ID: 902238263

View in Genome Browser
Species Human (GRCh38)
Location 1:15071617-15071639
Sequence AAATATGCAAATATGCAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 457}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902238257_902238263 20 Left 902238257 1:15071574-15071596 CCTGAACCACAATTGGATGATGT 0: 1
1: 0
2: 1
3: 7
4: 88
Right 902238263 1:15071617-15071639 AAATATGCAAATATGCAGCACGG 0: 1
1: 0
2: 4
3: 33
4: 457
902238258_902238263 14 Left 902238258 1:15071580-15071602 CCACAATTGGATGATGTCTCAAA 0: 1
1: 1
2: 1
3: 17
4: 157
Right 902238263 1:15071617-15071639 AAATATGCAAATATGCAGCACGG 0: 1
1: 0
2: 4
3: 33
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902238263 Original CRISPR AAATATGCAAATATGCAGCA CGG Intronic
901458082 1:9375331-9375353 AAATATGGAAATACGTTGCAAGG - Intergenic
902238263 1:15071617-15071639 AAATATGCAAATATGCAGCACGG + Intronic
902684199 1:18065176-18065198 AAATCTGCAAGTCTGCAGCTTGG + Intergenic
903956190 1:27027689-27027711 AAATAGGTAAATACGCAGCATGG - Intergenic
904437334 1:30507352-30507374 ACAGCTGCAGATATGCAGCATGG - Intergenic
904525762 1:31132716-31132738 AAAATTGCAAAGATGCAGCCAGG + Intergenic
904899421 1:33844937-33844959 AATTTTACAAATCTGCAGCAGGG - Intronic
905227106 1:36486305-36486327 AAATATTGAATTATGCAGAAGGG - Intergenic
905367545 1:37461987-37462009 AACTGTGCAAATACGTAGCAGGG - Intergenic
905767182 1:40610845-40610867 AAGTATGAAAATATGTTGCAAGG + Intergenic
906720407 1:48000245-48000267 GAATAGGCAAATATATAGCAAGG + Intergenic
906900422 1:49829975-49829997 AAATGTGCACATATACACCATGG - Intronic
907254043 1:53164733-53164755 CAATGTACAAAAATGCAGCAGGG - Intergenic
907754527 1:57298197-57298219 AAGAAATCAAATATGCAGCATGG - Intronic
908026017 1:59952331-59952353 AAATAAGCAAATATGCTCCAGGG - Intergenic
908840223 1:68272824-68272846 AAAAATACAAATTTGAAGCAGGG + Intergenic
909584469 1:77274179-77274201 AAATATGCTTTTATGAAGCAAGG - Intergenic
909994468 1:82262034-82262056 ATATATATAAATATGCAGTATGG + Intergenic
910430357 1:87153864-87153886 ACATTTATAAATATGCAGCAAGG - Intronic
911656665 1:100451526-100451548 ATAAATGCAAATATGCTGTAAGG - Intronic
911781179 1:101881002-101881024 AAATATGCAAGTCTTCAGGATGG + Intronic
912626483 1:111208974-111208996 ATATATCCATATATCCAGCAAGG - Intronic
913670112 1:121089528-121089550 AAATTTGCCAATAGGCAGAATGG - Intronic
914021876 1:143876941-143876963 AAATTTGCTAATAGGCAGAATGG - Intergenic
914660360 1:149784880-149784902 AAATTTGCTAATAGGCAGAATGG - Intronic
914732664 1:150385563-150385585 AAATATGTAAATATTAAGTATGG + Intronic
915044673 1:153002165-153002187 AAATTTGCAAACATACAGCATGG + Intronic
915046631 1:153022898-153022920 AACTTTGCAAACATACAGCATGG + Intergenic
915193799 1:154174035-154174057 AAATATGGATATATACAGCTGGG + Intronic
916104564 1:161421737-161421759 AAATATGCAAATTAGCATAACGG - Intergenic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
918071747 1:181138298-181138320 AAATAAGCGTAGATGCAGCAAGG - Intergenic
918475298 1:184918036-184918058 ACATTTGGAAATATGCGGCAGGG - Intronic
918719816 1:187838911-187838933 AAGTATGAAAATATGCTGCAAGG + Intergenic
921070176 1:211651812-211651834 AAAGAGGCAAATATACAGAATGG + Intergenic
921291879 1:213665312-213665334 AAATATTCAAATAAGCAATAAGG + Intergenic
921876593 1:220203306-220203328 CAATATTCTAATATGTAGCATGG - Intronic
922453265 1:225753760-225753782 AAAAATACAAAAAAGCAGCAGGG - Intergenic
923918956 1:238542282-238542304 AAATATGCACATATTCAAAAAGG + Intergenic
924806526 1:247366135-247366157 AAATTTGCAAGTAAGTAGCAAGG + Intergenic
924834869 1:247638129-247638151 ACATATGAAAATATGCAAGACGG + Intergenic
1063801586 10:9585038-9585060 AAATGTGCACATATACACCATGG + Intergenic
1064539827 10:16394120-16394142 AAATATGGCAATAAGTAGCAGGG + Intergenic
1065753645 10:28911382-28911404 CCATATTCAAAGATGCAGCAAGG - Intergenic
1066003473 10:31126322-31126344 AAATATACATATACGTAGCAAGG - Intergenic
1066391295 10:34979259-34979281 AAAAGTACAAAAATGCAGCAGGG - Intergenic
1067404815 10:46011898-46011920 AAATATGCAAAAAATTAGCAGGG + Intronic
1067901254 10:50244029-50244051 AAGTATGAAAATATGTTGCAAGG + Intronic
1068100322 10:52544725-52544747 GAATATGCAAAGATTCAGAAAGG + Intergenic
1068501873 10:57849726-57849748 AATTATGCAAATGTGCAGAAGGG + Intergenic
1068754303 10:60633727-60633749 ATATTTACAAATATGCAACATGG + Intronic
1068984569 10:63095212-63095234 AAATAGGCAAATAGGCTGCCTGG + Intergenic
1069059100 10:63874995-63875017 AAATATTGTAATATGCAGCCTGG - Intergenic
