ID: 902235280

View in Genome Browser
Species Human (GRCh38)
Location 1:15053389-15053411
Sequence TTGTCCTACTGCAAGAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902235280_902235285 12 Left 902235280 1:15053389-15053411 CCATTGTTCTTGCAGTAGGACAA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 902235285 1:15053424-15053446 CTGGGCCATCAACACAACAAAGG 0: 1
1: 0
2: 0
3: 6
4: 143
902235280_902235281 -7 Left 902235280 1:15053389-15053411 CCATTGTTCTTGCAGTAGGACAA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 902235281 1:15053405-15053427 AGGACAACAGAGCTGTTCCCTGG 0: 1
1: 0
2: 1
3: 10
4: 218
902235280_902235282 -6 Left 902235280 1:15053389-15053411 CCATTGTTCTTGCAGTAGGACAA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 902235282 1:15053406-15053428 GGACAACAGAGCTGTTCCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902235280 Original CRISPR TTGTCCTACTGCAAGAACAA TGG (reversed) Intronic
902235280 1:15053389-15053411 TTGTCCTACTGCAAGAACAATGG - Intronic
904862469 1:33549164-33549186 ATGTCAAACTGCAAGAACAGTGG + Intronic
909389268 1:75099905-75099927 TTTTACTACAGCAAGAAGAATGG + Intergenic
914696901 1:150091715-150091737 TTGTCCTAAAGCAATTACAATGG + Intronic
918460512 1:184771910-184771932 TTGACCTATTCTAAGAACAAAGG + Intergenic
918926468 1:190792845-190792867 CTGCCTTACTGCAAGGACAAAGG + Intergenic
921195577 1:212754355-212754377 TTGGCCTCCTGCAAGATAAAAGG + Intronic
921666199 1:217874671-217874693 ATATTCTACTGCAACAACAAAGG - Intergenic
922493048 1:226034015-226034037 CTGTCCTACTGCAAGCACCTGGG - Intergenic
922673620 1:227534167-227534189 TTGGCCTAATGCAATTACAAGGG + Intergenic
922871442 1:228905156-228905178 ATGTCCTTGTTCAAGAACAAGGG + Intergenic
1063808665 10:9678582-9678604 TTGTCATACTGGAAAAGCAAAGG - Intergenic
1064251208 10:13707737-13707759 TTGTGCTGCAGCAAGAAGAATGG - Intronic
1064714256 10:18160018-18160040 TTATCCTACAGAAAAAACAAGGG - Intronic
1070127599 10:73634651-73634673 TTCTCATACAGCAAGAGCAACGG - Exonic
1070400662 10:76050814-76050836 TTTTGCTACAGAAAGAACAATGG + Intronic
1074726015 10:116310853-116310875 TTTGCCTACTTCAAGAAAAATGG - Intergenic
1079319158 11:19436695-19436717 TTGTTCTACTTCATGAACATAGG + Intronic
1079501581 11:21106584-21106606 TTTTCCTACTCCAAGAACAATGG - Intronic
1079767908 11:24416971-24416993 TTGTTCTGCTTCAAGAACATTGG + Intergenic
1083044343 11:59719757-59719779 TACTCCTACTGCAATAATAATGG + Intronic
1087462982 11:98468603-98468625 TTTTCCTACTGGAAGAAACATGG + Intergenic
1087647162 11:100821504-100821526 TACTCCTACTGATAGAACAATGG - Intronic
1089044647 11:115489963-115489985 TAGTCCTAAAGCAAAAACAATGG + Intronic
1089956350 11:122574747-122574769 GTGGCCTGCTGCCAGAACAAAGG + Intergenic
1092146398 12:6217701-6217723 TTGTCCTCCTGGAAAAGCAATGG - Intronic
1094400131 12:30054039-30054061 TTGCCCTACTACTAAAACAAGGG - Intergenic
1097996865 12:65897657-65897679 TTGTCCTAAAGCAAGAAGAAAGG + Intronic
