ID: 902236811

View in Genome Browser
Species Human (GRCh38)
Location 1:15062941-15062963
Sequence CCTTCCAGGCAGGAGCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902236811_902236817 -6 Left 902236811 1:15062941-15062963 CCCTGGAGCTCCTGCCTGGAAGG 0: 1
1: 0
2: 3
3: 34
4: 296
Right 902236817 1:15062958-15062980 GGAAGGAGCACTGTGCCAGGAGG 0: 1
1: 0
2: 5
3: 44
4: 331
902236811_902236816 -9 Left 902236811 1:15062941-15062963 CCCTGGAGCTCCTGCCTGGAAGG 0: 1
1: 0
2: 3
3: 34
4: 296
Right 902236816 1:15062955-15062977 CCTGGAAGGAGCACTGTGCCAGG 0: 1
1: 1
2: 3
3: 34
4: 417
902236811_902236819 15 Left 902236811 1:15062941-15062963 CCCTGGAGCTCCTGCCTGGAAGG 0: 1
1: 0
2: 3
3: 34
4: 296
Right 902236819 1:15062979-15063001 GGAATCTGACAGCCCCCAATTGG 0: 1
1: 0
2: 0
3: 4
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902236811 Original CRISPR CCTTCCAGGCAGGAGCTCCA GGG (reversed) Intronic
900365525 1:2310589-2310611 CCTTCCCGGCTGGGCCTCCACGG + Intergenic
900465765 1:2824779-2824801 CCCCCCAGGCATCAGCTCCAGGG - Intergenic
900715674 1:4141944-4141966 CCTTCCTTTCTGGAGCTCCAGGG - Intergenic
901453683 1:9351585-9351607 CCCTCCAGGCTGCAGTTCCAGGG + Intronic
901839391 1:11944588-11944610 CCGTCCTGGCAGGAGCTCGGGGG + Intronic
902216778 1:14939307-14939329 CCTCCCAGGCTGGAGTGCCATGG + Intronic
902236811 1:15062941-15062963 CCTTCCAGGCAGGAGCTCCAGGG - Intronic
902837905 1:19058555-19058577 CGTTCCAGGCAGGATGGCCAGGG - Intergenic
903868763 1:26417224-26417246 AACTCCAGGCAGGAGCTACAGGG + Intronic
904251004 1:29224277-29224299 CCAGCCAGACAGGAGCTGCATGG - Intronic
904948117 1:34214202-34214224 CATTCCAGGCAGGAGGAGCAAGG + Intronic
907270660 1:53288991-53289013 CCATGGAGGCAGGAGCTCCTAGG + Intronic
907443551 1:54492834-54492856 CATTCCAGAAAGGAGCTACAAGG + Intergenic
907462339 1:54612405-54612427 CCTTCCAGCCATGAGCTTCTGGG + Intronic
907854721 1:58291350-58291372 CCTTCAAGACAGGTGCTCCATGG + Intronic
912416963 1:109515505-109515527 CCCCCATGGCAGGAGCTCCAAGG - Intergenic
913047816 1:115089111-115089133 CCTTCCAGGAAAGAGCCACACGG + Intronic
915834795 1:159168186-159168208 CCTCCCGGGCAGGAGCAGCATGG + Intergenic
919448098 1:197735620-197735642 CCTTCATGGCGGCAGCTCCACGG - Intronic
919486918 1:198157309-198157331 CCCTCCCGGCAGGAGCTGCCCGG - Intronic
920527964 1:206682677-206682699 CCTACCTAGCTGGAGCTCCAGGG - Intronic
921213902 1:212921462-212921484 CCTTCCAGGGAGGAGAGCCGTGG - Intergenic
922695564 1:227729257-227729279 CCCTGGAGGCAGGAACTCCAGGG - Intronic
922698585 1:227744742-227744764 CCTGGCAGGCAGGAGCGCCTAGG - Intronic
922972520 1:229754879-229754901 CCTGCTAGGCAGGAGTTCTAAGG + Intergenic
923405124 1:233652189-233652211 CCACCCAAGCAGGAGCTCCCAGG - Intronic
1063003539 10:1946623-1946645 CAGTCCAGGCTGGAGATCCACGG - Intergenic
1063391765 10:5654273-5654295 ACTCCCAAGAAGGAGCTCCAGGG + Intronic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1064296046 10:14080025-14080047 AGGTCCAGGCAGGAGGTCCAAGG - Intronic
1064549672 10:16486519-16486541 CCATCCTGGACGGAGCTCCAGGG + Exonic