1069219840 10:65869359-65869381 AATTATGAAAATTTGCAGAAGGG - Intergenic
1069673596 10:70232042-70232064 AATTTTGCAATTAAGCAGCAAGG - Intronic
1070040259 10:72771399-72771421 AAATGTGCACATATACACCATGG - Intronic
1070531394 10:77340494-77340516 AAATGTGCACATATACACCATGG + Intronic
1071063420 10:81601277-81601299 TATTATGCAAATATAAAGCAAGG + Intergenic
1072195058 10:93110386-93110408 AAATCTGCACAGATGCAGCCAGG - Intergenic
1072529814 10:96308379-96308401 AAATATGCAAAAATGCCTCAAGG - Intronic
1073603339 10:104868058-104868080 GTATATGAAAATATGAAGCAAGG - Intronic
1074190297 10:111129654-111129676 AAATCTGCTAATATGCAGACGGG - Intergenic
1075362536 10:121851724-121851746 AAATATGCAAAACTGCAGACTGG - Intronic
1075647073 10:124103653-124103675 AAACATGCAAATCTGGAGCAAGG - Intergenic
1078048652 11:7942019-7942041 AAATAGGCACAAATGCAGAAGGG + Intergenic
1078501242 11:11879734-11879756 AATTGTGCAAAAATGCAGTAAGG - Intronic
1078570065 11:12450004-12450026 AAATGAGTAAATATGCAGGAAGG - Intronic
1080549239 11:33356437-33356459 TAGTATGCAAATATGCAACTTGG - Exonic
1081018570 11:37913796-37913818 ACATATGCAAATATGTAGTCTGG + Intergenic
1081240269 11:40697148-40697170 AAAAATGTATATATGCAGTATGG - Intronic
1082200940 11:49366283-49366305 AATTATGCAGATAAGTAGCAAGG + Intergenic
1082938112 11:58675397-58675419 AAAAATGCAAATATGCATGAGGG - Intronic
1083695928 11:64442367-64442389 AAAGATGCAAATGTGGAGGATGG - Intergenic
1084535582 11:69754502-69754524 AAATATGCAACTATGCCAAAAGG + Intergenic
1085160608 11:74340472-74340494 AAATATGCAAAAATGGAATATGG + Intronic
1086130594 11:83397689-83397711 AAAAATACAAAAATACAGCAGGG - Intergenic
1086233065 11:84593426-84593448 AAATGTGCACATATACACCATGG + Intronic
1086654732 11:89339937-89339959 AATTATGCAGATAAGTAGCAAGG - Intronic
1086951318 11:92892961-92892983 AAATATGCATATATTTACCATGG - Exonic
1087422653 11:97949769-97949791 AAATTTGCACATATACACCATGG - Intergenic
1087788574 11:102383468-102383490 AAATATGCAAAGTTGGAGAATGG + Intergenic
1088112901 11:106282359-106282381 CAAAATTCAAATATACAGCAGGG + Intergenic
1089355197 11:117845303-117845325 AAATATGCATACATGCTACAAGG - Intronic
1090102440 11:123813898-123813920 AAATATATATATATGCAGAAAGG - Intergenic
1090912772 11:131135843-131135865 AAAGATGCCAACATGCAGCAGGG - Intergenic
1090936058 11:131343510-131343532 TAATCTGCAAACATGCAACAAGG + Intergenic
1091218191 11:133916413-133916435 ACACATGCAAAGGTGCAGCATGG + Intronic
1091777671 12:3195159-3195181 AAATGTGGGAATATTCAGCATGG + Intronic
1092299219 12:7229291-7229313 AAACATTCAAATAGCCAGCATGG + Intergenic
1093699856 12:22207113-22207135 AGATAGGCCAATGTGCAGCAGGG + Intronic
1094790829 12:33912923-33912945 AAATGTGCACATATACACCATGG - Intergenic
1095583412 12:43825353-43825375 GATTATCCCAATATGCAGCAGGG + Intergenic
1095882983 12:47158430-47158452 AAATATGCAAATGGCCAGTAAGG - Intronic
1095885047 12:47179993-47180015 ACATATGCAAACATGTACCATGG + Intronic
1095995881 12:48084178-48084200 AAATATGTAAAAATGCATAAAGG + Intronic
1096281672 12:50260468-50260490 ACATATGAAACTATCCAGCATGG - Intronic
1096422737 12:51474225-51474247 AAGTATGCAAAGAAGCAGCAAGG + Intronic
1097438036 12:59574663-59574685 AAATATGAGAATGTACAGCAAGG + Intergenic
1097870195 12:64595499-64595521 AAAGATGCAAATATTCCCCAGGG - Intergenic
1098098617 12:66988236-66988258 AGATATGCAAATATACGGCCTGG + Intergenic
1098238239 12:68439551-68439573 AAATATGCAAATGAGCAGGGTGG - Intergenic
1099143603 12:79011391-79011413 AAATATGCAAATTTATAGTAGGG + Intronic
1100147487 12:91696214-91696236 AATTATAGAAATAAGCAGCAAGG + Intergenic
1100451903 12:94714940-94714962 AAATATGCACATATGCACATTGG + Intergenic
1100727886 12:97428540-97428562 AAAAATGAAAATATGCATTAAGG - Intergenic
1100771639 12:97929482-97929504 AAATATGAAAATGTACATCAGGG - Intergenic
1102624067 12:114220490-114220512 CACTATGCAAATATGCCTCAAGG + Intergenic
1103004735 12:117412230-117412252 ACATATGAATATATGCACCAGGG + Intronic
1103502007 12:121410235-121410257 AAATTTTCAAATATGCTGCATGG + Intronic
1104199145 12:126570604-126570626 ACATATGAACATATGCTGCATGG + Intergenic
1105459684 13:20572081-20572103 AAATTTTCAAACATGCAGCAAGG + Intronic
1106225541 13:27783601-27783623 AAATCTGCAAATTTGTTGCATGG + Intergenic
1106501154 13:30330281-30330303 AAATATACAGAAATGCAGCCCGG - Intergenic
1106743577 13:32674823-32674845 AAAGATTCTAATATGCAGCCAGG - Intronic
1108115197 13:47119866-47119888 AAAGATGCAATAATGCTGCAAGG + Intergenic
