ID: 902238035

View in Genome Browser
Species Human (GRCh38)
Location 1:15070229-15070251
Sequence CTGTGTCAGAGGCTACTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902238035 Original CRISPR CTGTGTCAGAGGCTACTGGT GGG (reversed) Intronic
900478936 1:2889077-2889099 CTGTATCATACGCTGCTGGTCGG + Intergenic
900737510 1:4308481-4308503 CTGAGTCAGAGTCTGCTTGTGGG + Intergenic
902205944 1:14868265-14868287 CTGCGTCTGAGGCCACTGGAGGG + Intronic
902238035 1:15070229-15070251 CTGTGTCAGAGGCTACTGGTGGG - Intronic
902453387 1:16513787-16513809 CTGTGTAAGAGGTGACTGGGGGG + Intergenic
903364433 1:22797351-22797373 CTTTGTCAGATGCTGCTGGCAGG - Intronic
903397048 1:23009609-23009631 CTGTGTTAGGTGCTACGGGTGGG + Intergenic
903737357 1:25538552-25538574 CGGGTTCAGAGGCAACTGGTTGG + Intergenic
903976246 1:27152287-27152309 GAGTGTCAGTGGCTGCTGGTGGG - Intronic
904092300 1:27953964-27953986 CTGTGGCACAGGCTTCTGGTCGG - Intronic
904538380 1:31216188-31216210 CTGGGCCAGAGGCGGCTGGTTGG + Intronic
904633067 1:31857686-31857708 GCGTGTCAGATGCTACTGCTGGG + Intergenic
905124750 1:35708516-35708538 CTGGTTCAGAGCCTACGGGTTGG + Intergenic
905998353 1:42401735-42401757 CTCTTTCAGTGGCTAATGGTAGG + Intronic
906192909 1:43910005-43910027 TTGTATCAAAGGCTACTGGTCGG + Intronic
907332801 1:53682260-53682282 CTGTGTCAGCGGCTGCTTGCTGG - Intronic
907575002 1:55518509-55518531 CTGTGTCAAAAGCTGCTGTTAGG + Intergenic
908281978 1:62549233-62549255 CTGTGTGAAAAGCTGCTGGTAGG + Intronic
908355656 1:63323279-63323301 CAATGTCAGGGGCTGCTGGTGGG - Exonic
909900118 1:81123726-81123748 ATGTGTCAGGGGCGCCTGGTGGG + Intergenic
913177402 1:116287500-116287522 CTGAGTTAGTGGCTGCTGGTAGG - Intergenic
914701519 1:150138231-150138253 CTGCGTCAGATGCTGCTGATAGG - Intronic
914705079 1:150163572-150163594 CTAGGTCAGAGGCAACGGGTTGG - Intronic
916331101 1:163618093-163618115 TTGTGTCAAATGCTGCTGGTAGG + Intergenic
917185264 1:172346892-172346914 CTGTGTGACAGGCTCCTGTTAGG - Intronic
917837750 1:178954201-178954223 CTGTGTCAGAAGCTGCTGGAAGG - Intergenic
922208150 1:223466977-223466999 CTGTATAGGAGGCTATTGGTGGG - Intergenic
1063064554 10:2595044-2595066 CTGTGTCTGAGGCTGGTTGTGGG - Intergenic
1065800976 10:29352110-29352132 CTGAGGCAGAAGCTGCTGGTTGG + Intergenic
1068123828 10:52813316-52813338 TTGTATCAGAGGATAGTGGTAGG - Intergenic
1069731915 10:70622620-70622642 CTGGGTCTGAAGCTGCTGGTTGG - Intergenic
1075077157 10:119359179-119359201 CTGTGCCAGAGGCCAGGGGTGGG + Intronic
1076480748 10:130783745-130783767 CTGTGTGAGGGGGTGCTGGTGGG + Intergenic
1077123902 11:924140-924162 CTCTGTGAGTGGCTGCTGGTGGG + Intergenic
