ID: 902241925

View in Genome Browser
Species Human (GRCh38)
Location 1:15095215-15095237
Sequence CCCAGCACTCCTCTGCCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 8, 3: 64, 4: 504}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902241915_902241925 8 Left 902241915 1:15095184-15095206 CCCCCAACCAATGCGGGAACCTC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 902241925 1:15095215-15095237 CCCAGCACTCCTCTGCCTTCCGG 0: 1
1: 0
2: 8
3: 64
4: 504
902241908_902241925 27 Left 902241908 1:15095165-15095187 CCCCAAAGGCCCTAGTACACCCC 0: 1
1: 0
2: 0
3: 8
4: 70
Right 902241925 1:15095215-15095237 CCCAGCACTCCTCTGCCTTCCGG 0: 1
1: 0
2: 8
3: 64
4: 504
902241917_902241925 6 Left 902241917 1:15095186-15095208 CCCAACCAATGCGGGAACCTCAC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 902241925 1:15095215-15095237 CCCAGCACTCCTCTGCCTTCCGG 0: 1
1: 0
2: 8
3: 64
4: 504
902241912_902241925 17 Left 902241912 1:15095175-15095197 CCTAGTACACCCCCAACCAATGC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 902241925 1:15095215-15095237 CCCAGCACTCCTCTGCCTTCCGG 0: 1
1: 0
2: 8
3: 64
4: 504
902241916_902241925 7 Left 902241916 1:15095185-15095207 CCCCAACCAATGCGGGAACCTCA 0: 1
1: 0
2: 0
3: 5
4: 73
Right 902241925 1:15095215-15095237 CCCAGCACTCCTCTGCCTTCCGG 0: 1
1: 0
2: 8
3: 64
4: 504
902241910_902241925 25 Left 902241910 1:15095167-15095189 CCAAAGGCCCTAGTACACCCCCA 0: 1
1: 0
2: 0
3: 6
4: 102
Right 902241925 1:15095215-15095237 CCCAGCACTCCTCTGCCTTCCGG 0: 1
1: 0
2: 8
3: 64
4: 504
902241919_902241925 1 Left 902241919 1:15095191-15095213 CCAATGCGGGAACCTCACGAGCC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 902241925 1:15095215-15095237 CCCAGCACTCCTCTGCCTTCCGG 0: 1
1: 0
2: 8
3: 64
4: 504
902241911_902241925 18 Left 902241911 1:15095174-15095196 CCCTAGTACACCCCCAACCAATG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 902241925 1:15095215-15095237 CCCAGCACTCCTCTGCCTTCCGG 0: 1
1: 0
2: 8
3: 64
4: 504
902241909_902241925 26 Left 902241909 1:15095166-15095188 CCCAAAGGCCCTAGTACACCCCC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 902241925 1:15095215-15095237 CCCAGCACTCCTCTGCCTTCCGG 0: 1
1: 0
2: 8
3: 64
4: 504
902241918_902241925 5 Left 902241918 1:15095187-15095209 CCAACCAATGCGGGAACCTCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 902241925 1:15095215-15095237 CCCAGCACTCCTCTGCCTTCCGG 0: 1
1: 0
2: 8
3: 64
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902241925 Original CRISPR CCCAGCACTCCTCTGCCTTC CGG Intronic
900458375 1:2788235-2788257 CACAGAGTTCCTCTGCCTTCTGG - Intronic
900562096 1:3312290-3312312 CCCAGCACTCAGCGGCCTGCAGG + Intronic
901005144 1:6168069-6168091 CCCAGCCCTCCTCTGCGGCCGGG + Intronic
901327280 1:8374829-8374851 CTCAGCACTCTCCTGCCTGCTGG + Intronic
901797112 1:11686243-11686265 CTCCGCTCTCATCTGCCTTCTGG + Intronic
902041213 1:13493695-13493717 TCCAGCACTCCTCGGCTCTCAGG - Intronic
902241925 1:15095215-15095237 CCCAGCACTCCTCTGCCTTCCGG + Intronic
902799768 1:18821892-18821914 CCCAGGTCTCCTCTGCCTCCAGG - Intergenic
902877656 1:19350403-19350425 CCCAGCACTCTTCTGGCCTCTGG + Intronic
903122823 1:21227390-21227412 CCCAGCCTCCCTCTGGCTTCAGG - Intronic
903126407 1:21251191-21251213 ACCAGCACGCCACTGCCTTCAGG - Intronic
903293532 1:22329427-22329449 CCGAGACCTCCTCGGCCTTCAGG + Intergenic
903682221 1:25104636-25104658 CCCACAACCCCTCTTCCTTCAGG - Intergenic
904160097 1:28516877-28516899 CAAAGCACTCCCCTGTCTTCAGG - Intronic
904944384 1:34188718-34188740 CCCAGCCCTCCTCCACCCTCCGG - Intronic
904953315 1:34262090-34262112 CCCATAATTCCTCCGCCTTCTGG - Intergenic
905083786 1:35350660-35350682 CCCAGCACTGCTGGGCCTGCAGG + Intronic
905852205 1:41282778-41282800 CCCAACCCTCCTCTGCCTCGGGG - Intergenic
906087867 1:43151475-43151497 CCCAGAACTCCACTGCCTGATGG - Intronic
906798133 1:48713574-48713596 CCTAGCAGTCCTCTGCGTACGGG + Intronic