1108211973 13:48148392-48148414 AAATAGGCAAAAATTAAGCAGGG + Intergenic
1109057422 13:57569116-57569138 CAATAAGCAAATATTCAGTATGG + Intergenic
1109160966 13:58973729-58973751 AAAAATGCTAATGTGCAGAAGGG - Intergenic
1109586209 13:64408080-64408102 AAAAATGAAATTATGCAGCCTGG + Intergenic
1109943444 13:69401708-69401730 AAAAATATAAATATGCAGCAAGG + Intergenic
1109995580 13:70120704-70120726 AAATCTGCACATATACACCATGG + Intergenic
1110098434 13:71562345-71562367 AAATATGCAAATAAGTGGGAGGG + Intronic
1110165529 13:72438243-72438265 ATATATGTAAATATGCAGGATGG - Intergenic
1110246280 13:73327817-73327839 AGAAATGCTAATATGCAGCCAGG + Intergenic
1110317456 13:74127209-74127231 AAATATTTATAAATGCAGCATGG + Intronic
1110871239 13:80454821-80454843 AAATGTGTACATATGCAACATGG + Intergenic
1111608136 13:90567007-90567029 AGATATGCAAAAATGCAACTGGG + Intergenic
1112499277 13:99930014-99930036 AAGAATGCAGACATGCAGCATGG + Intergenic
1114072083 14:19119963-19119985 AGATCTTCAAAAATGCAGCAAGG - Intergenic
1114090174 14:19280001-19280023 AGATCTTCAAAAATGCAGCAAGG + Intergenic
1114376672 14:22153746-22153768 AAATAAGCACATATGGAGAATGG - Intergenic
1114518212 14:23314940-23314962 CAATATGCAAATATATATCAAGG - Intronic
1114755032 14:25249544-25249566 TAATTTTCAAAAATGCAGCATGG + Intergenic
1114906880 14:27139747-27139769 AAATTTGAAAATATGCTGCCAGG - Intergenic
1114983992 14:28203147-28203169 AGATATGAAACAATGCAGCAAGG + Intergenic
1115098957 14:29674792-29674814 AAATATTCTGATAGGCAGCAGGG + Intronic
1115150772 14:30282993-30283015 AGTTATGCAAATATGCAAAATGG - Intergenic
1115615416 14:35090084-35090106 AAATATGTAAATATACGTCAGGG + Intronic
1115686893 14:35805477-35805499 AAAAATGGAATTATGCAGTACGG - Intronic
1116464933 14:45220803-45220825 ATATATCAAAATTTGCAGCATGG - Intronic
1117118678 14:52545583-52545605 AAATAAGGAAACATGCAGCTAGG + Intronic
1118949454 14:70420728-70420750 AAATGTGCAAAAATAGAGCAAGG - Intergenic
1119023728 14:71136503-71136525 CTATATGCAAATATGCTGCTAGG - Intergenic
1120344703 14:83271164-83271186 TAAGCTGCAAATGTGCAGCATGG - Intergenic
1120431517 14:84422583-84422605 AAATATGCAGAAAAGAAGCATGG - Intergenic
1121593736 14:95142045-95142067 AGATATGCTCATATACAGCATGG - Intronic
1121866124 14:97364322-97364344 AAGTATGAAAATATGTTGCAAGG - Intergenic
1122335533 14:100976652-100976674 AAATATAGAAATATGTGGCAAGG + Intergenic
1122515172 14:102302709-102302731 AAATATGTACATATGCTGCCTGG - Intronic
1202844865 14_GL000009v2_random:159783-159805 AAATCTGGCAATATGCAACATGG + Intergenic
1124165841 15:27324897-27324919 AATTATGCAAATATGGCTCAAGG - Intronic
1125260469 15:37818743-37818765 AAATAAACAATTATGCACCAGGG - Intergenic
1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG + Exonic
1126357112 15:47808273-47808295 AAATATTCAAATATAGAGCCGGG - Intergenic
1126893233 15:53229276-53229298 AAATTTGCAAATATGCAGTAGGG - Intergenic
1127146392 15:56028646-56028668 AAGTATGCAAGAATGCAGAAAGG - Intergenic
1127309139 15:57737021-57737043 AAAGTTGCAAAAAGGCAGCATGG + Intronic
1127753811 15:62070225-62070247 AAATATTTAAATATACAGGATGG + Exonic
1128922149 15:71620849-71620871 AAAAAGGCTAATAAGCAGCAGGG + Intronic
1129195054 15:73959307-73959329 AAGCTTGCAAATATGCAGAAAGG + Intergenic
1129559275 15:76549389-76549411 AAATATGCACATATACACCATGG + Intronic
1130343977 15:83024758-83024780 AAAAATTCAAAAATTCAGCATGG - Intronic
1131362929 15:91810199-91810221 AAAAATGTAAATATGCAGAATGG + Intergenic
1131371363 15:91884822-91884844 ATATATGAAAATATGCAGCATGG - Intronic
1131718836 15:95145107-95145129 TTATAAGCAAATATGCAGCATGG - Intergenic
1133564281 16:6978443-6978465 TAATAAGTAAATATGCACCAAGG - Intronic
1133678527 16:8098603-8098625 ATTTTTGCAAATATTCAGCAGGG + Intergenic
1135148049 16:19980298-19980320 AAAAATGCAGATTTCCAGCATGG + Intergenic
1135790049 16:25385603-25385625 AAATATGCACATATACTCCATGG - Intergenic
1135886592 16:26315370-26315392 AAATATGAAAAGAGGCAGCCAGG - Intergenic
1136187018 16:28594299-28594321 AAAGATGCAAATAATCAGCAGGG - Intronic
1137276963 16:46941506-46941528 AACTATGTACATATGCAGGAAGG + Intergenic
1137998233 16:53244043-53244065 ACATATACAAATATTTAGCATGG + Intronic
1138296252 16:55887818-55887840 AAGTATGAAAATATGTTGCAAGG + Intronic
1138365231 16:56470232-56470254 AAATATACAATCATGCACCAAGG + Intronic
1140330926 16:74056059-74056081 AAAAAGGCAAATATGAAGCTGGG + Intergenic
1141075299 16:81000977-81000999 AAATATGTACATATACACCATGG + Intronic