1077362492 11:2146881-2146903 CTGAGGCAGAGGCCACTGGCTGG + Intronic
1077977441 11:7262653-7262675 CTGTGTCAAGTGCTACTGTTAGG + Intronic
1078740280 11:14059736-14059758 CTGTGGCAGCGGCTGCTGGGGGG - Intronic
1079214779 11:18498935-18498957 CTGTGTCAAATGCTGCTGATAGG + Intronic
1083242914 11:61403105-61403127 TTGGGACAGAGGCTACAGGTTGG - Exonic
1083939083 11:65885450-65885472 CTGTGGGAGAAACTACTGGTGGG + Intronic
1085346343 11:75770431-75770453 GGCTGTCAGAGGCTACTGGCTGG - Intronic
1087827885 11:102786943-102786965 CAGTTTCAGGGGCTACTAGTTGG + Intergenic
1089330248 11:117684303-117684325 CAGTGGGAGAGGCCACTGGTGGG - Intronic
1089514874 11:119026132-119026154 CTGTGTCAGAGTCCAGGGGTGGG - Intronic
1089843579 11:121440462-121440484 TTGTTTCTGAGGCTGCTGGTGGG - Intergenic
1089936908 11:122374048-122374070 CCGTGTCAGAAACTACTGATAGG - Intergenic
1090242312 11:125192755-125192777 CTGTTTCAGAGGCCACAGGGAGG + Intronic
1090542419 11:127722694-127722716 AGGTGTCAGAGGCTGCTGATTGG + Intergenic
1090668318 11:128929792-128929814 CTGGCTCAGGGGCTTCTGGTAGG + Intergenic
1092125455 12:6072189-6072211 CTGAGTTGGAGGCTACTGGTGGG - Intronic
1093376969 12:18441159-18441181 CTGTGTCAAATGCTACTGGTAGG + Intronic
1093517054 12:20000349-20000371 CTGGGTCAGATGCTCCTTGTGGG + Intergenic
1094039769 12:26110557-26110579 CAGTGTCAGAGCCTGCTGTTTGG - Intergenic
1096111570 12:49031958-49031980 CTGGGTCCCAGGCTCCTGGTAGG + Exonic
1096874718 12:54618569-54618591 CTGTGTCAAACGCTCCTGATAGG - Intergenic
1098270184 12:68762419-68762441 CTGTGTCAGATGCCGCTGGCAGG + Intronic
1098456455 12:70680409-70680431 ATGTGTCTGAGGGTATTGGTTGG + Intronic
1101058590 12:100946907-100946929 CTGTGTCAAATGCTGCTGATGGG + Intronic
1102083332 12:110115916-110115938 CTGCGTCAGAGGCTCTTGTTAGG + Intergenic
1105706696 13:22971694-22971716 CTGTGTGGGAGGAGACTGGTTGG - Intergenic
1107002580 13:35566679-35566701 CTGTGATAGAGGCTACTGGCTGG - Intronic
1107615267 13:42160512-42160534 CTCTGTCAGAGAGCACTGGTAGG - Intronic
1108305442 13:49127529-49127551 CTGTGTCAAATGCTGCTGATAGG - Intronic
1110530332 13:76590175-76590197 CAGTTTCAGAGGCTTCTGTTTGG + Intergenic
1113541370 13:111112421-111112443 CTGAATCAGAGGTCACTGGTGGG + Intergenic
1113872568 13:113569081-113569103 TTGGGACAGAGGCTGCTGGTTGG - Intergenic
1116388761 14:44365730-44365752 CTGTGTCATAGGCTGCCAGTGGG - Intergenic
1117564908 14:56983867-56983889 TTGTGTCAGAGACTACTGGTTGG + Intergenic
1119333229 14:73811044-73811066 CTGTGTCAAATGCTACTGAAGGG - Intergenic
1121062925 14:90933121-90933143 CTGTGTCAAATGCTATTGTTAGG - Intronic