907261633 1:53222588-53222610 CCCAGTACTGTGCTGCCTTCAGG + Intergenic
908027687 1:59969661-59969683 CCCAGCACTCCTCAGCCCTTGGG + Intergenic
908041223 1:60115903-60115925 CACAGTATTCCTGTGCCTTCTGG + Intergenic
908634924 1:66153177-66153199 CCCTGCAGTTCTCTGCCTTTTGG + Intronic
908686910 1:66730906-66730928 CTCAGCTCTACTCTGCCTCCTGG + Intronic
909225485 1:73015314-73015336 ACAAGCAATGCTCTGCCTTCTGG + Intergenic
909335300 1:74465622-74465644 GCCTGCACTCCTCAGCCTTTGGG - Intronic
909550707 1:76896021-76896043 CCTTACAGTCCTCTGCCTTCAGG - Intronic
909782219 1:79561525-79561547 CCCTGCACTCCTCAGCCCTTGGG + Intergenic
910757223 1:90706590-90706612 CCCCGCGCTCCTCCACCTTCAGG - Intergenic
912448866 1:109757730-109757752 CCCAGTAATCCTCTGCTGTCTGG - Intronic
913120959 1:115740365-115740387 CCCATCCCTCCTCTCTCTTCAGG + Intronic
914172219 1:145235233-145235255 CCAAACACTCCTCTTCCTCCAGG + Intergenic
914685896 1:149978886-149978908 CCCACCAATCCCCTGCCTTTTGG + Intronic
914756175 1:150562654-150562676 CCCCACATTCCTCTGCCCTCAGG - Intergenic
914808550 1:151009282-151009304 ACCAGCATTCCTTTGCCTCCAGG + Intronic
914870926 1:151473319-151473341 CCCAGCCCTTCTCTGGCCTCGGG + Intergenic
915439049 1:155933009-155933031 ACCTGAACTCCTCTGACTTCAGG + Intronic
917568960 1:176244010-176244032 CCCATCACTTCTCAGCCTTTTGG - Intergenic
917981319 1:180271542-180271564 GCCAGCACTCCTGTGCCCTCCGG + Intronic
918053325 1:180994659-180994681 CCCTGCACTCTTCTGGCCTCAGG - Intronic
918688978 1:187456774-187456796 TCCAGCTCTCCCTTGCCTTCAGG + Intergenic
918985565 1:191621167-191621189 CCTATCACTTCTTTGCCTTCTGG + Intergenic
919008572 1:191929905-191929927 CCCAGCACTGTGCTGGCTTCAGG + Intergenic
919988445 1:202692021-202692043 CCCAGCACTCCACTCACATCTGG + Intronic
920684154 1:208096321-208096343 CCCAGACTTCCTCTGCCTGCAGG + Intronic
920797931 1:209158560-209158582 CCCAGCAGTCCTCCAGCTTCAGG + Intergenic
921049282 1:211499603-211499625 CTCATCCCTCCTCTGCCTACAGG + Intergenic
921555721 1:216596513-216596535 CCCTGCACTCCCAAGCCTTCAGG - Intronic
921888399 1:220329291-220329313 TCCAGCACACCTCTGCCTTTGGG + Intergenic
922053869 1:222021706-222021728 CTCAGCTCTCCTCTGCTTTCTGG + Intergenic
922056892 1:222050110-222050132 GCCTGCACTCCTCAGCCCTCAGG - Intergenic
922575202 1:226656452-226656474 CCCAGCACAGCTGTGGCTTCCGG - Intronic
923034404 1:230274409-230274431 CATAGCACGCCTCTGACTTCTGG + Intronic
924334984 1:242978546-242978568 ACCACCACTCCTCTTCCGTCAGG + Intergenic
924434901 1:244030611-244030633 TTCAGCCCTCCTGTGCCTTCTGG - Intergenic
924649007 1:245905763-245905785 CCCAGCACTGTGCTGGCTTCAGG + Intronic
1063413723 10:5856553-5856575 CCCGGCTCTCCCTTGCCTTCAGG - Intergenic
1065694822 10:28370151-28370173 CACAGCACTGCACTCCCTTCTGG + Intergenic
1065804854 10:29384828-29384850 CCCAGCAAGCCTCTGTCTGCTGG - Intergenic
1065944285 10:30592954-30592976 CCCAGCAAGCCTCTGCCTCCTGG + Intergenic
1066235394 10:33480464-33480486 CCCGGCACTCCTCAGCCCTTGGG + Intergenic
1067217185 10:44312964-44312986 CCCAGCACTCCTCCACCTCAAGG - Intergenic
1067539124 10:47138847-47138869 CCCAGCCCCCCTCTGTCTCCAGG - Intergenic
1067687135 10:48472588-48472610 CCCAGGAAGCCTCTACCTTCTGG + Intronic
1068500415 10:57835818-57835840 CCCAGAAAACCTTTGCCTTCTGG - Intergenic
1069215289 10:65812090-65812112 CCCCGCACTCCTCAGCCCTTGGG + Intergenic
1069817612 10:71208654-71208676 CACAGAAAACCTCTGCCTTCTGG + Intergenic
1070746357 10:78936220-78936242 CCCAGTACTCCCCAGCGTTCAGG - Intergenic
1070782661 10:79146652-79146674 CCCAGCAGACATCTGCCCTCTGG + Intronic
1071078781 10:81784582-81784604 ACCAGCACTCCTCAGCCCTTCGG - Intergenic
1071372424 10:84966000-84966022 CACAGGACTCCCCTTCCTTCAGG + Intergenic
1071372690 10:84968628-84968650 CACAGGACTCCCCTTCCTTCAGG + Intergenic
1071589800 10:86862186-86862208 CCTAGCACTCCTCTCCTTTCTGG - Intronic
1072647390 10:97267588-97267610 TGCAGCACACCTCTGCCTTGAGG + Intronic