1141264316 16:82482407-82482429 AGATATGTAGATATGCATCAGGG + Intergenic
1142135222 16:88448924-88448946 ACATATGCAAATGTGCAGCCTGG + Intergenic
1142735642 17:1897199-1897221 AAGTTTGCAAATAGGCAGAATGG + Exonic
1143152041 17:4813308-4813330 ACATGTGAAAATATGCAGGAAGG - Intronic
1144247488 17:13381895-13381917 AAAAATGCAAATATTTAGCCAGG - Intergenic
1144748170 17:17629782-17629804 AAAAATGCAAAAATTTAGCAGGG - Intergenic
1145089354 17:19973906-19973928 AAAAATCCAAAAATGCAGCCGGG + Intronic
1145119366 17:20243293-20243315 AAATATGTAAGTATACAGCCAGG - Intronic
1146144986 17:30407174-30407196 AAATGTGCACATATACACCATGG - Intronic
1148926724 17:51093291-51093313 TAAAAAGCAAATATGCAGAAAGG + Intronic
1149010349 17:51850205-51850227 TTCTATGAAAATATGCAGCATGG + Intronic
1149782082 17:59405879-59405901 AAATGTGTAAACATGCAGCCAGG - Intergenic
1150832971 17:68540510-68540532 AAGTACACAAATATGTAGCAGGG - Intronic
1150941113 17:69695707-69695729 AAGTATGAAAATATGTTGCAAGG + Intergenic
1151409113 17:73909395-73909417 ACACATGCAAATGAGCAGCACGG - Intergenic
1152977203 18:233123-233145 AAATATGTAAATTTGGAGTAGGG - Intronic
1153832755 18:8937654-8937676 AAATCTGCATTTATGCAGCCAGG + Intergenic
1154053803 18:10991588-10991610 AAATGTGGACATATGCACCATGG - Intronic
1154504818 18:15025801-15025823 AGATATATAAATATCCAGCACGG - Intergenic
1154994758 18:21629504-21629526 AAATCTTCAACTATGCAGCTGGG - Exonic
1156093610 18:33501553-33501575 AAAAATGGAAATATGAAGAAAGG - Intergenic
1156282607 18:35655375-35655397 AAATATACAAATATAAAGGAGGG + Intronic
1156939542 18:42748939-42748961 TAATAGGCAAATATTCAGTAAGG + Intronic
1157001822 18:43536415-43536437 AAAAATACAAAAATTCAGCATGG + Intergenic
1157670986 18:49528452-49528474 AAATATGCACATATACATAATGG - Intergenic
1157941882 18:51938059-51938081 ACATATGTAAATGTGCACCATGG + Intergenic
1158159197 18:54460951-54460973 AAATTGGCAACTATCCAGCATGG + Intergenic
1159342227 18:67150029-67150051 TAATATGCAAATGTACAGTATGG + Intergenic
1159610182 18:70516007-70516029 AAATGTGCACATATACACCATGG - Intergenic
1160039432 18:75332652-75332674 AGACATGCAAAAAGGCAGCAGGG + Intergenic
1161722542 19:5911273-5911295 AAAAATGCAAAAACGCAGCCAGG - Intronic
1161728049 19:5941911-5941933 AAATATCCCAACATGCACCACGG + Intronic
1163627615 19:18399261-18399283 AAACATGCAAATATTCAGGCAGG - Intergenic
1164779569 19:30881614-30881636 AGATATGAGAATATGCAGCCTGG + Intergenic
1166510034 19:43400465-43400487 AAATAAGTAATTATGCATCAGGG - Intergenic
1167777805 19:51572381-51572403 AAATTTGCAGACATGCATCAGGG - Intronic
1167813359 19:51854885-51854907 GAATAAGCAAATATGAAGCTAGG - Intergenic
925284702 2:2708308-2708330 GCATATGAAAATATGTAGCAAGG - Intergenic
925567123 2:5268528-5268550 CAGTATACAAATATGTAGCATGG - Intergenic
925943745 2:8842245-8842267 AACTATGCGAATAATCAGCAAGG + Intergenic
926235329 2:11038565-11038587 AAAGATACAAATTTGCAGAATGG - Intergenic
926493284 2:13552487-13552509 GAAAATGCAAATATGCACAATGG + Intergenic
927621038 2:24659091-24659113 AAATCTGCAATTATGGATCATGG - Intronic
928595533 2:32855947-32855969 CATTATGCAAATAAGCAGCCTGG - Intergenic
929517203 2:42614677-42614699 AAATATTCTAATATTCAGCTGGG + Intronic
930359852 2:50363873-50363895 AAATGTGCACATATACACCATGG + Intronic
930610441 2:53537050-53537072 AAATGTGAAAATAAGCAGCGGGG + Intronic
930890321 2:56377725-56377747 AAAAATACAAAAATTCAGCAGGG + Intronic
930966272 2:57332097-57332119 AAAAATGCAAATATAAAGCCAGG + Intergenic
931784793 2:65609057-65609079 AAAAATGAAAATAGCCAGCAAGG - Intergenic
932007708 2:67944138-67944160 AAATATGGTAATATACACCATGG + Intergenic
932584092 2:73012575-73012597 AGATATGCAAAGATTCAGAAAGG + Intronic
933011056 2:77064081-77064103 AAAAATGTAACTATGCAACATGG + Intronic
933057530 2:77691374-77691396 AAATATTTAAATATGTAACATGG + Intergenic
933919284 2:87028292-87028314 AAGTATGAAAATATGTTGCAAGG - Intergenic
934003710 2:87741615-87741637 AAGTATGAAAATATGTTGCAAGG + Intergenic
934797966 2:97118496-97118518 AAATATTGAAGAATGCAGCAAGG + Exonic
934835456 2:97584943-97584965 AAATATTGAAGAATGCAGCAAGG - Exonic
934982529 2:98855990-98856012 AACTATACAAATATTCAGAATGG + Intronic
937517294 2:122669925-122669947 CAATATTCAAAAATGCAGAATGG - Intergenic
937546593 2:123029833-123029855 AAATATGCATATATATGGCATGG - Intergenic
938486325 2:131713382-131713404 AGATCTTCAAAAATGCAGCAAGG - Intergenic
938504011 2:131856008-131856030 AGATATATAAATATCCAGCACGG - Intergenic
938621447 2:133059002-133059024 AAATATTCTGATATGCAGCCAGG + Intronic
