ID: 902241918

View in Genome Browser
Species Human (GRCh38)
Location 1:15095187-15095209
Sequence CGTGAGGTTCCCGCATTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 24}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902241918_902241927 6 Left 902241918 1:15095187-15095209 CCAACCAATGCGGGAACCTCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 902241927 1:15095216-15095238 CCAGCACTCCTCTGCCTTCCGGG 0: 1
1: 0
2: 7
3: 57
4: 492
902241918_902241925 5 Left 902241918 1:15095187-15095209 CCAACCAATGCGGGAACCTCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 902241925 1:15095215-15095237 CCCAGCACTCCTCTGCCTTCCGG 0: 1
1: 0
2: 8
3: 64
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902241918 Original CRISPR CGTGAGGTTCCCGCATTGGT TGG (reversed) Intronic
902241918 1:15095187-15095209 CGTGAGGTTCCCGCATTGGTTGG - Intronic
923243397 1:232107934-232107956 CATGAGGTTCCTGAAGTGGTAGG - Intergenic
1073083035 10:100871772-100871794 CTGGAGGTTCCTGCATTGGAGGG + Intergenic
1074949170 10:118312177-118312199 CTTGAGCTGTCCGCATTGGTGGG - Intronic
1081561579 11:44221842-44221864 CGTGAGTTTCAGGCAGTGGTTGG + Intronic
1082753912 11:57052927-57052949 CTTGAGATTCCTGAATTGGTGGG - Intergenic
1090855569 11:130607280-130607302 CTTGAGGCTCCCCCATTGCTAGG + Intergenic
1103235810 12:119371598-119371620 CCTGAGGTTTTCCCATTGGTGGG + Intronic
1119421304 14:74509412-74509434 GGTGAGGTTCCTGCATTGCCTGG - Intronic
1122415440 14:101547444-101547466 CGTGAGGTGCTCACATTGGCTGG - Intergenic
1142398345 16:89845754-89845776 GGTGAGGTTCCAGTTTTGGTCGG - Intronic
1149274757 17:55021130-55021152 TATGAGGTTCCAGCATTGTTTGG + Intronic
1151412460 17:73940455-73940477 TGTGAGGTCCCAGCACTGGTGGG + Intergenic
1165422714 19:35730300-35730322 AGTGAGGTGGCTGCATTGGTGGG - Intronic
1167427067 19:49434773-49434795 CGTGAGGATCCTGCAGGGGTTGG - Exonic
1167932501 19:52877606-52877628 CTTGAGGTTCCCGGTTTGGGAGG + Exonic
929923859 2:46193442-46193464 AGTGAGGATCCCTCATTGGGGGG - Intergenic
947329345 2:229012418-229012440 CATTAGGCTCCCGCATGGGTAGG - Intronic
1181630821 22:24150414-24150436 CGTGAGGGTCCCTCATGGGGTGG + Intronic
1182733049 22:32510736-32510758 GGTGAGGTTCCCCCATTAGAAGG - Intergenic
996578423 5:125001852-125001874 CTGGAGGTTCCAGCATTTGTTGG - Intergenic
1004886806 6:20059080-20059102 AGAGAGGTTCCCCCATGGGTGGG + Intergenic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1025251972 7:57357483-57357505 GGTGAAGTTCCCGCTTTCGTAGG + Intergenic
1046917681 8:119694284-119694306 CATGAGGTTCTTGTATTGGTTGG - Intergenic