1073429307 10:103476159-103476181 TCCAGCACTTCCCTGCCTCCTGG + Intronic
1074314762 10:112350967-112350989 CCCCACACAACTCTGCCTTCTGG - Intergenic
1074408557 10:113202230-113202252 CACAGCACTGCTTTCCCTTCAGG - Intergenic
1074862793 10:117524988-117525010 CCTAGAACTCCTGTGACTTCAGG + Intergenic
1074864648 10:117537683-117537705 CCCAGCGCTCCCCCGCCCTCGGG + Intergenic
1075632524 10:124009796-124009818 CCCTGCCCGCCTCCGCCTTCTGG - Exonic
1075717721 10:124566639-124566661 ACCAGCACACGTCTGCCTTTTGG + Intronic
1075887607 10:125915002-125915024 TCCAGCACTCCTATTCCTTGAGG + Intronic
1076220843 10:128731967-128731989 CCCCACACTCCTCTGCCTTCTGG + Intergenic
1076242249 10:128917234-128917256 CCCAGGACTCCTCTGGAGTCGGG - Intergenic
1076263860 10:129093809-129093831 CCCAGCACACCTGTGTGTTCAGG - Intergenic
1076438642 10:130463870-130463892 GCCAGCTCTCCCTTGCCTTCAGG + Intergenic
1076599000 10:131645169-131645191 GCCAGCACAGCCCTGCCTTCAGG + Intergenic
1076703791 10:132290165-132290187 CCCAGCCCTGCTCTCCTTTCTGG - Intronic
1077583737 11:3434981-3435003 ACCAGCACTCCTCAGCCCTTGGG + Intergenic
1077609145 11:3633623-3633645 CCCAGAGCTCGTCTGCCTTGGGG + Intergenic
1078614381 11:12851723-12851745 CTCAGCTCACCTCTGCCTCCTGG - Intronic
1078935505 11:15945879-15945901 CCCAGCAGGCCTTGGCCTTCAGG + Intergenic
1079032975 11:16999328-16999350 CCAGGCCCTCCTCTGCCTGCAGG + Intronic
1080107437 11:28525793-28525815 ACCCGCACTCCTCAGCCTTTGGG + Intergenic
1081234832 11:40635094-40635116 CCCAACACTCCTATACCTCCAGG + Intronic
1081305348 11:41505133-41505155 CTCACCACACCTCTGCCTCCTGG + Intergenic
1081590314 11:44418269-44418291 CCAAGCACGCTTCTGCCTTGGGG - Intergenic
1081783536 11:45730305-45730327 GCCAGTACTCCTTTGCCTTGAGG - Intergenic
1081907253 11:46677873-46677895 CTCGGCACACCTCCGCCTTCTGG - Exonic
1082014372 11:47473470-47473492 CCCAACACTCCTCCTCCTGCGGG - Intronic
1083347028 11:62000980-62001002 CCCAGGACTCCTCTACATGCAGG + Intergenic
1083418539 11:62540708-62540730 CCAAGCAGTCTTCTGCCTTAGGG - Intronic
1083421675 11:62556745-62556767 CTCAGCCTTCCTCTGCCTGCAGG - Intergenic
1083711035 11:64548452-64548474 TCCAGGACTTCTCTGGCTTCAGG - Intergenic
1083727009 11:64633937-64633959 CCCAGCTCTGCTCTGCCCACAGG + Intronic
1083901688 11:65646473-65646495 CCCAGGACACCCCTGCCTTCGGG + Exonic
1084496292 11:69505600-69505622 CCCAGGATGCCTCTGCCATCAGG + Intergenic
1084594892 11:70110988-70111010 GCCAGCATTCCACTGCCTCCAGG + Intronic
1084831789 11:71775059-71775081 GCCAGCACTCCTCAGCCCTTAGG - Intergenic
1085194633 11:74661633-74661655 CCCAGCACTGTGCTGGCTTCAGG - Intronic
1085465747 11:76722188-76722210 CCCCTCACCCCTCTGCCTCCTGG + Intergenic
1085538854 11:77247149-77247171 CCTAGCAATGATCTGCCTTCTGG - Intronic
1086416134 11:86590581-86590603 CCCAAATCTCCTCTGCCTTGAGG - Intronic
1086515790 11:87611764-87611786 CCATGTGCTCCTCTGCCTTCTGG - Intergenic
1087441118 11:98185211-98185233 ACCAGCACTCCTCAGCCTTTGGG + Intergenic
1088024175 11:105157468-105157490 TCCAGCACTTTTCTGCCCTCAGG - Intergenic
1088570037 11:111213778-111213800 CCCAGCACTGTGCTGGCTTCAGG + Intergenic
1089069735 11:115690048-115690070 CCCAGCAATCCACTGCCTCCAGG - Intergenic
1089387871 11:118079774-118079796 CCCAGCACCCCGCTGCCCGCAGG - Intronic
1089648766 11:119897921-119897943 GCAATCACTCCTCTGCCTCCAGG - Intergenic
1089893277 11:121902410-121902432 CCCATCACTCCTGTGCCGTCGGG - Intergenic
1090583296 11:128183104-128183126 CCTGTCACTCTTCTGCCTTCCGG - Intergenic
1090941679 11:131393043-131393065 CACACCACTCCCCTGCCGTCAGG + Intronic
1091213740 11:133886775-133886797 CAGTGCACTCCTGTGCCTTCTGG + Intergenic
1091794819 12:3292065-3292087 CCCCGCTCTCCTGTGTCTTCAGG - Intergenic
1091826809 12:3519014-3519036 GCCGGCTCTCCCCTGCCTTCAGG - Intronic
1092248183 12:6875393-6875415 CTCAGCTCACCTCTGCCTCCTGG + Intronic
1092754876 12:11753753-11753775 CCCAGCAACCGTCTGCCCTCTGG - Intronic
1092944039 12:13436662-13436684 CCCAGGACTCCTCTCCCTCCTGG - Intergenic