1069726453 10:70583178-70583200 CCTTCCCCCCAGGAACTCCACGG - Intergenic
1069847424 10:71382322-71382344 CCTTCCAGGAAGGACTTCCTAGG - Intergenic
1073068850 10:100780886-100780908 CCTTCTAGGCAGCACCTCCATGG - Intronic
1073516767 10:104082927-104082949 CCTTCCAATGAGGAGCTCCCAGG - Intronic
1074017029 10:109544832-109544854 GCTTCCAGGGAGGAGAGCCATGG - Intergenic
1074416602 10:113272608-113272630 ATTTACAGGCTGGAGCTCCAAGG - Intergenic
1075812061 10:125231563-125231585 CCTTCCGGGCAGGGGCCTCATGG + Intergenic
1076608951 10:131708398-131708420 CCTGCCAGGCATGCGCGCCAAGG + Intergenic
1076867885 10:133177094-133177116 TCTGCCAGGCAGCAGCTGCATGG - Intronic
1077245817 11:1537508-1537530 CCTCTGAGGCAGCAGCTCCAAGG + Intergenic
1077906460 11:6538525-6538547 ACTCCCAGTCAAGAGCTCCAAGG - Intronic
1078039412 11:7844753-7844775 CCTTCCAGTCTGGAATTCCAAGG + Intergenic
1078542211 11:12221738-12221760 CCTTTCAGCCAGCAGCTCCAGGG - Exonic
1081164067 11:39786438-39786460 CTAGCCAGGCAGGAGCTCCCAGG - Intergenic
1081969761 11:47189612-47189634 CATTCTAGGCAGGAGCTTCAGGG + Intergenic
1082001500 11:47395698-47395720 CCTGCCAGGCAGCAGCCCCCGGG + Intergenic
1083028534 11:59571033-59571055 AATTGCAGGCAGGAGCTACATGG + Intergenic
1083340404 11:61955451-61955473 CCTCCCGCGCAGGGGCTCCAGGG - Intronic
1084438167 11:69156053-69156075 CAGTCCAGGCAGGGGCTCCAGGG + Intergenic
1085351268 11:75799342-75799364 TCTTCCATCCAGCAGCTCCAAGG - Intronic
1085722822 11:78928224-78928246 CCTTCCAGGAAACTGCTCCAGGG - Intronic
1086167651 11:83798065-83798087 CCTTCTAAGCAGCATCTCCAAGG - Intronic
1087153759 11:94881661-94881683 CCTTCAGGGCAGGATCACCATGG - Intergenic
1087501876 11:98967069-98967091 CCTATCAGGCATGACCTCCAAGG - Intergenic
1088792798 11:113241068-113241090 CCCTGCAGGCAGGATCCCCAAGG + Intronic
1090208034 11:124896519-124896541 CCTTCCGGGCTGGAGGGCCAGGG + Exonic
1090327766 11:125904155-125904177 CCCTCCAGGCGGGAGCCCCCCGG - Intronic
1090386437 11:126359988-126360010 CCTGCCAGGCAGAAGCACCTTGG + Intronic
1090692205 11:129195672-129195694 TCTTCCAGGCTGGAGCGCAATGG - Intronic
1091397293 12:161822-161844 CCATCCAGCCTGGAGCTCCCGGG - Intronic
1091544900 12:1495158-1495180 CCTGCCAGGCAGGGGCTTCAGGG - Exonic
1091691780 12:2602030-2602052 CCCTGCAGGCAGGCCCTCCAGGG - Intronic
1095964339 12:47857044-47857066 CCTTCCATCCAGCAGCCCCAGGG + Intronic
1096130104 12:49151980-49152002 CCTTCCAGGCTGGAGTGCAATGG + Intergenic
1098076545 12:66738045-66738067 CCTTCCAGCCAGGGGGTCCCAGG - Intronic
1099994957 12:89768539-89768561 CAATCCAGGCAGGACCACCAAGG - Intergenic
1101815712 12:108144626-108144648 CCTAGAAGGCAGGAGCTCCAAGG - Intronic
1102423834 12:112824936-112824958 CCTTCCTCCCAGGATCTCCAAGG + Intronic
1103924419 12:124415669-124415691 CGTTCCAGGCAGGGGCTCCCAGG - Intronic
1106134010 13:26961024-26961046 CCTTCCAGGCAGGCTGCCCATGG - Intergenic
1107670984 13:42746079-42746101 CCTTGCATTCAGCAGCTCCATGG + Intergenic
1107910483 13:45100986-45101008 ACATCCAGGCAGGAGCCCCAAGG - Intergenic
1110744511 13:79037269-79037291 CCTCCCAGGTAGGAGCTCTCTGG + Intergenic