1122739011 14:103859996-103860018 CTGTCACAGGGGCTCCTGGTGGG + Intergenic
1123439031 15:20276695-20276717 CTGGCTCAGAGGCTTCTGGAAGG + Intergenic
1123800411 15:23813750-23813772 CAGTGTCAAACACTACTGGTGGG - Intergenic
1124456198 15:29845042-29845064 CTGTGTCAAATGCTATTGTTAGG + Intronic
1125917910 15:43505865-43505887 CTGTGTCAGAGGCTTATCCTTGG - Intronic
1126169432 15:45682536-45682558 CTGTGGCTGATGCTGCTGGTTGG + Exonic
1126446577 15:48752681-48752703 CTGTCTGACAGGCGACTGGTGGG + Intronic
1129761854 15:78133540-78133562 TTATATCTGAGGCTACTGGTTGG + Intronic
1134031556 16:10996266-10996288 CTGACTGAGAGGCTACTGGCTGG + Intronic
1136846138 16:33577649-33577671 CTGGCTCAGAGGCTTCTGGAAGG - Intergenic
1138225220 16:55289005-55289027 TTGTGTCAGAGGCTGTGGGTTGG - Intergenic
1138605411 16:58085364-58085386 TTGTGTCAGAGGATGCTGGGCGG - Intergenic
1141573763 16:84951100-84951122 CTGTGTCAGAGGCCAGCGGGGGG + Intergenic
1142000338 16:87660680-87660702 CTGTGGAAGAGGCAGCTGGTGGG - Intronic
1203107846 16_KI270728v1_random:1426303-1426325 CTGGCTCAGAGGCTTCTGGAAGG - Intergenic
1143632007 17:8144907-8144929 CTGGGTCAGGGGCTACTGTGGGG + Exonic
1147343053 17:39766641-39766663 CTGTCTCAGGGGACACTGGTCGG + Intronic
1147643957 17:42022643-42022665 GTGTGGCATAGGCTTCTGGTGGG + Intronic
1148165088 17:45477938-45477960 CTGGGGCAGAGGCTTCTGGTGGG + Exonic
1150157831 17:62869017-62869039 CTGTGCCTGTGGCTGCTGGTGGG - Intergenic
1150316741 17:64175320-64175342 CAGTGCCAGAGGCTAGAGGTGGG - Intronic
1150396320 17:64824663-64824685 CTGGGGCAGAGGCTTCTGGTGGG + Intergenic
1150843135 17:68628109-68628131 CTGTGGGAGAGGCTAGTGGGAGG + Intergenic
1151733872 17:75926804-75926826 CTGTGTCACAGGCGGCTGCTTGG + Exonic
1153093960 18:1380318-1380340 CTGTGTCAGATGCAACTGATTGG + Intergenic
1157284414 18:46367706-46367728 CAAAGTCACAGGCTACTGGTGGG - Intronic
1157709980 18:49843569-49843591 CAGTGTCTGAAACTACTGGTAGG - Intronic
1157816804 18:50735363-50735385 TTGTGTCAGAGCCTGCTAGTAGG + Intergenic
1157863356 18:51160970-51160992 CTGTGCCTGGTGCTACTGGTTGG + Intergenic
1162268116 19:9592768-9592790 CTGGGTCTGAGGCTTTTGGTAGG + Intergenic
1163195645 19:15717731-15717753 GTGTCTCAGAGGCTACTGGGTGG - Intergenic
1164609709 19:29623847-29623869 CTGTGGCAGAGGCCCCTGGCAGG + Intergenic
1164675198 19:30095990-30096012 CAGTGGCAGATGCTAGTGGTAGG + Intergenic
1165333965 19:35156199-35156221 CTGTGTCAGAGGAGAATGGGTGG + Intronic
1166108234 19:40608038-40608060 ATGTCTTAGAGGCTACAGGTGGG - Intronic
1166427928 19:42696533-42696555 CTGGGTCAGGGTCTGCTGGTTGG + Intronic
1167966834 19:53154677-53154699 CTGTGCCACATGCTACTGATAGG + Intronic