1092967029 12:13654088-13654110 CACAGCATTCCTCTGCTTTTGGG - Intronic
1093921736 12:24866464-24866486 ACCCGCACTCCTCAGCCCTCGGG - Intronic
1095883189 12:47161069-47161091 GCCAGCATTCATCTGGCTTCTGG - Intronic
1096219506 12:49820239-49820261 CCCAGCACTCCTCCCCGTGCAGG - Intronic
1097195899 12:57242423-57242445 CCCATCACACCTCAGCCTTCTGG + Intergenic
1099081217 12:78183988-78184010 TCTAGCATTCCTCAGCCTTCTGG + Intronic
1099443883 12:82729087-82729109 GCCAGCACTCCTCAGCCCTTGGG - Intronic
1100142411 12:91634315-91634337 CCCTGCACTCCTCAGCCCTTGGG - Intergenic
1102181148 12:110913255-110913277 TTCAGCACCCCTTTGCCTTCAGG + Exonic
1103360665 12:120351549-120351571 CCTTGCCCTCCCCTGCCTTCTGG - Intronic
1103379186 12:120480619-120480641 CCAAGGCCTCCTCAGCCTTCAGG + Intronic
1103413346 12:120728021-120728043 CACTGCACCCCTCTGCCTCCTGG + Intronic
1103518782 12:121524197-121524219 CCCTCCACTCCCCTCCCTTCTGG + Intronic
1103755648 12:123204510-123204532 CCCATCACTTCTCAGCCTTTTGG + Intronic
1103760809 12:123249317-123249339 CCCCGCACTCCTCAGCCCTTGGG + Intronic
1103775177 12:123362062-123362084 CACTGCATTCCTCTGCCTCCTGG - Intronic
1103907543 12:124335280-124335302 ACCAGCTCTGCTCTGCCTGCAGG - Exonic
1104421666 12:128641159-128641181 CCCAGGCCTCCTCAGCCTTCAGG + Intronic
1105023416 12:132833157-132833179 CCCAGCACTATTCTGCGTGCGGG + Intronic
1106925338 13:34607526-34607548 TCCAGAGCTCCTCTGGCTTCTGG + Intergenic
1109110952 13:58318531-58318553 GCCAGCACTCCTCAGCCCTTGGG + Intergenic
1110497915 13:76190454-76190476 GCCCGCACTCCTCAGCCCTCGGG - Intergenic
1114602093 14:23965308-23965330 TCTAGCACTTCTCTGGCTTCTGG - Intronic
1114606265 14:24000423-24000445 TCTAGCACTTCTCTGGCTTCTGG - Intronic
1115151254 14:30288286-30288308 ACCACCACTCCTCTGCTCTCTGG + Intergenic
1115475038 14:33805350-33805372 ACAAGCACCCCTCTGCCTTGTGG - Intergenic
1117018566 14:51545605-51545627 ACCAGCACACCACTGCCTCCCGG + Intronic
1117727279 14:58687267-58687289 GCCTGCACTCCTCAGCCTTTGGG + Intergenic
1118852580 14:69595466-69595488 CCGAGGACTCCTGTGCCCTCTGG + Intergenic
1118932484 14:70255207-70255229 GCCAGCAGTCCTCAGCCTTCGGG - Intergenic
1119615549 14:76096526-76096548 GCCATCACTCCTCTGCCTATCGG - Intergenic
1119911296 14:78352010-78352032 CACTGCAATCCTCTGCCTCCCGG - Intronic
1121438535 14:93934399-93934421 CCCAGACCTTCTCTACCTTCAGG - Exonic
1121600517 14:95199824-95199846 CCAGGCTCTCCTCTGCCTCCAGG - Intronic
1122809651 14:104281656-104281678 CCAAGCACTGCTGTCCCTTCAGG - Intergenic
1122977988 14:105178853-105178875 CCCAGGACGCCTTTGCCTCCCGG - Intronic
1123010617 14:105347961-105347983 TCCAGCACTCCTGTGGCCTCAGG + Intronic
1123432007 15:20225980-20226002 ACCAGGGCTCCTTTGCCTTCTGG + Intergenic
1123799206 15:23803278-23803300 GCCAGCACTCCTCAGCCCTTGGG - Intergenic
1124146884 15:27136093-27136115 CCTACCACTACTCTTCCTTCAGG - Intronic
1125359591 15:38850872-38850894 CACTGCAATCCTCTGCCTCCCGG - Intergenic
1126128146 15:45314457-45314479 CCCTGCACTCCTCAGCCCTTGGG - Intergenic
1126359000 15:47826348-47826370 ACCAGCACACCACTGCATTCGGG - Intergenic
1126531247 15:49713400-49713422 CCCATCACTCCTCTGCCCTCTGG + Intergenic
1127035288 15:54908999-54909021 CCCAGCACTACACTGGCTTCAGG + Intergenic
1128330269 15:66751072-66751094 CCCAGCAAGCCCCTGCCTTTTGG + Intronic
1129243694 15:74267336-74267358 CCCAACTCTCCTGGGCCTTCTGG - Intronic
1129641848 15:77387927-77387949 ACCAACTCTCCTCTGACTTCTGG - Intronic
1129831315 15:78672779-78672801 GCCAGCTCTCCTTTGCCTTCAGG - Intronic
1130400246 15:83545977-83545999 CCCAGTACTGTTCTGGCTTCAGG - Intronic
1130585457 15:85177434-85177456 GCCAGCTCTCCCTTGCCTTCAGG - Intergenic
1130902962 15:88220757-88220779 GCCAGCATTCCTCTGGCTTGAGG - Intronic
1131030951 15:89185587-89185609 GCCAGGACTCCTGTTCCTTCAGG + Intronic
1132590558 16:724574-724596 CCCGGCACTGCTCAGCCTGCTGG - Intronic
1132801629 16:1757578-1757600 CCCAGCCCTCCTCTGCTTTCTGG + Intronic