1099353557 12:81605308-81605330 TGGTCATACTGAAAGAACAATGG + Intronic
1101085654 12:101233300-101233322 TTCTTCTACTGCAAGGACTAAGG + Intergenic
1108256727 13:48618350-48618372 CTGTCCTACTGCTGGAACATGGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1112119834 13:96397554-96397576 TTCTCCTACAGAAAGATCAATGG + Intronic
1112770135 13:102786234-102786256 TTTTCCTATGGCAAGTACAAGGG + Exonic
1114856867 14:26457820-26457842 TTGTCCTACTGAAAGATCTTTGG - Intronic
1117528277 14:56633343-56633365 TTCTCCTACTTACAGAACAATGG + Intronic
1118944104 14:70367096-70367118 TTCTCCCCCTGCAAGAACAAAGG + Exonic
1119965414 14:78910127-78910149 CTCTCCTACAGCAAGAACAGTGG - Intronic
1122004220 14:98688717-98688739 TTGGCCTACTTGAAGAGCAAGGG + Intergenic
1122450147 14:101799252-101799274 TTGTCCCACTGGAAAAACATGGG - Intronic
1124051744 15:26202797-26202819 TTATTATACTGCAGGAACAAGGG - Intergenic
1124101091 15:26693924-26693946 TCTTCCTGCTGGAAGAACAAGGG - Intronic
1126989590 15:54357783-54357805 AAGTCCTACTCCAAGAGCAAGGG - Intronic
1127112551 15:55690116-55690138 TGGTCTTATTGTAAGAACAATGG - Intronic
1128520519 15:68371895-68371917 TTGTCCTTTTCAAAGAACAAGGG + Intronic
1134598861 16:15517676-15517698 TGGTGCTGCTGCAGGAACAATGG + Intronic
1137327057 16:47450652-47450674 TTGTCTTTCTGAAAGTACAAAGG - Intronic
1138282742 16:55784478-55784500 CTGTCCTACTGCTTTAACAAGGG - Intergenic
1139028444 16:62848989-62849011 TTGTCTTACTGGGAGAACACAGG - Intergenic
1139185282 16:64799039-64799061 TCCTCCTACTCTAAGAACAAAGG - Intergenic
1139810054 16:69607237-69607259 ATGTCATAATGAAAGAACAAAGG - Intronic
1143368419 17:6423213-6423235 TTCTAGTACTGCAAGAAAAAAGG + Intronic
1144291118 17:13827340-13827362 CTGTCATATTGCAAGAGCAACGG + Intergenic
1144300887 17:13922342-13922364 CTGTCTTACTGCAAGGACAGAGG - Intergenic
1144566827 17:16366562-16366584 TAGTCTTGCTACAAGAACAAAGG + Intergenic
1144998016 17:19284040-19284062 TTGTCCTGCTGCACATACAATGG + Intronic
1148885387 17:50768478-50768500 GTGTCTTTCTGCAAGAACAGGGG + Intergenic
1150461351 17:65356421-65356443 GTGTCCTGCTGCTAGAAGAAGGG + Intergenic
1151084118 17:71361432-71361454 TGGTCCTACGGAAAAAACAATGG - Intergenic
1153432472 18:5033061-5033083 TTATTCTACTGCATGGACAATGG + Intergenic
1153486133 18:5600250-5600272 TTGTCATACTGCTAGAAAATTGG + Intronic
1156023622 18:32627439-32627461 TGGTGCTATTGCAAGAACAATGG - Intergenic
1159001348 18:62978247-62978269 TTGCCATCCTGGAAGAACAAGGG - Exonic
1162254493 19:9477587-9477609 TTGTCCTCTTGCAGGAGCAATGG - Intronic
926742496 2:16124493-16124515 TTCTCCCACTGCAAGGACTATGG - Intergenic
931245142 2:60486076-60486098 TTGACCTGCTGATAGAACAAGGG - Intronic
931395375 2:61883967-61883989 TTGTCCTACAAAAAGGACAATGG + Intronic
932567900 2:72920956-72920978 CCGTCCTCCTGCCAGAACAAAGG - Intronic
932950314 2:76285492-76285514 TTGTCCTACATCTAGAAAAAGGG - Intergenic
933162133 2:79037104-79037126 TTGTCTTTCTTAAAGAACAAGGG - Intergenic