1113076006 13:106468589-106468611 CCTTGGAGGCAGGAGTTTCAGGG - Intergenic
1113707924 13:112446117-112446139 CCCTCCAGGCAGCAGCTTCCCGG + Intergenic
1115398789 14:32936787-32936809 CCCTCAAGGCAGGAGCACCAGGG + Intronic
1115787463 14:36842412-36842434 GCTTCCAGGCAGGAAGTACAAGG - Intronic
1117374498 14:55108298-55108320 GCTTCCTGGCAGGACTTCCACGG + Intergenic
1119400291 14:74358264-74358286 CCTTAGTGGCAGGAGCTCCCCGG - Exonic
1119631017 14:76232337-76232359 TCTTCCAGGCTGGAGCGCAATGG + Intronic
1120467961 14:84885333-84885355 CATTCCAGGCCATAGCTCCAAGG + Intergenic
1121845711 14:97170277-97170299 CATTCCAAACAGGAGCTGCAGGG + Intergenic
1122055250 14:99093708-99093730 CCTGCCACGGAGGAGCTCCAAGG + Intergenic
1122290220 14:100676757-100676779 CCAGCCAGGCAGGAGCTTGAGGG - Intergenic
1122405311 14:101497195-101497217 CAAGCCAGGCAGCAGCTCCAAGG + Intergenic
1122649996 14:103220883-103220905 GCTTCCAGCCACGACCTCCAGGG - Intergenic
1123160126 14:106270033-106270055 TCGTCCAGGCTGGAGCTCCGTGG - Intergenic
1123178505 14:106444556-106444578 TCATCCAGGCTGGAGCTCCGTGG - Intergenic
1123880867 15:24676552-24676574 CCTTCCAAGCAGGAGCTCGCTGG - Exonic
1124340723 15:28887662-28887684 TCTGCCAGGCAGGAGGGCCAGGG + Intronic
1124632697 15:31346537-31346559 GCTTCCAGGCCAGAGCCCCAAGG + Intronic
1124694450 15:31852237-31852259 ACTTGCTGGCAGGAGCCCCAGGG + Intronic
1126217361 15:46171715-46171737 TCTCCCAGGCAGGAACTCAAGGG + Intergenic
1128444409 15:67744485-67744507 TCTTCCAGACAAGAGCTGCAGGG + Intronic
1129182419 15:73885595-73885617 CTTTCCAGGGAGGTGTTCCAGGG - Intronic
1131151456 15:90049810-90049832 CATCCCAGCCAGGAGCTCCTGGG - Intronic
1132142253 15:99405725-99405747 CCTGCAAGGGGGGAGCTCCAGGG - Intergenic
1132655941 16:1041679-1041701 CCTTCCCTGCTGGAGCTCCCAGG - Intergenic
1132950308 16:2558062-2558084 CCTTCCAGGCAGGAGGTCTCAGG + Intronic
1132964040 16:2642108-2642130 CCTTCCAGGCAGGAGGTCTCAGG - Intergenic
1134041706 16:11073673-11073695 CCATCCAGGCAGGGGCGACAAGG - Intronic
1135128027 16:19827777-19827799 CCTGCGAGCCAGGAGCACCAAGG - Intronic
1135402895 16:22178382-22178404 TGTTCCTGCCAGGAGCTCCAAGG - Intronic
1136270842 16:29147377-29147399 CCTTCCATGCAGCTGCTCCCAGG - Intergenic
1137351588 16:47718341-47718363 CCTTCCATGCAGCTGCACCATGG - Intergenic
1137549498 16:49427589-49427611 CCCTCCCAGTAGGAGCTCCAAGG + Intergenic
1137574590 16:49590551-49590573 CATCCCATACAGGAGCTCCAGGG + Intronic
1137589870 16:49686977-49686999 CCCTCCAGGCAGGAGACCCTGGG - Intronic
1137603963 16:49774944-49774966 TCTTTAAGGCAGGATCTCCAAGG - Intronic
1137858406 16:51820074-51820096 CCTTCCAGCCTGGACCACCATGG + Intergenic
1138563641 16:57816771-57816793 CCTTCCAGGCAGGAGCTCATGGG + Intronic
1138609166 16:58109296-58109318 CCTTCCAGACAGGATCCCAAGGG + Intergenic
1139490120 16:67281559-67281581 CCTTGCAGGAAGCAGCCCCAGGG + Exonic
1139949474 16:70662147-70662169 CCTCCCAGGCTTGAGCTCCTGGG - Exonic
1141151663 16:81568506-81568528 TGTGCCAGGCAGGAGCTCCAGGG + Intronic
1141370509 16:83482050-83482072 CATTCCAGCAAGGACCTCCAAGG + Intronic
