ID: 902237682

View in Genome Browser
Species Human (GRCh38)
Location 1:15068256-15068278
Sequence CTGGGTTCTGGGAGGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2360
Summary {0: 1, 1: 0, 2: 5, 3: 158, 4: 2196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902237666_902237682 25 Left 902237666 1:15068208-15068230 CCTCTGGGAGGCACAGGCTGGCA 0: 1
1: 0
2: 4
3: 116
4: 1110
Right 902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG 0: 1
1: 0
2: 5
3: 158
4: 2196
902237670_902237682 -1 Left 902237670 1:15068234-15068256 CCTGCTCCTTGGACTTCCAGGGC 0: 1
1: 0
2: 2
3: 60
4: 358
Right 902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG 0: 1
1: 0
2: 5
3: 158
4: 2196
902237673_902237682 -7 Left 902237673 1:15068240-15068262 CCTTGGACTTCCAGGGCTGGGTT 0: 1
1: 0
2: 3
3: 30
4: 337
Right 902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG 0: 1
1: 0
2: 5
3: 158
4: 2196
902237663_902237682 27 Left 902237663 1:15068206-15068228 CCCCTCTGGGAGGCACAGGCTGG 0: 1
1: 0
2: 6
3: 258
4: 2850
Right 902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG 0: 1
1: 0
2: 5
3: 158
4: 2196
902237665_902237682 26 Left 902237665 1:15068207-15068229 CCCTCTGGGAGGCACAGGCTGGC 0: 1
1: 1
2: 3
3: 133
4: 1447
Right 902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG 0: 1
1: 0
2: 5
3: 158
4: 2196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902237682 Original CRISPR CTGGGTTCTGGGAGGGGGGA TGG Intronic
Too many off-targets to display for this crispr