGACCTGAAGCTGG + Intronic
1089702567 11:120254439-120254461 GGGCAGAGGAGATGACAAGTTGG + Intronic
1089846434 11:121462310-121462332 GGGCAGAGCAGAAGCCAGGAAGG - Intronic
1089997516 11:122922845-122922867 GGGGAGATCTGAACACAAACAGG + Intronic
1090879836 11:130823860-130823882 GGGCAGAGCTGGGCAAAAGCTGG - Intergenic
1094100741 12:26759653-26759675 GTGCAGAGCACAACTAAAGCAGG + Intronic
1095987769 12:48010885-48010907 GGGCGGTGCAGAACACAATGGGG - Intergenic
1096372410 12:51080110-51080132 GGGAAGAGAAGAAGGCAAGCAGG + Intronic
1097689475 12:62721114-62721136 GGGCAGAGCAAATCACAGCCTGG + Intronic
1099474586 12:83092852-83092874 CGGCAAAGCTGAACAAAAGCAGG + Intronic
1102814994 12:115858513-115858535 GGACAGAGCATAATCCAAGCAGG + Intergenic
1103608610 12:122107054-122107076 AGACAGAGGAGAACACAAGGAGG - Intronic
1104384472 12:128338548-128338570 GGACAGAGCTGAGCACATGCTGG + Intronic
1105316170 13:19266116-19266138 GGACAGACCAGAACACAGGGAGG + Intergenic
1106057699 13:26254138-26254160 GGGCAGAGCCGCACAACAGCCGG - Exonic
1106079420 13:26488041-26488063 GGGAAGGTCAGAAGACAAGCAGG + Intergenic
1106920939 13:34562426-34562448 GGGAAGAGCAGAACAGATGTGGG - Intergenic
1108361825 13:49674821-49674843 GGGCTGAGCAGGGCAAAAGCTGG - Intronic
1108860186 13:54847886-54847908 GGGAAGAGCAGAATAAAAGATGG - Intergenic
1115500188 14:34042747-34042769 CGGGAGAGCAGCACACAGGCAGG + Intronic
1117180275 14:53184228-53184250 GGGCAGAGGAGAACAAAGGAAGG + Intergenic
1117797003 14:59405311-59405333 GGGCATAGCTGAACAAAAGGTGG - Intergenic
1120728905 14:87979829-87979851 GGACAGAGCAGAAGCCAAGTTGG - Intronic
1121571014 14:94946657-94946679 GGGCAGTGGAGAACAGAGGCAGG - Intergenic
1122128654 14:99592725-99592747 GGGCAGAGCAGTAGACAGGAGGG + Intronic
1123008608 14:105336332-105336354 GGACAGCACAGAACACGAGCAGG - Intronic
1123042564 14:105496394-105496416 GGGCGGAGCAGAGCAGAGGCAGG - Intronic
1123113340 14:105882949-105882971 GGCCAGAGCAGATCCCAGGCAGG - Intergenic
1123402674 15:20003381-20003403 GGCCAGAGCAGATCCCAGGCAGG - Intergenic
1123512013 15:21010035-21010057 GGCCAGAGCAGATCCCAGGCAGG - Intergenic
1124614397 15:31231122-31231144 GAGCAGAACAGAACACACACTGG + Intergenic
1125719502 15:41838595-41838617 GGGCTGAGCAGAAGGAAAGCAGG - Intronic
1127293852 15:57592576-57592598 GGGCAAACCAGAACAGCAGCCGG + Intronic
1127566032 15:60189293-60189315 GGGTAGGGTATAACACAAGCTGG + Intergenic
1128635576 15:69299968-69299990 GGGCAGATGAGAAGACAAGGAGG + Intronic
1128895822 15:71372841-71372863 GGGCATAGCTGAACAAAAGGCGG - Intronic
1129394752 15:75237675-75237697 GGGAGGAGCAGAACAGAAGCAGG + Intergenic
1129882847 15:79018549-79018571 GAGCAAAGCAGAACCAAAGCAGG - Intronic
1129893087 15:79084775-79084797 GGGGAGAGCTGAAGACAAGCAGG - Intronic
1132399368 15:101496086-101496108 GAGCAGAGCAGAAGACAGGATGG + Intronic
1132751400 16:1459483-1459505 GGGGAGAGCAGCACACATGTCGG + Intronic
1132751420 16:1459553-1459575 GGGGAGAGCAGCACACATGTCGG + Intronic
1132751522 16:1459903-1459925 GGGGAGAGCAGCACACACGTCGG + Intronic
1132751550 16:1460008-1460030 GGGAAGAGCAGCACACACGTTGG + Intronic
1133166881 16:3954296-3954318 GGACAGAGCAGAGGACAGGCTGG - Intronic