1141677126 16:85523839-85523861 CCCTCCAGGCAAGAGCCCCGTGG - Intergenic
1142193118 16:88726958-88726980 CCTGCCAGGCCGGAGCGTCAGGG + Exonic
1142401184 16:89859468-89859490 TCTTGCAGGCACGAGCTCCCTGG - Intronic
1144951847 17:18998628-18998650 CCTTCGAGGAAGGAGCTCTAAGG - Intronic
1145052842 17:19677140-19677162 CCCTGCAGTCAGGAGCTCCAAGG - Exonic
1145957677 17:28865745-28865767 GCTTCAAACCAGGAGCTCCATGG + Intergenic
1147216000 17:38899284-38899306 CCTCCCTGGCAGGACCTCCTAGG - Intronic
1147759357 17:42787651-42787673 CCTTCCTGGAGGGAGCTTCATGG - Intronic
1148201457 17:45752691-45752713 AGTTCCAGGCAGAAGCTGCAAGG - Intergenic
1148213195 17:45820385-45820407 CCTACCAGGCTTGAGCTCCAGGG - Intronic
1148909155 17:50931226-50931248 CCGTCCGGGCAGGAGGTGCAGGG + Intergenic
1151312824 17:73304699-73304721 CCTCCCAGGCCTGAGCCCCAGGG - Intronic
1151354700 17:73551433-73551455 CATTCCTGGCAGGAGCTGCGAGG - Intronic
1151713673 17:75820567-75820589 CCTGCCGGGCAGAGGCTCCAGGG + Intronic
1151769708 17:76152244-76152266 CCTTCTTGGCAGGAACTGCAGGG + Intronic
1152617812 17:81345967-81345989 CCGTCCGGGCAGGAGCCCCGGGG + Intergenic
1152698231 17:81806738-81806760 CCACCCAGCCAGGAGCTCCCTGG - Intronic
1152727437 17:81954514-81954536 TCTTCCAGGCAGGCCCTCCCAGG + Intronic
1152933807 17:83124467-83124489 CTTCCCAGGGAGGAGCTTCATGG - Intergenic
1154163333 18:11996055-11996077 TCTCCCAGGCAGGAGCTCAGAGG - Intronic
1157173617 18:45430874-45430896 CATTCCAGTCATCAGCTCCATGG - Intronic
1161053878 19:2180255-2180277 CCAGCCAGGCTGGAGCTCCCTGG + Intronic
1161352401 19:3801334-3801356 CCTTGCAGGCAGCATCTCCCTGG - Intronic
1161865851 19:6831693-6831715 CCTACCAGGCTGGAGCTCTGGGG + Intronic
1162130429 19:8522759-8522781 CCCTCCAGACATGATCTCCAGGG + Exonic
1162531209 19:11237426-11237448 ATTGGCAGGCAGGAGCTCCAGGG + Intronic
1163241095 19:16064369-16064391 CCCTCTGGGCATGAGCTCCAGGG - Intergenic
1164515903 19:28934993-28935015 CCTTGCTGGCAGGAGGTCTAGGG + Intergenic
1164553564 19:29232644-29232666 CCTCCCTGGAAGGTGCTCCAGGG + Intergenic
1166340981 19:42136692-42136714 GCCTCCAAGAAGGAGCTCCATGG - Intronic
1167576024 19:50317835-50317857 CCCCCCAGGCTGGAGCACCATGG + Intronic
1167609879 19:50501895-50501917 CCAACCAGGCGGGACCTCCAAGG - Intergenic
928170135 2:28998203-28998225 GCTTCCAGGCGGGAGCACCCGGG - Exonic
930439798 2:51391271-51391293 CCTTCCCAGCAGCAGCTACATGG - Intergenic
931808009 2:65826772-65826794 CCTGCCAGCCAGGAGCAACAGGG - Intergenic
932220311 2:69994162-69994184 ACTGTCAGGCAGGAGTTCCAGGG + Intergenic
932739770 2:74282715-74282737 CCTTCTTGGCAAGGGCTCCACGG + Intronic
935373331 2:102370161-102370183 CCTGCCATCCAGGAGCTCCAAGG - Intronic
936959012 2:118053873-118053895 CCTGCCTGGGAGGGGCTCCATGG + Intergenic
938772723 2:134514001-134514023 CAAACCAGGCAGAAGCTCCAAGG + Intronic
940709769 2:157147771-157147793 AATTCCAGGCAGGTGCTCCCTGG - Intergenic
941304045 2:163839233-163839255 TCTTCCAGGCTGGAGTTCAATGG + Intergenic
942210366 2:173663691-173663713 GCTTCCAGGGAGGAGCCCCAGGG + Intergenic