939045707 2:137247224-137247246 AATGTTGAAAATATGCAGCAAGG - Intronic
939128680 2:138207217-138207239 AAACATGCAAATATAAAACAAGG - Intergenic
939199230 2:139013871-139013893 GAATATCCAAATAGGCAGAAAGG - Intergenic
940406638 2:153311346-153311368 AAATATCCAAATATGAAGAAAGG + Intergenic
941103521 2:161325127-161325149 AACTAAGGACATATGCAGCAGGG + Intronic
941915178 2:170807855-170807877 AAATATCCAATTAGGCATCAGGG - Intergenic
942355009 2:175101351-175101373 AAATATATAAATATGCAGACTGG - Intronic
942743222 2:179203259-179203281 AAGTATAAAAATATGCTGCAAGG - Intronic
942912430 2:181261657-181261679 AATTATGGAAATTTGCAGCAAGG - Intergenic
943040509 2:182798956-182798978 AAAAATGCACATATTCAGTATGG + Intergenic
943700434 2:190983478-190983500 AAATCTGGGAATATGAAGCATGG - Intronic
944281917 2:197907706-197907728 AAATATGAAATTATGCACTAGGG - Intronic
944370453 2:198976281-198976303 AAATATCCAGATAGGCAGTATGG + Intergenic
945073407 2:206013689-206013711 TAAAATGAAAATATGCAGCTGGG + Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
945590287 2:211720571-211720593 AAACAGGCAAAGATCCAGCACGG - Intronic
947078497 2:226369778-226369800 AAATATGGGTATATGCAGAAGGG - Intergenic
1170016624 20:11789151-11789173 AAATCTGCATTGATGCAGCATGG - Intergenic
1170338365 20:15296051-15296073 AAGTATGAAAATATGTTGCAAGG - Intronic
1170906731 20:20522387-20522409 AAATCTGCAAATATTCACAACGG + Intronic
1171339142 20:24413361-24413383 AAATAGGCATTTATGGAGCAGGG - Intergenic
1172556072 20:35842505-35842527 AAATATCCAAATATCCATAATGG - Intronic
1173877115 20:46380314-46380336 AAATAAGCAAATATAAGGCAGGG + Intronic
1174964624 20:55198330-55198352 AAATAGGTAAACATGCATCATGG - Intergenic
1175649465 20:60705894-60705916 AAATCTGCACATAAGCACCATGG - Intergenic
1177064787 21:16416844-16416866 AAATATGAAAATAAGTATCATGG + Intergenic
1177117110 21:17099976-17099998 AAATATTAAAACATGAAGCAAGG - Intergenic
1177750880 21:25282711-25282733 AACTATGGTAATATTCAGCATGG + Intergenic
1177756077 21:25349789-25349811 AAATATGCAAATATGCACTTAGG + Intergenic
1177992426 21:28054168-28054190 AGATATATAAATATCCAGCACGG + Intergenic
1178095991 21:29216545-29216567 ATATATGCAAAGATCCAGCCTGG - Intronic
1178219706 21:30642474-30642496 AAATATGCATATAAGAAGAAGGG + Intergenic
1178227065 21:30732772-30732794 AAATATGCAAACCTCCAGGAAGG - Intergenic
1180490525 22:15842318-15842340 AGATCTTCAAAAATGCAGCAAGG - Intergenic
1180651079 22:17377693-17377715 AAATATGCAAATATGGAGGAAGG - Intronic
1180880438 22:19199610-19199632 GCATCTGCAAATATGAAGCATGG - Intronic
1182382316 22:29902298-29902320 AAATATGAAATTATGCACTAAGG - Intronic
1182774206 22:32818949-32818971 AAATAGGAAATTATGCAGGAGGG - Intronic
1184937696 22:47737002-47737024 AAATATGGAAATATCTACCAAGG - Intergenic
949369794 3:3322314-3322336 AAATATTAACATATGCAGAAAGG + Intergenic
950339284 3:12228458-12228480 AATTATACAAATATTCATCAGGG + Intergenic
951128563 3:19013874-19013896 AATTAAGCAAATATGAAGCATGG + Intergenic
951356825 3:21677358-21677380 AAATATACAAATCTGGAGCTTGG + Intronic
951424920 3:22533186-22533208 AAATGTGCACATATACACCATGG + Intergenic
952027161 3:29097629-29097651 AAATATGCAATTATGTAAAATGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953267366 3:41404722-41404744 GCACATGCACATATGCAGCAGGG - Intronic
955572716 3:60325194-60325216 AATTATAAAAATATGTAGCATGG - Intronic
955905401 3:63802329-63802351 AAACAAGCATATATGCTGCAAGG + Intergenic
956186264 3:66565306-66565328 AAGTATGAAAATATGTTGCAAGG + Intergenic
956248051 3:67205755-67205777 AAGTATGAAAATATGTTGCAGGG - Intergenic
956350746 3:68333276-68333298 GAAAATGCAAATATACACCATGG + Intronic
957561818 3:81832029-81832051 AAATATTCAAAGATACATCAAGG - Intergenic
957660209 3:83140482-83140504 AAGTATGCAACTTTGCAGTATGG + Intergenic
958173926 3:89971416-89971438 CAATCTCCCAATATGCAGCAGGG + Intergenic
958421502 3:93936925-93936947 AAATATACAAATTGACAGCATGG + Intronic
958739876 3:98056315-98056337 GAATATGAGAATATGGAGCAGGG - Intergenic
959434052 3:106291284-106291306 ATGTATGCATATATGCAGCAAGG - Intergenic
959835990 3:110918699-110918721 AAAGATGAAAATATTAAGCAGGG - Intergenic
961576534 3:127841492-127841514 GAATATGTAAATAAGCAGCCAGG + Intergenic
961839729 3:129698999-129699021 AACTATCCAGATATGTAGCAGGG + Intronic
963641127 3:147862918-147862940 AAGTATGAAAATATGTTGCAAGG - Intergenic
963713129 3:148770563-148770585 AAATAGGCAGAAAAGCAGCAAGG + Intergenic
964170635 3:153766348-153766370 AAATGTGCACATATACACCATGG + Intergenic