1136050809 16:27648610-27648632 GTGCAGATCAGAACAGAAGCTGG + Exonic
1137324956 16:47425011-47425033 GGGCATAGCAGAACAAAAGGCGG - Intronic
1137568629 16:49550336-49550358 GGGCGGAGCAGAACACAGAATGG - Intronic
1139548928 16:67662821-67662843 GTCCAGAGCAGAAGGCAAGCTGG - Intergenic
1139583023 16:67884351-67884373 AGGCATGGCAGAACCCAAGCAGG - Exonic
1141003666 16:80331929-80331951 GAGCAGAGCAGAAGACAAGAGGG + Intergenic
1142236777 16:88926158-88926180 GGGCAGAGCAGAGCCGCAGCCGG + Intronic
1142328007 16:89430878-89430900 GGGAAGAGGAGAGCACAGGCAGG - Intronic
1142519862 17:497282-497304 GTTCAGAGCAGAATACATGCAGG + Intergenic
1142856652 17:2734339-2734361 AGGTAGAGCAGAAATCAAGCAGG - Intergenic
1144553273 17:16260090-16260112 GGGCAGAGATGAGCACAAGTGGG + Intronic
1144701806 17:17345286-17345308 GGGCAGAGCAGAGCTCCTGCAGG + Intronic
1145095760 17:20024686-20024708 GTGCAAAGCAGAAAACAAGGGGG - Intronic
1146599232 17:34200025-34200047 AGGAGGAACAGAACACAAGCAGG + Intergenic
1148505482 17:48123782-48123804 GGACAGAGCAAAACAGAAGAGGG - Intergenic
1151480688 17:74368662-74368684 GACCAGAGCAGCCCACAAGCAGG - Intronic
1151546028 17:74793680-74793702 CCTCAGAGCAGAAAACAAGCTGG + Intronic
1152894833 17:82905161-82905183 GGGCGGAGCAGGACAGAGGCAGG - Intronic
1153914264 18:9732169-9732191 AGGCAGAGCAGAGCCCATGCTGG - Intronic
1153980468 18:10304529-10304551 GGTCAGAGCAGAACAGAGGTGGG - Intergenic
1154164609 18:12005208-12005230 GGGCAGAGGTGTACACAAGGTGG + Intronic
1158746558 18:60206750-60206772 GGGAAAGGCAGAACCCAAGCTGG - Intergenic
1158823690 18:61190216-61190238 GGGTAGAGAAGAACACCAACAGG + Intergenic
1161482422 19:4517653-4517675 GGGCAGAGCTGAAGCCAGGCAGG + Exonic
1163685611 19:18710175-18710197 GGGCTGTGCAGAAAACAAGCTGG - Intronic
1163729151 19:18939943-18939965 GGGCAGAGCAGAATCCACACTGG + Intronic
1163935512 19:20439020-20439042 GATCAGAGCAGAACCCTAGCAGG - Intergenic
1164949162 19:32321902-32321924 CGGCAGAGCAGAACAGCAGACGG - Intergenic
1165677901 19:37744210-37744232 GAGCAGAGCAGCTCCCAAGCAGG + Intronic
1166390468 19:42406447-42406469 GGGCAGGGAGGAACTCAAGCTGG + Intronic
1166419739 19:42627092-42627114 GGGCAAAGTAGAACTGAAGCTGG - Intronic
1168472586 19:56651467-56651489 GGGCACAGAAGAAAGCAAGCAGG + Intronic
926391345 2:12396613-12396635 GAGCAGAGCAGAAGACCAGAAGG - Intergenic
926429271 2:12769169-12769191 TGGCAGAGGAGAATACAAGAAGG - Intergenic
928402510 2:30989305-30989327 GGGCAGAGGAGAACAGAGGTGGG - Intronic
930751589 2:54939663-54939685 AGACAGAGCAGAACCCAGGCAGG - Intronic
933518083 2:83331481-83331503 GGACAGAGCAGAACAAAAGCTGG - Intergenic
934621126 2:95807828-95807850 GTGCAGAGCAAAAAACATGCAGG - Intergenic
937640493 2:124205626-124205648 GGGCGGATCACAAGACAAGCTGG - Intronic
937867310 2:126762319-126762341 AGGAAGAGCAGGCCACAAGCTGG + Intergenic
938785991 2:134630472-134630494 GTGCAGAGAATAAGACAAGCAGG + Intronic
940147621 2:150563656-150563678 CGCCAGACCAGAACAGAAGCAGG + Intergenic
941903445 2:170698965-170698987 AGGCAAAGCAGAACTCCAGCAGG - Intergenic
943927624 2:193806191-193806213 GTGCACCACAGAACACAAGCTGG + Intergenic
944306572 2:198186461-198186483 GGGCAGAGAAGAAGGAAAGCTGG - Intronic