942887732 2:180948403-180948425 GCTTCCAGGCAGCAGCAACATGG - Intergenic
946334307 2:219027342-219027364 CCTCCTAGCCAGGAGCCCCAGGG + Intronic
947137407 2:226988631-226988653 CCTTCCTCTCAGAAGCTCCAGGG - Intronic
947525054 2:230872610-230872632 CTCTCCTGGCAGGAGCTCCCTGG + Intronic
947724549 2:232388688-232388710 CCTCCCCGGCCGGTGCTCCAGGG - Intergenic
947743147 2:232494120-232494142 CCTTCCTGTCAGGGTCTCCATGG + Intergenic
948025635 2:234773914-234773936 CCATCCAGGCAGCAGTTGCATGG - Intergenic
948657633 2:239486545-239486567 CCTTCGAGCCTGGAGCTCCCTGG - Intergenic
948868223 2:240785886-240785908 CATCCCAGGCAGGAGGCCCAGGG + Intronic
1170162214 20:13325078-13325100 CCTTGCATCCAGGAGCTCCCTGG - Intergenic
1171373588 20:24676785-24676807 CTTTCCAGGGAGCAGCACCAAGG - Intergenic
1172614952 20:36277238-36277260 CCTCCCAGGCTGTAGCTCCTTGG - Intergenic
1172992884 20:39049196-39049218 CAAGCCAGGCAGGAGCTGCATGG - Intergenic
1173336086 20:42113402-42113424 GCTTCCAGGCCTGAGCTGCAGGG + Intronic
1173663949 20:44752379-44752401 CCCTTCAGCCAGGAGCTCCTGGG - Intronic
1173783179 20:45773428-45773450 CCCTCAAGGAAGGAGGTCCAAGG + Intronic
1173952953 20:47007653-47007675 TCTTCCAGGCTGGAGTGCCATGG + Intronic
1175681852 20:60994988-60995010 GCTACCACGCATGAGCTCCACGG + Intergenic
1175988184 20:62774676-62774698 CCTTCCAGGCAGGGGCTGAGGGG + Intergenic
1176378152 21:6096930-6096952 CCTGCGAGGTAGGAGCTCCCAGG - Intergenic
1179225259 21:39447273-39447295 TCCTCCAGTCATGAGCTCCAGGG - Intronic
1179571317 21:42280455-42280477 GCTTCCCGGCGGGCGCTCCAGGG - Intronic
1179745321 21:43441316-43441338 CCTGCGAGGTAGGAGCTCCCAGG + Intergenic
1179876180 21:44269339-44269361 CCAGCGTGGCAGGAGCTCCAAGG - Intergenic
1180058670 21:45373885-45373907 CCTTCAGGCCAAGAGCTCCATGG - Intergenic
1180083605 21:45497677-45497699 CATCCCAGGCAGGAGAGCCATGG + Intronic
1183684126 22:39351616-39351638 CCTTCCAGGCCAGAGGCCCAGGG - Intronic
1184147726 22:42621292-42621314 CCCTCCAGCCTGGAGCTCCTGGG + Intronic
1184351757 22:43948974-43948996 CCTTCGGGGCAGGAGTTCCGGGG + Intronic
1184403574 22:44287416-44287438 CCTCCCAGCCAGGAGCTCCCAGG - Intronic
1184419001 22:44368800-44368822 ACTTGCAGGGAAGAGCTCCAAGG - Intergenic
1184935633 22:47718369-47718391 GCTGCCCGGAAGGAGCTCCAGGG + Intergenic
1184956459 22:47890079-47890101 CCCTCCAGGCTGGATCTTCATGG - Intergenic
1185126343 22:49012838-49012860 CCTTCCAGGCAGGCAATCCAGGG + Intergenic
1185166172 22:49263626-49263648 TCTTCCAGGCAGGACCCCCAGGG + Intergenic
1185400400 22:50612761-50612783 GTTTCCAGGCAGCAGCTACAGGG - Intronic
949646425 3:6100421-6100443 CATTTCAGGCAGGAGACCCAGGG - Intergenic
952301868 3:32110577-32110599 CCTTCCTGGCTGAAGCTCCCTGG - Intronic
952872030 3:37909497-37909519 CCTTCCAGGCAGGAGGCCCAGGG + Intronic
953773672 3:45797783-45797805 CCAGACAGGCAGGAACTCCAGGG - Intergenic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
954285755 3:49617790-49617812 CCACCGTGGCAGGAGCTCCAGGG - Intronic
961564124 3:127751279-127751301 CCTTGCTGGGAGGAGCTGCAGGG - Intronic