933430990 2:82178853-82178875 TTATCTTACTGCAAGACCAAAGG + Intergenic
935530169 2:104222624-104222646 TTGGACTACTGCAACATCAATGG + Intergenic
936145365 2:109977076-109977098 TTGTCCTCCTGCCAGCACATTGG + Intergenic
936199321 2:110394402-110394424 TTGTCCTCCTGCCAGCACATTGG - Intergenic
937648967 2:124298756-124298778 TTGTCATACTTCAAGACCCAGGG + Intronic
937732251 2:125247400-125247422 TAGTTCTACTGCAACAAGAATGG - Intergenic
943612319 2:190047597-190047619 TTGTACTACTGCGGGAACTATGG - Intronic
945427033 2:209719052-209719074 TTTTCATAATGCAAGAACAAAGG + Intronic
945591405 2:211736488-211736510 TTGTCTTATTGCATGAACAAAGG + Intronic
1170583698 20:17718135-17718157 TTGACCTTTTGCAAAAACAATGG + Intronic
1174754801 20:53147311-53147333 TTGACCTACTGAAAGAAAAGGGG - Intronic
1175211108 20:57356305-57356327 TTATCTAACTTCAAGAACAAAGG - Intronic
1175464844 20:59183604-59183626 TTTGCCTACTGCAGGAACGAGGG - Intergenic
1178780332 21:35597434-35597456 TTGTCTTAGTGCAATAAAAAAGG - Intronic
1183056272 22:35308086-35308108 CTGTCCAAGTGCAAGGACAAGGG - Intronic
950163246 3:10775364-10775386 TTGTCCTACTAGAACAACACAGG + Intergenic
951596860 3:24327847-24327869 GTATTCTACTGCTAGAACAAAGG + Intronic
951597501 3:24334171-24334193 ATGCCCTACTGCAATAACACAGG + Intronic
951714506 3:25625432-25625454 TTGGCCTAGAGCAAGAAGAATGG - Intronic
952129702 3:30346930-30346952 TTTTCCACCTGCAAGAAAAATGG + Intergenic
956260468 3:67335214-67335236 TTATGGTACTGAAAGAACAAAGG - Intergenic
956359062 3:68427443-68427465 CTGTCCTTCTGCAACAACACTGG + Intronic
957286410 3:78222796-78222818 TTGATCTACTGCAAGTACCAAGG - Intergenic
962131435 3:132681913-132681935 TTTTCCTTCAGCAAGGACAAAGG - Exonic
963882994 3:150548910-150548932 TTGTTCTAGTGAAAGAAAAATGG - Intronic
964418070 3:156470693-156470715 CTCTCCTACTCCAAAAACAATGG - Intronic
966366062 3:179188423-179188445 TTGTACTACTGGAAAAACAAAGG + Intronic
966710493 3:182967485-182967507 TTTTCATATTGCAAGAAAAAGGG - Intronic
968166465 3:196469976-196469998 TTGTCCTTGTGAAAGAACACAGG - Exonic
973055326 4:45650656-45650678 TTGAACTCCTGCATGAACAAGGG + Intergenic
974819509 4:67047735-67047757 TTGACTTACTGCAAAAATAATGG - Intergenic
975174613 4:71273423-71273445 TTCTCCCACTGCAAGAATTAGGG - Intronic
978882908 4:113729434-113729456 TTGCCATGCTGGAAGAACAAAGG - Intronic
981410386 4:144423367-144423389 TTTTCATAATGAAAGAACAATGG + Intergenic
981651461 4:147063987-147064009 CTGTACTACTGCAAATACAAAGG + Intergenic
981776669 4:148376365-148376387 TTGCCCAACAGGAAGAACAAAGG + Intronic
984596744 4:181677541-181677563 TTGTCCCACAGCTAAAACAAAGG - Intergenic
986326638 5:6680371-6680393 TTGTCCTACTGAATGGACACTGG - Intergenic
988374294 5:30414204-30414226 TCCTCCTACTCCAAGCACAAAGG - Intergenic
994892869 5:105660910-105660932 TTGTATTAAAGCAAGAACAAAGG - Intergenic
995232809 5:109789090-109789112 CTTTGCTAATGCAAGAACAATGG - Intronic
999977949 5:156930481-156930503 ATGTCCTACTGACAGAAGAAAGG + Intronic