1133209960 16:4258025-4258047 CCCAGCCCTCCTCTCCCTTCTGG - Exonic
1133305674 16:4806879-4806901 GCCAGCTCTGCTCTGCCTCCCGG + Intronic
1134297731 16:12961730-12961752 CACTGAACTCCTGTGCCTTCTGG - Intronic
1134361676 16:13536574-13536596 CCCAGCACTTCTCGGCATTGCGG + Intergenic
1134512922 16:14863416-14863438 CCAGTCACTCCTCTACCTTCAGG + Intronic
1134700560 16:16261905-16261927 CCAGTCACTCCTCTACCTTCAGG + Intronic
1134971266 16:18532754-18532776 CCAGTCACTCCTCTACCTTCAGG - Intronic
1135092354 16:19528659-19528681 TCAAGCAATCCTCTTCCTTCCGG - Intronic
1135743725 16:24998253-24998275 CTCAGCCCTCCCCTTCCTTCTGG - Intronic
1136333329 16:29595612-29595634 CCCAGCCCTCCGGTGCTTTCCGG - Intergenic
1136593062 16:31229306-31229328 CCAAACACTCCTGTGCCTTCCGG + Intergenic
1136630125 16:31485079-31485101 CCCTGCACCCCTCTGCTTCCTGG - Intronic
1136852631 16:33625159-33625181 ACCAGGGCTCCTTTGCCTTCTGG - Intergenic
1137509294 16:49084426-49084448 CCCAGTAATCCTCTGCCATATGG + Intergenic
1137540758 16:49360084-49360106 CCCAACCCTCCGCTGCCCTCAGG - Intergenic
1138863114 16:60783331-60783353 TCAAGCAATCCTCTGACTTCAGG - Intergenic
1138889808 16:61128751-61128773 CCCGGCACTCCTCAGCCCTTGGG + Intergenic
1139125476 16:64072324-64072346 GCCCGCACTCCTCTGCCCTTGGG + Intergenic
1139510644 16:67426611-67426633 CCAAGCTCTCCTTTGCCCTCAGG + Intergenic
1139514285 16:67444238-67444260 CTCAGCCCTCCTCTGCACTCTGG + Intronic
1140258542 16:73357656-73357678 CCTACCACTCCTCTGTCTGCTGG - Intergenic
1140516779 16:75548944-75548966 CCCATCACTTCACTTCCTTCAGG - Intronic
1140661837 16:77196054-77196076 CCCAGCACTCCTCAGACTACAGG + Intronic
1203114235 16_KI270728v1_random:1473627-1473649 ACCAGGGCTCCTTTGCCTTCTGG - Intergenic
1143416985 17:6757437-6757459 CCCAAGTCTCCCCTGCCTTCAGG - Intronic
1143823876 17:9588403-9588425 GCCAGCTCTACCCTGCCTTCAGG - Intronic
1144108481 17:12008592-12008614 ACCTTGACTCCTCTGCCTTCTGG - Intergenic
1144471225 17:15543181-15543203 CACATCACACCTGTGCCTTCAGG + Intronic
1144713296 17:17417219-17417241 CCCAGCACTCCTCGACCCTCTGG - Intergenic
1145004416 17:19329281-19329303 GCCAGCACCCCTTTGCCTTTTGG + Intronic
1145094900 17:20016789-20016811 GCCCGCACTCCTCAGCCCTCTGG - Intronic
1145785678 17:27592435-27592457 CCTTCCTCTCCTCTGCCTTCTGG + Intronic
1146150343 17:30463156-30463178 CCCAACACTTCTCTTTCTTCAGG + Intronic
1146443601 17:32918002-32918024 CCATTCACTCCTTTGCCTTCAGG - Intergenic
1146759973 17:35468664-35468686 CCCCGCACTCCTATGCCTGAAGG + Intronic
1147161392 17:38571432-38571454 CCCAGCACTGCTCAGCCTTCTGG + Intronic
1147798690 17:43065787-43065809 CCATGCACTCGTCTGCTTTCTGG + Intronic
1148203350 17:45764384-45764406 TCCAGCTCTGCTCTGCCTTGAGG + Intergenic
1149621775 17:58050647-58050669 TCCAGCCCTCCTCCGCCTCCAGG - Intergenic
1150135528 17:62693008-62693030 TCCATCACTCCTGTGCCTGCTGG + Exonic
1150442501 17:65202816-65202838 CCCAACACTCCTCCCCCTACAGG + Intronic
1150706329 17:67490584-67490606 CCCAGCAGTCCCCTGCCTGCGGG - Intronic
1150804547 17:68308908-68308930 GCCTGCACTCCTCAGCCTTTGGG + Intronic
1151562746 17:74879388-74879410 CCCAGCCCTCGACTACCTTCAGG + Exonic
1151795715 17:76344017-76344039 CTCAGCTCACCTCTGCCTCCTGG + Intronic
1151912839 17:77095403-77095425 CCCAGGAATCCTCCACCTTCAGG + Intronic
1152117563 17:78397995-78398017 GGCAGCACGCCTCTGCCTGCAGG + Intronic
1153687953 18:7565927-7565949 ACCAACACTCCTCTTACTTCAGG - Intergenic
1153817350 18:8801900-8801922 CACAGAAGTCCTCTGCCCTCTGG - Intronic
1153868777 18:9297301-9297323 GCCTGCACTCCTCAGCCCTCGGG - Intergenic
1154255245 18:12776842-12776864 GCCCGCACTCCTCAGCCTTTGGG + Intergenic
1154294053 18:13134681-13134703 CCCCGCACTCCTCAGCCCTTGGG + Intergenic
1155611647 18:27673885-27673907 CCCCGCACTCCTCAGCCCTTGGG + Intergenic
1155785894 18:29899079-29899101 TCCAGCACTCCTCAGCCCTTGGG + Intergenic
1156150375 18:34234208-34234230 GCCCGCACTCCTCAGCCTTTGGG - Intergenic