961604480 3:128083513-128083535 CCCTGCGGGCAGGAGCTGCAGGG + Intronic
962318108 3:134371207-134371229 GCCACCAGGCAGGAGCCCCAGGG - Exonic
964976956 3:162633599-162633621 CCATCCAGGCTGGAGTACCATGG + Intergenic
965524517 3:169701929-169701951 CTTTCCAGTTAGGAGCTCCAGGG - Intergenic
966885954 3:184378271-184378293 TGGTCCAGGCAGGGGCTCCAGGG - Intronic
967346536 3:188463063-188463085 CCTCCCAGGCAGGAGTGCAATGG - Intronic
968036820 3:195554594-195554616 CCTTCATGGCAGCGGCTCCACGG - Intergenic
968620787 4:1602677-1602699 CCCGCCAGGCAGGAGCTGCGAGG + Intergenic
968731675 4:2272038-2272060 CGTGCCATGCAGGGGCTCCAGGG - Intronic
968871930 4:3246709-3246731 CCTCCCAGGCAGGAGCAGCTGGG + Intronic
969178538 4:5419385-5419407 CCTTCCAGGAAAAAGCCCCAAGG - Intronic
969467563 4:7366625-7366647 CCTCCCATGCAGCTGCTCCAAGG + Intronic
969605888 4:8202111-8202133 CCTTGCAGGCAGGGGCTTCCTGG + Intronic
969879094 4:10158180-10158202 CCTGCCAGGCAGGAGAACCTGGG - Intergenic
969881466 4:10177710-10177732 CCATAGAGGCAGAAGCTCCATGG - Intergenic
971501261 4:27320263-27320285 CCTTCAAGGCAGTACCTGCATGG - Intergenic
972316888 4:37935024-37935046 CCTTCTGTGCAGGTGCTCCAAGG - Intronic
972321409 4:37976802-37976824 CCTGGCAGGCAGGAGCTAAATGG + Intronic
974752355 4:66156882-66156904 CCTTACAGGCAGGAGCACGTAGG - Intergenic
981587124 4:146316151-146316173 CCTCACAGACAGGAACTCCATGG + Intronic
982678130 4:158399582-158399604 ATTTCTAGGCAGGATCTCCAAGG + Intronic
984401180 4:179267148-179267170 CCTTCCAGGCTGGAGCACAGTGG + Intergenic
984496769 4:180507575-180507597 CCTTCCAGGCTGGAGTGCAATGG - Intergenic
985653550 5:1118464-1118486 TCTTCCTGGCAGCAGCGCCAGGG + Intergenic
986374491 5:7116141-7116163 GTTTCCTGGGAGGAGCTCCAAGG + Intergenic
988604605 5:32668690-32668712 CAGTCAAGGCAGGGGCTCCAGGG - Intergenic
990396517 5:55385477-55385499 CTTTCCAAGCAAGAGCTGCAGGG + Intronic
990608179 5:57430925-57430947 TCTGCCAGGCAGGACCTCCATGG + Intergenic
991473821 5:66998846-66998868 CCTTTCATGCAGGAGCTCTCAGG + Intronic
995356080 5:111238928-111238950 CCTTCCAGGCACTAGCACCTTGG + Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995854964 5:116581334-116581356 TATTCCAGGCAGGAGCACAAGGG - Intergenic
996354612 5:122581831-122581853 CCTTCCAGACAGAAGCTGCTGGG - Intergenic
997301284 5:132807499-132807521 CCCAGGAGGCAGGAGCTCCAGGG - Intergenic
998409657 5:141899870-141899892 TCTTCCAAGCAGGAGGGCCAGGG + Intergenic
998787986 5:145733220-145733242 TCTTCCAGGCTGGAGTGCCATGG - Intronic
999128124 5:149261875-149261897 CCTGCCAGGCAGGAGCACTGAGG + Intergenic
999189207 5:149733644-149733666 CCTGCCAAGCAGAAGCTCCCAGG + Intronic
999237229 5:150106177-150106199 CCTTCCCGGCAGCATCACCAAGG - Intronic
1000196138 5:158960000-158960022 TCTTCCAGACTGGAGCTCCAGGG - Intronic
1000300381 5:159951148-159951170 ACTTGCAGGGAGGAGCTACAAGG - Intronic
1002925745 6:1604907-1604929 CCTTCTGGGCAGGAGCCCCGGGG - Intergenic
1003268736 6:4589059-4589081 CCCACCAGGGAGGAGCACCATGG + Intergenic
1004258156 6:14084118-14084140 CCTCCCAGGCAGGAGCTTCAAGG - Intergenic