964702123 3:159580128-159580150 AAATATGGAAATTTTCTGCAAGG - Intronic
965141922 3:164849008-164849030 AAATCTGCATTTATGCAGCCAGG - Intergenic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
967195679 3:187023518-187023540 AAATGTGCACATATACACCATGG + Intronic
967366904 3:188697374-188697396 TAATATGCAAATATGACGCTTGG - Intronic
967936485 3:194732128-194732150 AAGTATGCAAATATGAGACATGG + Intergenic
970056046 4:11973027-11973049 TAATATGTAAATATATAGCAGGG + Intergenic
970325898 4:14925339-14925361 CAAAATGCAACTATGCAGAAAGG - Intergenic
970401005 4:15717758-15717780 AAGTATGAAAATATGTTGCAAGG + Intronic
970422589 4:15919314-15919336 AAGTATGAAAATATGTTGCAAGG + Intergenic
970621400 4:17823252-17823274 ATATATGGAAATATGTAGAAGGG - Intronic
970899529 4:21142807-21142829 AAAACTGCAAATATGATGCATGG + Intronic
971129264 4:23788060-23788082 AAATAGGCAATTGTGCAGCTAGG - Intronic
971687710 4:29789824-29789846 AAATATGACAATATGCAAGATGG + Intergenic
972872558 4:43317695-43317717 AAATATATATATATGCACCAAGG + Intergenic
973126971 4:46598372-46598394 AATTATGCCAATGTGCAGGATGG - Intergenic
974548190 4:63339351-63339373 AAATGTGCACATATACACCATGG + Intergenic
976354433 4:84100266-84100288 TATAATGCAAATATGCGGCATGG + Intergenic
976398845 4:84585201-84585223 AAATAAATAAATATGCAGCGAGG - Intronic
976479518 4:85524029-85524051 AGATATGCAAATGTACACCATGG - Intronic
976688680 4:87844749-87844771 TACTATTCAAATATGCAGAAGGG - Intronic
977148199 4:93473347-93473369 AAATGTTCAAATATGAAGTATGG - Intronic
977159431 4:93614747-93614769 ACAAATGTAAATATCCAGCACGG - Intronic
977323151 4:95545494-95545516 CAATATGCAAACATGCATAAAGG + Intronic
977679351 4:99781884-99781906 TCATATGCAAATATGTAGCTTGG + Intergenic
977830112 4:101580214-101580236 AACAATGCAACAATGCAGCAAGG - Intronic
978336043 4:107670445-107670467 AAATAAGAAAATATGCAGCATGG + Intronic
978721414 4:111914579-111914601 AAATTTGCAAAGAAGCAGGAAGG - Intergenic
979851866 4:125581501-125581523 ACATAGGAAAATGTGCAGCATGG + Intergenic
981470499 4:145128907-145128929 AAAAATTCAAATATACAGAATGG + Exonic
981856021 4:149293761-149293783 AAATATTAAAATATACAGGAAGG + Intergenic
982574571 4:157093373-157093395 ACATATGCATACATACAGCATGG - Intronic
982875942 4:160649851-160649873 AAGTATGAAAATATGTTGCAAGG + Intergenic
983016454 4:162619083-162619105 AAATATGCAAATATGTTTCTTGG + Intergenic
984358899 4:178702240-178702262 AAATGTGCACATATACACCATGG - Intergenic
984359421 4:178709836-178709858 AAATGTGCACATATACACCATGG + Intergenic
984399963 4:179250165-179250187 AAATATGCAAATCTGTGCCATGG + Intergenic
984890250 4:184485703-184485725 AAGTATGAAAATATGTTGCAAGG + Intergenic
986820680 5:11463310-11463332 AAATATGCAAATGTTCATCCAGG + Intronic
989139410 5:38188570-38188592 AGTTATGAAAATATGCAGAAAGG - Intergenic
989267566 5:39495356-39495378 AAAGAAACAAATATGAAGCATGG - Intergenic
989652318 5:43706753-43706775 AAATGTGCACATATACACCATGG + Exonic
989679572 5:44013157-44013179 AAAAATGGAAATATGCCGCTCGG - Intergenic
989969677 5:50507853-50507875 AAATATGTACATATACACCATGG + Intergenic
990160566 5:52935802-52935824 AAATATGCATATATGCAAATAGG + Intronic
990161065 5:52941138-52941160 AAATATGTACATATACACCATGG - Intronic
990534569 5:56707529-56707551 AAAAATACAAATAAGCAGCTGGG - Intergenic
991137446 5:63198704-63198726 AAGTATGTAAATATGAAGAATGG + Intergenic
991476994 5:67032402-67032424 AAATATTCATTTATTCAGCAAGG + Intronic
992129316 5:73675435-73675457 AAGTATGAAAATAAGCAGCCGGG + Intronic
992900956 5:81294886-81294908 AAATATGTACATATACACCATGG + Intergenic
993083017 5:83325668-83325690 AAATATGTACATATACACCATGG - Intronic
993567265 5:89490796-89490818 AAATATGCCAATTTGCAATAAGG - Intergenic
993763301 5:91823539-91823561 AAAGAGGCAAATATGTAGGATGG + Intergenic
993794981 5:92255808-92255830 AAAAATGCACATATACACCATGG - Intergenic
993960410 5:94290492-94290514 AAATATGGACATATACACCATGG - Intronic
994326115 5:98447412-98447434 AAATATGTAAATATTTTGCAAGG + Intergenic
994604818 5:101954030-101954052 AAATATTCTAAGATGCATCAGGG - Intergenic
995874311 5:116774388-116774410 AACTATGCAACTATGCAGGGAGG - Intergenic
997320517 5:132974363-132974385 AAATATGGAAATTTCCAGCCGGG + Intergenic
998013398 5:138713334-138713356 CAATAGCCAAATATTCAGCAAGG - Intronic
999084738 5:148877443-148877465 AAATAGGCACATATGTACCATGG + Intergenic
999856742 5:155603036-155603058 AAGTATGCCTATATGAAGCAAGG - Intergenic
1000334812 5:160234341-160234363 AAGTATGAAAATATGTTGCAAGG - Intronic