1158156837 18:54435515-54435537 GTCAGCTCTCCTCTGCCTTGTGG + Intergenic
1159609917 18:70513696-70513718 GCCGGCTCTCCCCTGCCTTCAGG + Intergenic
1159685751 18:71418073-71418095 CCCTCCACACCTCTGCTTTCAGG + Intergenic
1159923342 18:74246533-74246555 CCCAGCACACTTCTTCCTGCTGG + Intergenic
1159974910 18:74699379-74699401 CCCAGCACTCCCCTAAATTCTGG - Intronic
1160387914 18:78508123-78508145 CACACCAGTCCTCTGCCTTCAGG - Intergenic
1160627912 18:80225544-80225566 CCCAGCTCACCTCCCCCTTCAGG + Intronic
1161627729 19:5336973-5336995 CCCAGCTCTCCTCTGCATCCAGG - Intronic
1161730566 19:5958128-5958150 CCCAGCACACCTGTGCCTCCAGG - Intronic
1162308684 19:9891547-9891569 CTCAGCTCACCTCTGCCTCCCGG - Intronic
1162508762 19:11104295-11104317 CCCAGCAAGCCTTTGTCTTCTGG + Intronic
1162833335 19:13300350-13300372 CCCAGCACTGTTCTAACTTCTGG - Intronic
1163811626 19:19436209-19436231 CCAAGCACTCACCTGGCTTCGGG - Intronic
1165266983 19:34668510-34668532 ACCAGCACTCCTCAGCCCTTGGG - Intronic
1165334910 19:35162869-35162891 CTCAGCACTCTTCCTCCTTCTGG - Intronic
1167455787 19:49596283-49596305 CCCAGCCCTCCTCGGACCTCAGG + Exonic
1167702862 19:51060655-51060677 CCCAGGGCTCCTCTGCCCCCTGG - Intronic
1167766291 19:51484965-51484987 CCCAGGTGTCCTCTTCCTTCAGG + Exonic
1167859851 19:52273801-52273823 CCCAGCACACCCCCACCTTCTGG - Intronic
1168571451 19:57474421-57474443 ACCAGCATTTCTCTGCTTTCAGG - Exonic
924977418 2:191354-191376 CCCAGCACTCCTCAGCCTTTGGG + Intergenic
925294888 2:2769756-2769778 GCCAGCACTCATCTCCCCTCCGG - Intergenic
925305625 2:2846405-2846427 CCCAGCAAGCCTCAGCCTGCAGG - Intergenic
925395160 2:3528419-3528441 CCCAGCGCTCCTCAGCCCGCGGG + Intergenic
925747254 2:7054064-7054086 GCCGGCTCTCCCCTGCCTTCAGG - Intronic
927033218 2:19144184-19144206 CTCAGCATTCCTCTGCATTTTGG - Intergenic
927871913 2:26629251-26629273 CCTTGCACTCCTCTGCCTGGAGG + Intronic
929933283 2:46275146-46275168 CCCAGCATACCTCTGCCCCCAGG - Intergenic
930048283 2:47193018-47193040 CACAGCACCCCTCCTCCTTCTGG + Intergenic
930107884 2:47654408-47654430 ACCGGCTCTCCCCTGCCTTCAGG + Intergenic
930224415 2:48777697-48777719 CACAGCAATTCTCTGCCTACTGG - Intergenic
930249136 2:49015859-49015881 CCCAGCAGTCCTCTGAGTGCGGG + Intronic
930605222 2:53486395-53486417 CCTGGCACTCCTCAGCCCTCGGG - Intergenic
931275933 2:60743966-60743988 ACCAGCTCTCCTTTGCCTTCAGG + Intergenic
931276290 2:60746505-60746527 GCCGGCTCTCCTTTGCCTTCAGG + Intergenic
932304541 2:70692599-70692621 CCCCGCACTCCTCTCCCAGCTGG + Intronic
932566797 2:72916023-72916045 CCCAGCACTCCTCCGCGTCCTGG - Intergenic
933060779 2:77734775-77734797 GCCAGCACTCCTCAGCCCTTGGG + Intergenic
933387941 2:81634929-81634951 CCCAGCACTGTACTGACTTCTGG + Intergenic
934577046 2:95409381-95409403 TTCAGCACACCTCTGCCTCCTGG + Intronic
934855551 2:97727233-97727255 CCCTGCATTCCTCTCCCTTAAGG - Intronic
936229315 2:110686042-110686064 CCAAGCCTTCCTCTGCCTTCAGG + Intergenic
936789956 2:116139801-116139823 CCCAGCACCACTGTGCCCTCTGG - Intergenic
936867566 2:117092600-117092622 CCTAGGCCTCCCCTGCCTTCAGG - Intergenic
937266049 2:120615221-120615243 CCCTGCCCTCCTCTTCCTGCAGG + Intergenic
939497446 2:142941077-142941099 CCCAGCCCTCCTCTCCCTCTGGG + Intronic
941309309 2:163909888-163909910 GCCCGCACTCCTCAGCCTTTGGG - Intergenic
941476526 2:165957059-165957081 GCCCGCACTCCTCAGCCTTTGGG + Intergenic
942136980 2:172935442-172935464 CCCATCATTCCTCCTCCTTCTGG - Intronic
943345755 2:186735004-186735026 CCCAGCATCCCTCTGCTCTCAGG - Intronic
943494686 2:188606390-188606412 CCCCGCACTCCTCAGCCCTTGGG + Intergenic
943912115 2:193582644-193582666 ACCACCTATCCTCTGCCTTCTGG + Intergenic
943961101 2:194264813-194264835 CCCAGCACCCCTGTGCCCTTGGG + Intergenic
944482853 2:200175103-200175125 CCCGGCACTCCTCAGCCCTTGGG - Intergenic
944652244 2:201842802-201842824 CCCAGCACATCTCTCCCTTCTGG + Intronic
945069693 2:205977549-205977571 GCCAGCACTCCTCAGCCCTTGGG - Intergenic