1000576573 5:162982403-162982425 TTGTCTCACAGAAAGAACAAAGG + Intergenic
1001907632 5:175486230-175486252 GTGTCATACTTCAAGAAAAATGG + Intronic
1003893870 6:10588532-10588554 TTTTCCTAGTGCAAGAGAAACGG - Intronic
1007374678 6:41448385-41448407 TTCTCCTACTGCAAGCACTCTGG + Intergenic
1008149159 6:47929523-47929545 TTTACCTACTGCAAGATGAAAGG - Intronic
1008506310 6:52234207-52234229 TTCTCCTACAGGAAAAACAAAGG + Intergenic
1009270084 6:61604074-61604096 TAGTCCTTTTGCAAGAGCAAGGG - Intergenic
1011841468 6:91505919-91505941 TGGACCAACAGCAAGAACAAGGG - Intergenic
1015496263 6:133886879-133886901 ATGTCTTACTGCAAGATAAATGG + Intergenic
1015680959 6:135807943-135807965 TTGTCCCACTGGAAGAATATGGG + Intergenic
1018832821 6:167458409-167458431 TTGTACTTCTACAAGAATAATGG + Intergenic
1019815230 7:3195070-3195092 GTGTGCTACTGCAGGAACACAGG + Intergenic
1019842104 7:3457336-3457358 TTTTCTTCCTGCAAGAAGAAAGG - Intronic
1021654418 7:22861095-22861117 TTGTCCAGCTGCAAAATCAATGG - Intergenic
1027555456 7:79659331-79659353 TGGTACTTCTGCAAGACCAAGGG - Intergenic
1033211778 7:139465221-139465243 TAGTCCTTTTGCAAGAGCAAGGG - Intronic
1036070371 8:5435843-5435865 TTGTCATAAGGCAAAAACAAAGG - Intergenic
1036286110 8:7445441-7445463 TTAACCTACTGCAACAATAAAGG - Intronic
1036335364 8:7866088-7866110 TTAACCTACTGCAACAATAATGG + Intronic
1039753621 8:40499248-40499270 TTTTCCTACTGAAAGAAAAGAGG + Intergenic
1039804828 8:40988855-40988877 CTGTCCCACTGCAAGGACACTGG - Intergenic
1042074141 8:64969765-64969787 GTTTCTTACTACAAGAACAATGG + Intergenic
1042463369 8:69097352-69097374 TTGTCCTAGTGCTAGAATTAAGG + Intergenic
1044121264 8:88399108-88399130 TTTTCCTAATGCCAGGACAAGGG + Intergenic
1046327805 8:112672805-112672827 TTGTCTTACTTTAAGAAGAAAGG + Intronic
1052342907 9:27380705-27380727 CTGGACTACAGCAAGAACAAGGG - Intronic
1052984847 9:34479343-34479365 TTCTCATTCTGCAAGACCAAGGG + Intronic
1054368565 9:64368536-64368558 TTGTCCTCCTTCAAGAACGCAGG - Intergenic
1056571113 9:87815877-87815899 TTTTTCTAATGCAAGAACACAGG - Intergenic
1058150508 9:101458764-101458786 GTGTCATATTGCATGAACAAGGG + Intergenic
1058494987 9:105547133-105547155 TTTACCTACTGCACTAACAATGG + Intronic
1058570629 9:106339038-106339060 TGGTGCTATTTCAAGAACAATGG - Intergenic
1186268690 X:7860810-7860832 GTGTCCTAATGAAAGAAGAAAGG + Intergenic
1192676911 X:73206862-73206884 TTGTCCTAATTGAACAACAAAGG + Intergenic
1194689960 X:96972198-96972220 TTTCACTACTGCAAGAACATAGG + Intronic
1196498251 X:116347766-116347788 TTGTCCTACTGCCTGAATTAGGG + Intergenic
1196998241 X:121407632-121407654 CTGCCCTATTGCAAGAACAGAGG - Intergenic
1197006107 X:121500456-121500478 TTGGGCTGCTGCAAGAAGAAGGG + Intergenic
1197981838 X:132225347-132225369 TTGTCCTAGTGTCAAAACAAGGG - Intergenic
1199355188 X:146854322-146854344 ATGCCCTACTGTAAGATCAAGGG - Intergenic
1199617025 X:149664558-149664580 TTGCACTACTGCAAGCTCAATGG - Intergenic
1199625616 X:149738690-149738712 TTGCACTACTGCAAGCTCAATGG + Intergenic