1000705016 5:164500477-164500499 AAATATGTACATAGGCAGCTGGG - Intergenic
1001369107 5:171178379-171178401 AAATGTGCACATATACACCATGG - Intronic
1002141419 5:177142622-177142644 AAACATTCAACTATACAGCACGG - Intronic
1002809282 6:611228-611250 AGATCTGCACACATGCAGCATGG - Intronic
1003581773 6:7347026-7347048 AAAAATGTAAATATTCTGCAGGG - Intronic
1005401740 6:25441100-25441122 ATATATGAAAATATACAGCCTGG + Intronic
1006312801 6:33272781-33272803 ACATAAGCAAAAATGAAGCAAGG + Intronic
1007687693 6:43676789-43676811 AAATCTGCAGTTATGCAGCAAGG - Intronic
1008003463 6:46385335-46385357 AAAGATGCAAATTTGGAGCAGGG - Intronic
1008052330 6:46913006-46913028 AAGTATGAAAATATGTTGCAAGG - Intronic
1008292203 6:49730628-49730650 ATATATGCCAATATGTAACATGG + Intronic
1008622905 6:53289215-53289237 AAATATGCAGATAAGCAGGAAGG + Intronic
1008682472 6:53887742-53887764 AAAATTGCAAATATGCAAAAAGG - Intronic
1008725716 6:54415970-54415992 ATATATGCAAACACTCAGCAAGG + Intergenic
1008895829 6:56553908-56553930 AAATAAGTAAAAATGCATCAAGG + Intronic
1009694589 6:67085644-67085666 CAATATGGACATATGCACCATGG - Intergenic
1010763989 6:79757635-79757657 AAATATGACAAAATGCAGGAGGG - Intergenic
1011863436 6:91790111-91790133 AAATATGCAAATGTCTAGTATGG - Intergenic
1012343987 6:98164701-98164723 AAATATGAAAATATGAAATAAGG - Intergenic
1014843185 6:126243567-126243589 AAATGTGCACATATACACCATGG + Intergenic
1015042714 6:128741366-128741388 AAGTATGGAAATATGTTGCAAGG - Intergenic
1015619096 6:135111292-135111314 AAAAATGGAAAAATGCAACATGG + Intergenic
1018085332 6:160296581-160296603 AAAAATAAAAATATGAAGCAAGG - Intergenic
1019024682 6:168949137-168949159 AAGTATGAAAATATGTTGCAAGG + Intergenic
1020518120 7:9151434-9151456 AAATATGAATATATGCTGAATGG - Intergenic
1021710523 7:23411719-23411741 AAAGATGCCAACATCCAGCAGGG + Intronic
1022025798 7:26446554-26446576 AAAAATCCAAATATCCATCAAGG - Intergenic
1022671422 7:32459803-32459825 GAATATCCAAAGATGCAGCTGGG + Intergenic
1022737232 7:33087710-33087732 AAGTATGAAAATATGTTGCAAGG + Intergenic
1023680593 7:42683151-42683173 GAATATGCAAATCTGCAGTGGGG - Intergenic
1023862129 7:44223075-44223097 AAACATGCACATAAGCAGGACGG + Intronic
1024236087 7:47400279-47400301 AAATCTCCAAATATGCACAAAGG + Intronic
1024497590 7:50066162-50066184 GATTATGAACATATGCAGCATGG + Intronic
1026047434 7:66916563-66916585 AAATTTGCAAGTATGGAACAAGG + Intergenic
1026324479 7:69296965-69296987 AAAAATGAAAATAATCAGCAGGG + Intergenic
1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG + Intronic
1028779632 7:94720893-94720915 TTATATCAAAATATGCAGCATGG + Intergenic
1028855346 7:95586172-95586194 AAACAGGAAAATATGCACCAAGG + Intronic
1029433759 7:100549660-100549682 AAATAAACAAATATTGAGCATGG - Intronic
1029508909 7:100980953-100980975 TAATTTGAAAATATGCATCAGGG - Intronic
1029780756 7:102729833-102729855 AAATGTGCACATATACAACATGG + Intergenic
1030023312 7:105297420-105297442 AAATATGCAAATGTTCAATAAGG - Intronic
1030280317 7:107767810-107767832 AAATATGCAAAACAGCATCATGG + Exonic
1030570932 7:111223147-111223169 AAATATAAAAATATGCATTATGG + Intronic
1030733898 7:113021267-113021289 AAATAAGCACATATGGAGAATGG + Intergenic
1031741039 7:125430882-125430904 AAATATGGAAATATGCTTAAGGG - Intergenic
1033493412 7:141867893-141867915 AAAAAAGAAAATATGCACCATGG + Intergenic
1034130696 7:148714013-148714035 AAATATACACACATGCAGCCAGG - Intronic
1034483963 7:151345108-151345130 AAAGTTGCTAATATGTAGCAAGG - Intronic
1036017211 8:4798369-4798391 AAAAATGCACATATACACCATGG - Intronic
1037349264 8:17932102-17932124 AAATATGTAATTATGAAGCCTGG - Intronic
1037521417 8:19683863-19683885 AAATATAAAAATATGTAGTAAGG + Intronic
1037934651 8:22907300-22907322 AAATATAAAAATTAGCAGCATGG + Intronic
1039010467 8:33087851-33087873 ACACATGCAAATTTGAAGCAAGG - Intergenic
1039158241 8:34587409-34587431 AAATGTGCATATATGCACCATGG - Intergenic
1039657946 8:39430635-39430657 AAATGTGTACATATGCACCATGG - Intergenic
1040684785 8:49858992-49859014 AGATATGTTAATATTCAGCAAGG - Intergenic
1042991670 8:74647139-74647161 ATATATGCATATATGCAGAAAGG - Intronic
1045033474 8:98159560-98159582 AAAAATGTAAATATGCAGTTAGG + Exonic
1045066303 8:98449233-98449255 AAATATGGCAATATGTATCAAGG - Intronic
1045318190 8:101061214-101061236 AACTAGGCAGATAGGCAGCAGGG + Intergenic
1045702083 8:104879026-104879048 AAATTTGCAAAAATGGATCAAGG + Intronic
1046397772 8:113662268-113662290 ATATAAGGAAATAAGCAGCATGG - Intergenic