945286983 2:208092766-208092788 TTCAGCTTTCCTCTGCCTTCTGG + Intergenic
946302410 2:218831934-218831956 CCCAGCAACCCCCAGCCTTCAGG - Intronic
946314140 2:218898279-218898301 CCCATCCCTCCTCCGCCTGCGGG + Intronic
946335888 2:219036196-219036218 CCCACCCATCCCCTGCCTTCTGG + Intronic
946368515 2:219266128-219266150 CCCTGCACTCCCCTGCCCTAGGG - Intronic
946376559 2:219313141-219313163 GCCCGCACTCCTCAGCCTTTGGG - Intergenic
947111253 2:226721635-226721657 CCCAGCCCCCCACTGCCATCTGG - Intergenic
947323553 2:228949453-228949475 CACAGCACTCATTTGCCATCTGG - Intronic
947663956 2:231891320-231891342 GCCAGCTCTCCACTGCCTTCAGG - Intergenic
948349830 2:237330319-237330341 CCCAGCACACCCATGCTTTCAGG + Intronic
948564014 2:238872104-238872126 CCCAGGAGTCACCTGCCTTCCGG - Intronic
948870439 2:240795263-240795285 CCCAGAACTCCAATGTCTTCAGG + Intronic
949047120 2:241877323-241877345 CCCAGCCCACCCCTGCCATCGGG + Intergenic
1168939854 20:1699995-1700017 CATATCACTCCTCTGCCTTCTGG - Intergenic
1169313431 20:4567983-4568005 CCCACCACTCCCTTGGCTTCTGG - Intergenic
1169332239 20:4725034-4725056 GCCAGTGCTCCTCTGCCTTCTGG + Exonic
1169671481 20:8107328-8107350 CCCAGCACACCACTGCCTTATGG + Intergenic
1170572131 20:17638385-17638407 CTCAGCCCTCCTCTGCCACCTGG + Intronic
1170841137 20:19925064-19925086 CTCACCACTCCTCAGCCTTTGGG + Intronic
1172108152 20:32528727-32528749 CCCAGCAGTCCGTTCCCTTCCGG - Intronic
1172902039 20:38342457-38342479 CCCAGCCCTCATCTGCATTTGGG + Intergenic
1173190592 20:40872760-40872782 CCCAGCACACAGCTGCCTCCTGG + Intergenic
1173850806 20:46216554-46216576 CCCAGACCTCCTCTTGCTTCCGG - Intronic
1175156112 20:56972762-56972784 CCCCGGGCCCCTCTGCCTTCTGG - Intergenic
1176044031 20:63083221-63083243 CCCTACACTCCTCCTCCTTCCGG + Intergenic
1176133727 20:63509313-63509335 GCAACCACTCATCTGCCTTCTGG + Intergenic
1176176306 20:63727314-63727336 CACTGCAACCCTCTGCCTTCTGG + Intronic
1176246935 20:64101990-64102012 CCCAGCCCACCTCTGCTGTCGGG + Intergenic
1178305054 21:31484450-31484472 CCCAGCTTGCCTCTGCCTCCGGG + Intronic
1179022923 21:37656377-37656399 ACCAGCTCTCCTCTCCCTGCTGG + Intronic
1179359367 21:40691135-40691157 TCCAGTTCTCCTCTTCCTTCAGG + Intronic
1180155811 21:45977055-45977077 CCCTGCCCTCCCCTGCCTCCCGG + Intergenic
1180915075 22:19480093-19480115 CCCGGCCCTCCCCTGCCTCCCGG - Intronic
1181048265 22:20226855-20226877 TCCAGCCCTCCCTTGCCTTCCGG + Intergenic
1181319784 22:21995392-21995414 CCCAGCACCCCTCAGCCTCTTGG - Intergenic
1181594521 22:23905762-23905784 CCCAGCCCTCCCGTGCCTACTGG + Intergenic
1182442905 22:30374508-30374530 CCTAGCACTCCTATGCCATGGGG - Exonic
1182621538 22:31621260-31621282 CCCAGCATTCCCCTCCCTCCCGG + Intronic
1183362659 22:37390742-37390764 CCCGCCACCCCTCTCCCTTCTGG + Intronic
1183723153 22:39573815-39573837 ACCAGTACTCCTCTCCCTCCTGG - Intronic
1184280206 22:43433133-43433155 CCCACCACTCTTCTGTCCTCTGG - Intronic
1184735963 22:46398017-46398039 CCCAGCCCTCCACTGCACTCCGG - Intronic
1185157856 22:49205053-49205075 CCCATTACTCCACTGCCTTCAGG - Intergenic
949514690 3:4796418-4796440 CCACGCACTCCTCTGCTGTCTGG - Intronic
950068896 3:10136431-10136453 ACCTGCACTCCTCAGCCCTCAGG + Intergenic
950385237 3:12653668-12653690 CTCAGCTCTCCTCTGCCTCCTGG - Intronic
952076363 3:29701904-29701926 GCCTGCACTCCTCAGCCTTTGGG - Intronic
952593704 3:34988742-34988764 GCCAGCACTCCTCAGCCCTTGGG - Intergenic
952713374 3:36453667-36453689 GCCAGCACTCCTCAGCCCTTGGG - Intronic
952719642 3:36519033-36519055 CCCATGACCCCTCTTCCTTCTGG - Intronic
952960093 3:38583575-38583597 CTCTGCACTCCTCTGGCCTCTGG + Intronic
953791803 3:45953224-45953246 CCTAGCTCTCCTCTGAATTCTGG + Intronic
954427888 3:50453212-50453234 CTCAGCTCTCCTCTTCCTCCAGG + Intronic
955137069 3:56229938-56229960 CTCAGCTCACCTCCGCCTTCTGG + Intronic
955314011 3:57920193-57920215 GCCAGTAATCTTCTGCCTTCTGG + Intronic