944491968 2:200267118-200267140 GGGCATAAAAGAACACAACCCGG + Intergenic
945168396 2:206970026-206970048 GGGTGGAGCAGAACAGAAGGTGG + Intergenic
947080655 2:226392200-226392222 GTGGAGAGTAGAAAACAAGCTGG + Intergenic
948341435 2:237255915-237255937 GGACAGAGCAGTGCACAAGGAGG - Intergenic
948851743 2:240711646-240711668 GGGGAGAGGAGAGCACAGGCTGG + Intergenic
1174042251 20:47708344-47708366 GGGCATCGCAGAACCCAAGGGGG + Intronic
1178437667 21:32574034-32574056 CGGGAGAACAGAAAACAAGCGGG + Intergenic
1179050018 21:37881157-37881179 GGGCTGAGCCTAGCACAAGCTGG + Intronic
1179904175 21:44413660-44413682 GGGCAGAGCTGCACCCAGGCTGG - Intronic
1180648538 22:17359773-17359795 AGGGAGAGCAGGACAGAAGCTGG + Intergenic
1180707148 22:17816965-17816987 GGGCAGAGCTGACGCCAAGCGGG + Intronic
1181102013 22:20547472-20547494 GGACTGAGCAAAAGACAAGCCGG + Intronic
1181855274 22:25777017-25777039 GGGCACAGCATAACACAAAATGG - Intronic
1182844053 22:33416263-33416285 GGCCAGAGCAGCACACACGGTGG - Intronic
1182897883 22:33873799-33873821 GGGCAGGGCAGGACCCAAGTGGG - Intronic
1183302901 22:37067055-37067077 GGGCAGAGCAGGAGAGAAGTAGG - Intronic
1183322275 22:37172402-37172424 CTGCAGAGCAGGACTCAAGCTGG + Intronic
1184321709 22:43746918-43746940 GGACAGAGCTGCACACCAGCAGG + Intronic
1185088779 22:48754770-48754792 GGGCAGTGCAGAACCCAAGGGGG - Intronic
949191729 3:1257716-1257738 CGGCAGGGTAGAACACTAGCTGG + Intronic
949561627 3:5208002-5208024 GGGCAGAGGAGAGCCCAGGCAGG + Intronic
949863784 3:8530385-8530407 GAGCAGAGCAGAGCACTCGCCGG - Intronic
950751571 3:15133059-15133081 TGGGAGAGAAGAAGACAAGCTGG - Intergenic
952365989 3:32675395-32675417 GAGCAGAGCAGAGCACAACAAGG + Intergenic
952852708 3:37741993-37742015 GGACAGAGGAGAAAACAAGGAGG - Intronic
953947837 3:47164260-47164282 GGGCAGAGCGGAACACTGCCCGG + Intergenic
954090823 3:48282699-48282721 GGGCAGACCCAAACACAGGCAGG + Intronic
954227562 3:49192315-49192337 GGGCATAACAGAACAGAAGAAGG + Intergenic
954304383 3:49717747-49717769 GGGCAGAGCAGAAGGCAGGTTGG + Exonic
954428041 3:50453948-50453970 GGGCAGGGCAGAACAGATGCAGG - Intronic
955601232 3:60647534-60647556 GGGCAGAGGAGAGGACAACCAGG - Intronic
957069038 3:75551245-75551267 TGGGAGAGAAGAAGACAAGCTGG + Intergenic
964715293 3:159714821-159714843 GGGCATAGCTGAACAAAAGGAGG + Intronic
965658436 3:171015715-171015737 GGGCAGAGAGGAAAACAACCGGG + Intronic
966665313 3:182464976-182464998 GGGCAGTGCAGGAAAGAAGCAGG - Intergenic
969740473 4:9022016-9022038 TGGGAGAGAAGAAGACAAGCTGG - Intergenic
970546316 4:17133871-17133893 GGGGAGAGAAGAAGACAGGCAGG - Intergenic
971000394 4:22316257-22316279 GGGGAGAGAAGAAAACAACCAGG + Intergenic
972951711 4:44333481-44333503 AGGCAGAGCTGAGCACAAGCTGG + Intronic
972974081 4:44612145-44612167 GGAAAGAGCAGAACACAATAAGG + Intergenic
973224496 4:47767235-47767257 AGGCAGAGAAGAACAAAAACTGG + Intronic
979000415 4:115210329-115210351 GGGCAGGGAACATCACAAGCTGG + Intergenic
981005002 4:139865772-139865794 GGTCAGAGGAGGACCCAAGCAGG - Intronic
981019132 4:140006640-140006662 GGGCAGAGCAGAAAAAAAGGTGG + Intronic
983112341 4:163767686-163767708 GGGTAGATCAGAACATAAGGCGG - Intronic
984873245 4:184345743-184345765 GGGCAGAGCAGGCCAAGAGCTGG + Intergenic