1005419134 6:25631043-25631065 CCTTACAATCAGGAGCCCCATGG + Intergenic
1005755208 6:28920006-28920028 CCTTACCTGCAGGAGCTCCCTGG + Exonic
1005821842 6:29605196-29605218 CCCTCAAGGCAGGAACTCCCAGG + Intronic
1006169980 6:32087110-32087132 CCTACCTGGCCGGGGCTCCAGGG - Intronic
1006665431 6:35689503-35689525 CCTTTCAAGCAGGAGATCCCAGG + Intronic
1007130642 6:39470362-39470384 CGTCACAGGCAGGAGCTGCAAGG - Intronic
1007238189 6:40406035-40406057 CCCTCCATGAAGGAGCCCCATGG - Intronic
1007345248 6:41224077-41224099 CCCACCAGGAAGGAGATCCAAGG - Intergenic
1007561475 6:42812318-42812340 GATTACAGGCATGAGCTCCATGG - Intronic
1008312443 6:49992669-49992691 TCTTGCAGGCAGGAGATCAATGG - Intergenic
1009502813 6:64437765-64437787 TCTCCCAGGCAGGAGTGCCATGG + Intronic
1009748274 6:67848218-67848240 CATTCCAGGCAATAGCTCAAAGG + Intergenic
1010142590 6:72628174-72628196 CCTTCCACAGAGGAGCTTCAGGG + Intronic
1010328030 6:74587803-74587825 CATTCCAGGCCGCAGCTCCAAGG + Intergenic
1011627580 6:89296183-89296205 CCTTCCCTGCAGGTGCTCCTGGG - Intronic
1011716555 6:90111559-90111581 CCTTCCAGGCTGGAGCACACAGG - Intronic
1013174430 6:107665223-107665245 CCTTGCATTCAGGAGCTCCAAGG - Intergenic
1014216329 6:118755822-118755844 TCTTCCAGGCGGGGCCTCCATGG - Intergenic
1016004932 6:139079663-139079685 CCTTCCAGGAAGCAGATCTAGGG - Intergenic
1018027875 6:159819785-159819807 CCTTCCAGTCAGGAGGTGCCCGG + Intronic
1019597210 7:1863691-1863713 CCCTCCACCCAGGAGCTCCAGGG - Intronic
1020100412 7:5391189-5391211 TCTCCCAGGCAGGAGCTGCCAGG + Intronic
1020239576 7:6382831-6382853 TCTTCCAGGCTGGAGCCCAATGG - Intronic
1021909231 7:25367760-25367782 CATTCCAGGCAGAAGCTTTAGGG - Intergenic
1022462883 7:30628222-30628244 CCTTCCAGGCTGGAGTGCAATGG + Intronic
1022722973 7:32957405-32957427 CCCTCCCGGCCGCAGCTCCAGGG - Exonic
1024295150 7:47835908-47835930 TCTACCAGGCATGTGCTCCATGG + Intronic
1025613680 7:63099955-63099977 CCTTCCAGTGAGAAGGTCCAGGG + Intergenic
1025987529 7:66466901-66466923 GCTTCCAGGAGGGAGCTCCAAGG + Intergenic
1026003861 7:66584818-66584840 GCTTCCAGGAGGGAGCTCCGAGG + Intergenic
1026027467 7:66758519-66758541 GCTTCCAGGAGGGAGCTCCGAGG - Intronic
1026562503 7:71462135-71462157 CCCACCAGGCAAGGGCTCCAGGG - Intronic
1026767863 7:73171843-73171865 CCCTCCAGGCAGGCCCTCCTTGG + Intergenic
1026931028 7:74223058-74223080 CCTTCCCGGCAGTGGCTCTAGGG + Intronic
1027044331 7:74981551-74981573 CCCTCCAGGCAGGCCCTCCTTGG + Intronic
1027079310 7:75220807-75220829 CCCTCCAGGCAGGCCCTCCTTGG - Intergenic
1029304327 7:99607583-99607605 GCCTCCAGGCAGGAGCCACAGGG + Intronic
1029388538 7:100259388-100259410 CCCTCCAGGCAGGCCCTCCTTGG - Intronic
1029436284 7:100565780-100565802 CCATCAAAGCCGGAGCTCCAGGG + Exonic
1029603811 7:101586243-101586265 TCTTCCAGGCGGGAGCTCACAGG - Intergenic
1031265426 7:119573686-119573708 CCTTGCAGGCATGGGATCCAGGG + Intergenic
1032496719 7:132368409-132368431 CCTTCCTGCCAGCAGCTCCTGGG + Intronic
1032596022 7:133241372-133241394 CCTTCCAGGTAGGAGAGACAGGG - Intergenic
1035070933 7:156144279-156144301 CCTCCAGGGCTGGAGCTCCAGGG - Intergenic