925658919 2:6181912-6181934 CTGTGTCAAAGGCTACTCTTGGG + Intergenic
926452010 2:13016008-13016030 GTGTGACAGAGGCTTGTGGTTGG + Intergenic
927195142 2:20541758-20541780 CTGCTTCAGAAGCTACTTGTGGG - Intergenic
930140263 2:47944255-47944277 CTGTGTCAGATGCTACTGATGGG - Intergenic
932102562 2:68913963-68913985 CTGTGTCAAAGACTGCTCGTTGG + Intergenic
932614829 2:73225405-73225427 CTGAGACAGAGGAGACTGGTTGG - Intronic
933617475 2:84497625-84497647 CTCTGTCATAGGCTATTGCTAGG + Intergenic
933784388 2:85827467-85827489 CGGTGCCAGAGCCTACTGGCTGG + Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934711089 2:96514623-96514645 CTAAGTCAGAGGCTACTGGGTGG + Intergenic
935056831 2:99574946-99574968 CTGTCACTGAGGCTGCTGGTGGG + Intronic
935684758 2:105673454-105673476 CTGTGTCTGACGCTACCAGTTGG - Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937659579 2:124415115-124415137 CTGTGCCAGATGCTAGTGCTGGG + Intronic
938318562 2:130346531-130346553 CTGTGACAGTTCCTACTGGTGGG - Exonic
938773429 2:134520708-134520730 CTGTGTCAGAGGTTAGTAATGGG - Intronic
944182921 2:196915066-196915088 CTGTGTCAAATGTTACTGATAGG - Intronic
946564580 2:220949654-220949676 CTGTGTCAGGGTCTGCTAGTAGG + Intergenic
946970109 2:225081785-225081807 CTGTGTCAGGGACTCCGGGTAGG + Intergenic
947462521 2:230315648-230315670 CAGTTTCAGAGGCTTCTGCTTGG - Intergenic
947471631 2:230406161-230406183 CAGTTTCAGAGGCTTCTGCTTGG - Intergenic
1168787503 20:552514-552536 CTGTGTCAGATGCTGCTGAGGGG + Intergenic
1169143067 20:3236937-3236959 CTGTGTGCTAGGCTGCTGGTGGG - Intronic
1169472348 20:5897694-5897716 CTGTGTCATAGGCTACTGATAGG + Intergenic
1170468767 20:16647558-16647580 CTGTCTCAGGGTCTGCTGGTAGG + Intergenic
1170587465 20:17745607-17745629 CTGTGTCAAATGCTACCGATGGG + Intergenic
1171880114 20:30612365-30612387 CTGTGCCAGAGGCTCATGGTTGG - Intergenic
1173188531 20:40859219-40859241 CTGTGTCTGAGCCTACTGGAGGG - Intergenic
1175945714 20:62557835-62557857 CAGGGACAGAGGCTGCTGGTTGG - Intronic
1176953752 21:15075550-15075572 CTGTGCCACAGGGTACTTGTAGG - Intergenic
1180710535 22:17836486-17836508 CCCTGACAGAGGCTACTGGCTGG - Intronic
1183879705 22:40817212-40817234 CTGGGTCAGATGCTGCTGATGGG - Intronic
1184020950 22:41821115-41821137 GTGTGTCAGACGCTGCTGGGAGG + Intronic
1184320533 22:43739254-43739276 CTGTGTCAAAGGCGGCTGCTGGG - Intronic
1185235904 22:49712779-49712801 TTGTGTCAGAGGCCTCTGGGAGG - Intergenic
950447166 3:13045016-13045038 CTGTGTCTGAGGCTGCTGTGAGG + Intronic
952984297 3:38763858-38763880 CAGTGTCTGAGGAGACTGGTTGG - Intronic
954293861 3:49663524-49663546 CTGTGTCAGAGCCTGCTGTGGGG - Exonic