985867845 5:2529271-2529293 AGGCAGAGCAGAGGAAAAGCTGG - Intergenic
986042355 5:4005741-4005763 GGGCAGATCAGAACACAGTCAGG - Intergenic
986741917 5:10712124-10712146 GGGGAGAGCAGGACACAGACAGG + Intronic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
991234781 5:64380858-64380880 GGGCAGAGAAGATCACAAGAAGG + Intergenic
991616556 5:68502832-68502854 GGGTATACCAGAACAAAAGCAGG + Intergenic
992265103 5:75010458-75010480 GGATAGAGCATAACAGAAGCAGG - Intergenic
994071955 5:95612803-95612825 GGGCAGAGCAGAAGACCTGATGG + Intergenic
994390288 5:99184296-99184318 GATCAGAGAAGAACAGAAGCAGG + Intergenic
995419002 5:111941493-111941515 GCGCAGAGGAGGACACAAACAGG - Intronic
995654062 5:114404572-114404594 GGGCATAGGAGAAGGCAAGCCGG - Exonic
998916457 5:147017313-147017335 AGAAAGAGCAGAACACAGGCTGG + Intronic
999347546 5:150837547-150837569 AGGCAGAGGAGAACAAAAGAAGG + Intergenic
999833839 5:155347876-155347898 AGGCAGAGGAGAACAAAAGAAGG - Intergenic
999909483 5:156182288-156182310 GAGCAGAACAGAAAATAAGCTGG + Intronic
999996854 5:157100488-157100510 GGACAGAGCAGGAAACAAGAGGG + Intronic
1001582330 5:172807331-172807353 GGGCTGAGCATGACAGAAGCCGG - Intergenic
1002207734 5:177575298-177575320 AGGCAGAGGAGAACAAAAGAAGG + Intergenic
1004276144 6:14236629-14236651 GGTCAGAGCAGGAAACAAGCAGG + Intergenic
1004345933 6:14849366-14849388 GGGGAATGCAGAACAAAAGCAGG + Intergenic
1006309018 6:33244145-33244167 GGGCAGATCACAAAACAGGCAGG - Intergenic
1006616639 6:35332510-35332532 GGGCATAGCTGAACAAAAGTAGG + Intergenic
1006815101 6:36844782-36844804 GGGCACAGAAGAGCAGAAGCGGG + Intergenic
1007607900 6:43129676-43129698 GGGCAGAGCAGGGCAAAGGCGGG - Intronic
1008091765 6:47300951-47300973 AAGAAAAGCAGAACACAAGCAGG + Intronic
1011953366 6:92995735-92995757 GGGCATAGCCGAACAAAAGGTGG + Intergenic
1014184939 6:118424182-118424204 GATCAGAGCAGAACTGAAGCAGG + Intergenic
1014708904 6:124783179-124783201 GGGCAGAGCAGAAGATACTCAGG - Intronic
1016816748 6:148309828-148309850 GGGCAAAGGAGAACAAAAACTGG + Intronic
1018515830 6:164579238-164579260 GCACAGAGCAGAACCCAAGCAGG + Intergenic
1018653076 6:166007411-166007433 GGGAAATGCAGAACACAGGCTGG - Intergenic
1018690072 6:166337503-166337525 CGGCAGAGGAGACCCCAAGCAGG - Intronic
1018935657 6:168272383-168272405 GGGGAGGGCAGTGCACAAGCTGG - Intergenic
1019440493 7:1043815-1043837 GGGCCGAGTGGAACACCAGCAGG - Intronic
1020341286 7:7113918-7113940 AGGCAAAGGAGGACACAAGCAGG - Intergenic
1020701448 7:11488981-11489003 GGGCAGAGCACAACTCCATCTGG - Intronic
1021186488 7:17571102-17571124 GGGCATAGCTGAACAAAAGGTGG - Intergenic
1021986158 7:26100452-26100474 GGGCAGAGTAGAAAACAAAAGGG - Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024380680 7:48692467-48692489 GGGAAAAGCAGAACAAAACCAGG - Intergenic
1028836174 7:95377339-95377361 GGGCAAATCAGAACAAAAGGCGG + Intronic
1028871459 7:95774751-95774773 GGACAGAGCAGCACCCAGGCTGG - Intronic
1029538703 7:101170670-101170692 GGGCAGAGGTGGACACCAGCAGG - Exonic
1029977954 7:104851911-104851933 GGGCAGAGCAGGAGAAAAGCTGG + Intronic
1032520798 7:132543312-132543334 GGGCATTACAGGACACAAGCTGG - Intronic