1046649715 8:116824391-116824413 GAATATGAAAATATCCAACAAGG - Intronic
1046665339 8:116996041-116996063 AAATATGAAAATATGTTGCAAGG - Intronic
1046694226 8:117320664-117320686 AAATGTGCTGATATGCACCATGG + Intergenic
1047352816 8:124092070-124092092 AAATATGCCAGCAAGCAGCATGG - Intronic
1047471796 8:125181494-125181516 AAATTTTCAAATATGCAGAAAGG - Intronic
1047797010 8:128267869-128267891 CATTATGCAAATGAGCAGCAGGG - Intergenic
1047887365 8:129266640-129266662 AAATCTGCACATATACACCATGG + Intergenic
1048889207 8:138932927-138932949 TAATATGCAAATGAGAAGCAAGG + Intergenic
1049334946 8:142079170-142079192 AAATATGTAGATATGAAGCCAGG + Intergenic
1050778459 9:9299239-9299261 GAAAAAGCAAATATGCAGAAAGG + Intronic
1051931310 9:22389565-22389587 CAAGATGCAAATATGGAGAAAGG + Intergenic
1052318921 9:27146216-27146238 AAATATGCAAAGATATGGCAAGG - Intronic
1052828186 9:33192748-33192770 AAACATGCAAAAATGCAGTGGGG + Intergenic
1053575487 9:39355005-39355027 ACATAGGCAAATATGTACCATGG - Intergenic
1053839994 9:42182940-42182962 ACATAGGCAAATATGTACCATGG - Intergenic
1054097048 9:60913688-60913710 ACATAGGCAAATATGTACCATGG - Intergenic
1054118455 9:61189315-61189337 ACATAGGCAAATATGTACCATGG - Intergenic
1054589301 9:66993249-66993271 ACATAGGCAAATATGTACCATGG + Intergenic
1055029440 9:71758683-71758705 AAATATGCATTAATGCAGCCAGG - Intronic
1055317679 9:75050183-75050205 AAGTATGAAAATATGTTGCAAGG - Intergenic
1055671407 9:78610124-78610146 TTATATGCAAATATCAAGCAAGG - Intergenic
1056861534 9:90189034-90189056 AACTATTGATATATGCAGCAAGG - Intergenic
1057246452 9:93459211-93459233 AAATATGCAGTTATGCAGGTAGG - Intronic
1057424551 9:94937643-94937665 TGATATGGAATTATGCAGCAAGG - Intronic
1058045065 9:100349879-100349901 TAATATTCAAATACACAGCAAGG + Intronic
1058878985 9:109270364-109270386 AAATAAACAATTATGAAGCAAGG - Intronic
1058933959 9:109750328-109750350 AAACATGCCAGTATGCAACAGGG - Intronic
1059851394 9:118345123-118345145 ATATATGCATATATTAAGCAGGG - Intergenic
1185721076 X:2381904-2381926 AGATGTGCAAATCTGCAGGAGGG + Intronic
1186018735 X:5229295-5229317 ATATATGTACATATGCAGCAGGG + Intergenic
1186135903 X:6520568-6520590 ATATATGTACATATGCAACATGG + Intergenic
1186370184 X:8938534-8938556 AAGTATGAAAATATGTTGCAAGG + Intergenic
1188948147 X:36334006-36334028 AAATATACAAATGTGCTGAAAGG + Intronic
1188968105 X:36579904-36579926 AAATTTGCAAATAGAGAGCAGGG + Intergenic
1190190612 X:48274052-48274074 AAATACAAAAATATGTAGCAGGG - Intronic
1190511642 X:51179150-51179172 ATATATGTATATATGTAGCAGGG + Intergenic
1191175399 X:57494855-57494877 AACTAAGCTAATAAGCAGCAAGG - Intergenic
1191913774 X:66180025-66180047 AAAAATACAAAAATGCAGAATGG - Intronic
1192493837 X:71599892-71599914 AAAACTTCAAATATGCAGTAAGG - Intronic
1193099368 X:77591499-77591521 AAATCTGAAGATATGTAGCAGGG - Intronic
1193173417 X:78363332-78363354 AAATATGTAGATATACATCATGG + Intergenic
1193315245 X:80057356-80057378 AAATGTGCACATATACACCATGG - Intergenic
1194044548 X:88986116-88986138 AAATGTGCACATATACACCATGG + Intergenic
1195129927 X:101841547-101841569 AAATATACATATCTGCAGGAAGG + Exonic
1195176297 X:102318237-102318259 AAATATACATATCTGCAGGAAGG - Exonic
1195182567 X:102368856-102368878 AAATATACATATCTGCAGGAAGG + Exonic
1195426628 X:104739817-104739839 AAATATCCAAATATACAAGATGG - Intronic
1195466499 X:105184319-105184341 AAAAAGGCAAATATTCAGGAAGG - Intronic
1195581948 X:106514923-106514945 AAATATGTAAATATGTAAAAAGG + Intergenic
1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG + Intronic
1196000460 X:110778880-110778902 AAATGTGCACATATACACCATGG + Intronic
1196154643 X:112414930-112414952 ATCTATGCAAATATCCAACAGGG - Intergenic
1196321504 X:114345912-114345934 AATAATGCAAATATGCAAAAAGG + Intergenic
1197328553 X:125124637-125124659 AAATATATACATATGCATCATGG - Intergenic
1197455072 X:126669390-126669412 AAATTTGAAAATATACATCAAGG + Intergenic
1197677486 X:129346344-129346366 AAATATGTAAATGTTCAGCTGGG + Intergenic
1198242357 X:134798295-134798317 ATATATGAAAATATGTTGCAAGG + Intronic
1199592641 X:149481676-149481698 AAATATGAAAGTATCCAGAAAGG - Intergenic
1200947183 Y:8855379-8855401 AAATTCTCAAATATGCGGCAGGG + Intergenic
1201330867 Y:12819395-12819417 AAAAATGCAAAAATTAAGCATGG + Intronic
1201502260 Y:14658029-14658051 AAATATGCAGATATGTTACAAGG + Intronic
1201629770 Y:16058010-16058032 AAATAATAAAATATGTAGCAAGG + Intergenic
1202585043 Y:26414481-26414503 AAATATTGAAGAATGCAGCAAGG + Intergenic