954438609 3:50509349-50509371 CTGAGGCAGGGGCTCCTGGTGGG - Intergenic
955788616 3:62565530-62565552 CTGTATCAGAGTCTTCTGGATGG + Intronic
956704257 3:71985760-71985782 CTGTCTCAGAGTCTGCTGCTCGG + Intergenic
962253688 3:133855779-133855801 ATGTATCAGGAGCTACTGGTGGG + Intronic
962253799 3:133856619-133856641 ATGTATCAGGAGCTACTGGTGGG - Intronic
962310411 3:134322875-134322897 CAGGCTCACAGGCTACTGGTGGG - Intergenic
962311311 3:134329045-134329067 CTGAGTCACATGCCACTGGTGGG + Intergenic
962806554 3:138931577-138931599 ATGTGTCAGAAGCTCCTGGGTGG + Intergenic
967381444 3:188863549-188863571 CTTTCTCGAAGGCTACTGGTAGG + Intronic
968385037 4:128324-128346 CTGTGTGAGAGGCTTCTGATGGG + Intronic
968401159 4:298921-298943 TTGTGTGGGAGGCTTCTGGTGGG - Intronic
968763031 4:2452080-2452102 CCGTGACAGAGGCTGCTGGGTGG - Intronic
969675306 4:8611247-8611269 CTTGGGCAGAGGCTCCTGGTGGG - Intronic
976373662 4:84319543-84319565 TTGTGTCAGAAGTTACAGGTTGG + Intergenic
979561170 4:122103663-122103685 GTGTATCAGAGACTGCTGGTTGG - Intergenic
980079174 4:128325673-128325695 CTGTGTCAGATGCTAGTGAGAGG - Intergenic
981810688 4:148770669-148770691 CTGTTTCAGAGGCTTTTGCTTGG - Intergenic
982405481 4:155015326-155015348 ATGTGGCAGGGGCTTCTGGTTGG + Intergenic
985128119 4:186715133-186715155 CAGTGCCAGAGCCTTCTGGTGGG - Intronic
986122794 5:4857610-4857632 ATGTGTCAGAGGGTGCTGGATGG - Intergenic
991912414 5:71574843-71574865 GTCTATTAGAGGCTACTGGTTGG - Intergenic
992351298 5:75931970-75931992 CTGGATCAGAGGCTACAGCTTGG - Intergenic
993424727 5:87748973-87748995 CTGTGTCAAATGCTAATGTTAGG + Intergenic
994524588 5:100887897-100887919 CTGTGTGAGAGTCTATTGATTGG + Intronic
995901805 5:117078118-117078140 TTGTGTCAAATGCTACTGATAGG + Intergenic
998351252 5:141503119-141503141 CTGTGTCAGGGGCTACCAGAGGG - Intronic
999251581 5:150185524-150185546 CTGTCTCCCAGGCCACTGGTAGG - Intergenic
999354596 5:150914269-150914291 CTGGGTCAGAGTCTGCAGGTTGG - Intergenic
1002363958 5:178695834-178695856 ATGTTTCAGAGGCTACTGACAGG + Intergenic
1002618191 5:180468376-180468398 CTCTGTCAGAGGCCTCTGGTTGG + Intergenic
1005440333 6:25860600-25860622 CTGTTTCAGAGGCTCCAGGCAGG - Intronic
1007884192 6:45207251-45207273 CTGTGTCAAATGCTATTGATAGG + Intronic
1014499373 6:122165855-122165877 CTTTTTCAGAGCCTTCTGGTGGG - Intergenic
1015408937 6:132870081-132870103 CAGTGTCAAAAGCTACTGATAGG - Intergenic
1015430523 6:133125646-133125668 CTGTCTCAGAGGGAACTTGTTGG + Intergenic
1015487638 6:133790293-133790315 CTGTTTCACAGGCTGCTGTTGGG + Intergenic
1017450660 6:154551870-154551892 CTGGGGCAGAGGCTACTCGGAGG - Intergenic