1035677824 8:1467520-1467542 TGGCAGAGCCCAGCACAAGCTGG + Intergenic
1036085909 8:5612604-5612626 GGGCAGAGATGCACACAAGCGGG + Intergenic
1036245678 8:7114578-7114600 TGGGAGAGAAGAAGACAAGCTGG - Intergenic
1036768534 8:11563877-11563899 CGGCAGAGGAGACCGCAAGCGGG - Intronic
1037577694 8:20223546-20223568 GGGAATGGCAGAACACGAGCTGG + Intronic
1037590597 8:20308849-20308871 GGGCAGTGTTGACCACAAGCAGG + Intergenic
1038613004 8:29071340-29071362 GGGGAGACCGGAACAAAAGCGGG + Intronic
1040280651 8:46040192-46040214 GGGCAGGGCAGACCGCCAGCAGG + Intergenic
1041833566 8:62184682-62184704 GGGAGGAGAACAACACAAGCTGG - Intergenic
1042328333 8:67551945-67551967 GGGCAGTGAAGAATTCAAGCTGG + Intronic
1045334185 8:101183671-101183693 TGGCAGAGCAGGACGCTAGCTGG - Intronic
1046508044 8:115161442-115161464 AGGAAGAGAAGATCACAAGCAGG + Intergenic
1046974433 8:120258218-120258240 TAGAAGAGCAGAACACAAGAAGG - Intronic
1047966258 8:130048999-130049021 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966263 8:130049020-130049042 GGGCAGAGGAGAACACACTGGGG + Intergenic
1047966296 8:130049146-130049168 GGGCAGATGAGAACACATGGGGG + Intergenic
1047966304 8:130049167-130049189 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966312 8:130049188-130049210 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966318 8:130049209-130049231 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966333 8:130049250-130049272 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966339 8:130049271-130049293 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966346 8:130049291-130049313 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966354 8:130049312-130049334 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966360 8:130049333-130049355 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966365 8:130049353-130049375 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966373 8:130049374-130049396 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966381 8:130049395-130049417 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966387 8:130049416-130049438 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966400 8:130049457-130049479 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966413 8:130049498-130049520 GGGCAGAGGGGAACACATGGAGG + Intergenic
1047966421 8:130049519-130049541 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966427 8:130049540-130049562 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966440 8:130049581-130049603 GGGCAGAGGGGAACACATGGAGG + Intergenic
1047966448 8:130049602-130049624 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966456 8:130049623-130049645 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966462 8:130049644-130049666 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966467 8:130049664-130049686 GGGCAGAGGGGAACACATGGAGG + Intergenic
1047966475 8:130049685-130049707 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966480 8:130049705-130049727 GGGCAGAGGGGAACACATGGAGG + Intergenic