1035268262 7:157704258-157704280 CCTTACAGCCAAGAGCTCCCGGG - Intronic
1035866934 8:3094143-3094165 CCTTCCAGGCTGGAGTGCAATGG + Intronic
1036940975 8:13051588-13051610 CCATCCACACAGGATCTCCATGG + Intergenic
1037541446 8:19875814-19875836 CCTACAAGGCTGAAGCTCCAGGG + Intergenic
1038128320 8:24699347-24699369 CCTTCGAGGCAGGAGTACAATGG + Intergenic
1041095668 8:54347103-54347125 GATTTCAGGCATGAGCTCCAGGG + Intergenic
1046798357 8:118397131-118397153 CTATACAGGCTGGAGCTCCAAGG + Intronic
1047121377 8:121908616-121908638 TCTTCCAGTCAGGAGCCACAGGG - Intergenic
1047211234 8:122842122-122842144 TCTTCCAGGCATGAGTTGCATGG + Intronic
1047529167 8:125659675-125659697 CCTTCCAGGCAGGAACTTTAAGG + Intergenic
1047715307 8:127589808-127589830 CCTTCCAGGTAACAGCTCCTGGG + Intergenic
1048377514 8:133835498-133835520 CCTCACAGGCAGCATCTCCAGGG - Intergenic
1048877363 8:138847352-138847374 CCTCCAGGGCAGGAGCTCAAGGG - Intronic
1049397054 8:142405763-142405785 CTGTCCAGGCAGGGGCTGCAGGG - Intergenic
1049756395 8:144312987-144313009 CCTGTCAGGCAGGGTCTCCAGGG + Intronic
1051516743 9:17938216-17938238 CCTCCCTGACAGCAGCTCCATGG - Intergenic
1054891641 9:70258567-70258589 CCTTCCAGGTGAGAGCTCCCGGG - Intergenic
1055197623 9:73615570-73615592 CCTTCCAGGGAGAAGGTACAAGG + Intergenic
1056007229 9:82285458-82285480 CATTCCAGGCCCTAGCTCCAAGG + Intergenic
1056399027 9:86209175-86209197 TCCTCCAGGCATGAGCTCCACGG + Intergenic
1057225101 9:93288995-93289017 CCAGCCAGGCAGGGGGTCCAGGG + Exonic
1057230758 9:93320014-93320036 CCCTCCATGCAGAAGCTCGAAGG - Intronic
1057981178 9:99665410-99665432 CATTCCAGGCAGTAGCCCCGAGG + Intergenic
1058708684 9:107659558-107659580 TCGTCCAGGCTGGAGTTCCAGGG + Intergenic
1058976141 9:110127220-110127242 GCTTCATGGCAGGAGATCCATGG + Intronic
1059344073 9:113616446-113616468 CGTTCCTGGAAGGAACTCCAAGG + Intergenic
1060520651 9:124292177-124292199 CCTCCAGGGCTGGAGCTCCAGGG + Intronic
1061234421 9:129334332-129334354 CCTTCCAGGCAGAGCCTTCAGGG - Intergenic
1061366364 9:130174011-130174033 CCTTCCAGGTAGCAGCTCTTGGG - Intronic
1062365734 9:136208152-136208174 CCCTCCAAGCAAGTGCTCCAGGG - Exonic
1062581596 9:137231388-137231410 CCTTCCAGTCAGGACCAGCAAGG + Intronic
1185573225 X:1150628-1150650 TCTTCCAGGCTGGAGCGCAATGG - Intergenic
1185654992 X:1677486-1677508 CCTCCCAGGCTGGAGTTCAATGG + Intergenic
1185907822 X:3953040-3953062 CATTCATGGCAGCAGCTCCACGG - Intergenic
1186500662 X:10047740-10047762 CTTTCCAGGCAGGACATCGATGG + Intronic
1188381408 X:29497448-29497470 TCTTCCATGTAGGAGCTACATGG + Intronic
1191955976 X:66642665-66642687 CCTTTCATGAAGGAGCTTCATGG + Intergenic
1192046835 X:67684499-67684521 CATTCCAAGGAGGAGTTCCAGGG - Intronic
1192784977 X:74326354-74326376 CCTTGCAGGAAGGAGCCACAAGG - Intergenic
1193108671 X:77705345-77705367 CCTTCCAAGTTGGAGCTCCCTGG - Intronic
1195212267 X:102661107-102661129 CATTCCAGGTAGCAGCCCCATGG + Intergenic
1195687974 X:107602601-107602623 CATGCCAGGCAGGATCTTCATGG - Exonic
1199858739 X:151780877-151780899 CCTTCCAGGCAGGAAGGCCCGGG - Intergenic