1018667006 6:166148048-166148070 CTGTCTCATTGGCTACTGCTAGG - Intergenic
1025986727 7:66459675-66459697 CTGTGTCAGAGTCTTTTGCTTGG + Intergenic
1028085900 7:86637241-86637263 CTGAGTCAGACACTACTGGCTGG + Intergenic
1032334539 7:131012805-131012827 TTGTGGCAGAGCCTGCTGGTTGG - Intergenic
1034050701 7:147981311-147981333 GTGTGGCTGAGGCTAGTGGTGGG - Intronic
1036635432 8:10547252-10547274 CTGTGTCAGAGGCCACCGGCTGG - Intronic
1036697047 8:10982160-10982182 CTGTTTCAAAGGCAAATGGTAGG + Intronic
1041480113 8:58310756-58310778 CTGTCTCAAATGCTACTGATGGG - Intergenic
1043399654 8:79871568-79871590 CTGTGTCAAAGGCTACTCCCAGG - Intergenic
1044522803 8:93218977-93218999 CTATGTCAGAGTCCACGGGTGGG + Intergenic
1045945444 8:107789543-107789565 CTGTGTTGGTGGTTACTGGTGGG - Intergenic
1046803557 8:118455198-118455220 TTGTGTCAGAGGCTACCAGGAGG - Intronic
1047213407 8:122857985-122858007 CTGAGTGAAAGGCTACTGTTAGG + Intronic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1047585884 8:126271884-126271906 CAGTGTCATATGCTACTGATAGG - Intergenic
1048122668 8:131599284-131599306 CTGTGTCTGTGGCTACATGTGGG - Intergenic
1048307565 8:133294921-133294943 CTTTGTGAGAGGCTCCTGGGTGG - Intronic
1048804052 8:138222954-138222976 CTGTGTAGGAGGCTACTGTCGGG + Intronic
1049147546 8:141012516-141012538 CAGTGTCAAGGACTACTGGTTGG + Intergenic
1050276123 9:4002593-4002615 CTGTGACAGAGGCTATTGATTGG + Intronic
1052109698 9:24566160-24566182 ATGAGTCTGAGGCTACTGGAAGG - Intergenic
1059700175 9:116768340-116768362 CTGTGTCATAGGCTACTCAGAGG - Intronic
1061160756 9:128892573-128892595 GTGAGTCAGAGGCTGCTGGCTGG - Intronic
1186172764 X:6894751-6894773 CTGTTACAGAGGCTACTTGGAGG + Intergenic
1186409214 X:9331365-9331387 CTGTATCAGAGCCTCCTGGATGG - Intergenic
1186966124 X:14788046-14788068 CTGTGTCAGAGGAAAGTGCTAGG + Intergenic
1187365654 X:18663938-18663960 CTGTGTCATATGTTGCTGGTGGG + Intronic
1187634672 X:21213517-21213539 GTGTGTCAGGGGATAGTGGTGGG + Intergenic
1188126055 X:26370639-26370661 AAGTGTCAGGGGCTATTGGTAGG - Intergenic
1188969059 X:36590649-36590671 CTGCATCAGGGGCTACTTGTGGG + Intergenic
1189479505 X:41381830-41381852 CTGGGTCAGAGGCCACTGCCTGG + Intergenic
1190217240 X:48488123-48488145 CAGTGCCAGTGACTACTGGTGGG + Intergenic
1193390291 X:80918800-80918822 CTGTGTCAAATGCTGCTGATGGG - Intergenic
1194039452 X:88921892-88921914 CTGTGTTAGATGCTACTGATAGG - Intergenic
1195912870 X:109906132-109906154 CTGGGACAGAAGCTACTAGTAGG + Intergenic
1198175225 X:134148265-134148287 CTGTGTCAAATGCTGCTGATAGG - Intergenic
1200326717 X:155248283-155248305 CTGTGTCAAATGCTGCTGATAGG - Intergenic