1047966488 8:130049726-130049748 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966494 8:130049747-130049769 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966501 8:130049767-130049789 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966509 8:130049788-130049810 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966515 8:130049809-130049831 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966528 8:130049850-130049872 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966541 8:130049891-130049913 GGGCAGAGGGGAACACATGGAGG + Intergenic
1047966549 8:130049912-130049934 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966555 8:130049933-130049955 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966568 8:130049974-130049996 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966576 8:130049995-130050017 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966584 8:130050016-130050038 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966595 8:130050057-130050079 GGGCAGAGGAGAACACATGGAGG + Intergenic
1047966601 8:130050078-130050100 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966607 8:130050099-130050121 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966615 8:130050120-130050142 GGGCAGAGGGGAACACATGGGGG + Intergenic
1047966628 8:130050161-130050183 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966641 8:130050202-130050224 GGGCAGAGGAGAACACATGGGGG + Intergenic
1047966647 8:130050223-130050245 GGGCAGAGGAGAACACATGGGGG + Intergenic
1049363320 8:142224674-142224696 TGGCAGAGCTGAGCCCAAGCTGG + Intronic
1049621627 8:143600834-143600856 GGCCAGAGCAGAACAGAACCAGG - Exonic
1049744358 8:144256945-144256967 AGGCAGAGCTGCACTCAAGCTGG + Intronic
1050305140 9:4299055-4299077 GGGCAGAGGGGTACACAATCAGG - Intronic
1051589049 9:18757570-18757592 GGGCAGGGGAGTATACAAGCAGG - Intronic
1053217964 9:36288596-36288618 TGGCAGAGCAGAACCCGGGCAGG + Intronic
1053914537 9:42935984-42936006 GGGAAGAACAAAACACAAACGGG - Intergenic
1056286465 9:85092268-85092290 GTGCAGAGCAGAGGAGAAGCTGG - Intergenic
1056940925 9:90955639-90955661 GGGCAGAGCTGAGCACAGGACGG + Intergenic
1058416764 9:104796974-104796996 TGGCAGAGCAAAGCACCAGCAGG + Intronic
1060050322 9:120374174-120374196 AGGCAGAGCAAAACACAAAGGGG - Intergenic
1060723370 9:125992591-125992613 GGGCAGAGAGGAACAGAGGCCGG + Intergenic
1061550902 9:131334171-131334193 GGCCAGGGCTGGACACAAGCTGG - Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1189516716 X:41719769-41719791 AGGCAGAGGAGAACAAAAGAAGG + Intronic
1190876152 X:54461671-54461693 GGGCTGGGGAGAACACAATCTGG + Intronic
1193260702 X:79403643-79403665 GGGCATACTAAAACACAAGCTGG + Intergenic
1195292919 X:103446391-103446413 GGACATAGCAGAACATATGCTGG + Intergenic
1196307774 X:114124812-114124834 GGTCAGAGCAGAACTGAAGGAGG - Intergenic
1198655854 X:138912769-138912791 TGGCAAAGCAGAACAGAATCTGG - Intronic
1198660323 X:138961563-138961585 GGGCATAGCTGAACAAAAGGCGG - Intronic
1199456785 X:148037995-148038017 GGGCAGAGCACAATAGAAGCTGG + Intergenic
1200211600 X:154349082-154349104 GAGGAGAGCAGGACACCAGCGGG - Intronic
1200243283 X:154508696-154508718 CCGCAGAGCAGGACACAAGTAGG + Intronic
1201992410 Y:20042422-20042444 GGGCACAGCTGAACAAAAGGAGG - Intergenic