956727601 3:72169262-72169284 CCCATCCCTCCTCTACCTTCAGG + Intergenic
957002207 3:74899972-74899994 CCCCGCACTCCTCAGCCCTTGGG + Intergenic
957475247 3:80713883-80713905 CTCACCACGCCTCTGCCTTCTGG - Intergenic
957796772 3:85019246-85019268 TCAAGCAATCCTCTTCCTTCAGG - Intronic
957976089 3:87447277-87447299 CCCAGTACTGCACTGGCTTCAGG - Intergenic
959141573 3:102492472-102492494 GCCTGCACTCCTCAGCCTTTGGG + Intergenic
959798031 3:110456608-110456630 CCCAGCACTATACTGACTTCAGG - Intergenic
960162166 3:114362152-114362174 CCCAACACTCCTCAACATTCAGG - Intronic
960669268 3:120140613-120140635 GCCAGCACTCCTCAGCCCTTGGG - Intergenic
960871492 3:122254230-122254252 CCTGGCACACCTCTGCCTACGGG + Exonic
961327773 3:126119525-126119547 TCCACCACTCCCCTGCCTCCAGG + Intronic
962587824 3:136860607-136860629 ACCAGCTCTCCTTTGCCTTCTGG - Intergenic
962969592 3:140386568-140386590 GCCAGCTCTCCCCTGCCTTCAGG + Intronic
963575798 3:147059527-147059549 CCAATCACTCCTAGGCCTTCAGG - Intergenic
963844404 3:150140823-150140845 GCCAGCTCTCCCTTGCCTTCAGG + Intergenic
964646994 3:158969113-158969135 CCCATCACTTCTCAGGCTTCAGG + Intronic
965431597 3:168595472-168595494 CCCAGCACTCCTGTGCCTCTGGG - Intergenic
966452165 3:180074618-180074640 CCCAGTACTCTGCTGGCTTCAGG + Intergenic
967818184 3:193816428-193816450 CTCACCACACCTCTGCCTCCTGG - Intergenic
968621557 4:1605582-1605604 CCCATCCCTCCTCTCCCTGCGGG + Intergenic
968663782 4:1809986-1810008 CCCTGCAGGCCTCAGCCTTCAGG - Intergenic
968716225 4:2161632-2161654 GCCCGCACTCCTCAGCCTTTGGG - Intronic
968930489 4:3576223-3576245 CCCAGCTCTGCTCTGCCACCAGG - Intergenic
969086233 4:4658627-4658649 ACCAGCAATCACCTGCCTTCGGG - Intergenic
969096185 4:4734640-4734662 CCCACCACTCCCCTGCCATGTGG + Intergenic
969307689 4:6335267-6335289 CCCAGCACCTATCTGCCTGCTGG - Intronic
969401057 4:6955822-6955844 TCCAGCTGTCCTCTGCCTTCAGG + Intronic
969576450 4:8038808-8038830 AGCAGCTCCCCTCTGCCTTCTGG + Intronic
969689873 4:8698535-8698557 CCCTGCCCTCCTCTGCCTCCTGG - Intergenic
969838879 4:9865995-9866017 CCCAGGACCCCTCTGCCTCCAGG + Intronic
969846431 4:9923621-9923643 GCCAGCTCTCCCTTGCCTTCAGG - Intronic
970006730 4:11418207-11418229 TCCAGTCCACCTCTGCCTTCTGG - Intronic
970406907 4:15772807-15772829 CCAAGCTCTCCTCTGCCTCTGGG - Intergenic
970464259 4:16307306-16307328 CCAAGAACGCTTCTGCCTTCTGG - Intergenic
970515736 4:16828336-16828358 CCCTACACTTCTCTGCCTTTAGG + Intronic
970673101 4:18418332-18418354 GCCCGCACTCCTCAGCCTTTGGG + Intergenic
972682435 4:41319359-41319381 CCAGGTACTCCTCTGCCTTAAGG + Intergenic
972991896 4:44830741-44830763 GCCAGCTCTCCCTTGCCTTCAGG - Intergenic
973144205 4:46804825-46804847 GCCTGCACTCCTCAGCCTTTGGG + Intronic
973174128 4:47183488-47183510 GCCAGCACCCTTCTGTCTTCTGG + Intronic
975669861 4:76770246-76770268 CACTGCAATCCTCTGCCTCCTGG - Intronic
976846125 4:89490368-89490390 GCCAGCACTCCTCAGCCCTTGGG - Intergenic
976912288 4:90322871-90322893 CCCAGTACTGCACTGGCTTCAGG - Intronic
978153968 4:105468697-105468719 CCCAGCAGTACTCTGCATGCTGG - Intronic
978163982 4:105584876-105584898 CCCAACACCCCTTTGCCTTTGGG + Intronic
978360175 4:107923322-107923344 CCCAGCACACCTCAGCCTCAGGG + Intergenic
978886616 4:113772694-113772716 CCCTGCACTCCTCAGCCTTTGGG - Intergenic
979242132 4:118456733-118456755 ACCACCACTCCTCTTCCATCAGG - Intergenic
979514179 4:121588075-121588097 CTCACCACTCTTCTGGCTTCTGG + Intergenic
979949452 4:126874450-126874472 GCCAGCACTCCTCAGCCATTGGG + Intergenic
980115269 4:128672984-128673006 GCCGGCACTCCTCAGCCCTCGGG - Intergenic
980151435 4:129053668-129053690 CCCATCAGTCCGCTGTCTTCAGG - Intronic
980383962 4:132062758-132062780 ACCTGCACTCCTCAGCCCTCGGG + Intergenic
981075675 4:140588961-140588983 GCCAGCTCTCCCTTGCCTTCAGG + Intergenic
981597725 4:146446102-146446124 CCCAGTATTTCTCTGCCTCCTGG + Intronic
983369710 4:166842834-166842856 GCCTGCACTCCTCAGCCTTTGGG + Intronic
983778790 4:171642578-171642600 GCCAGCTCTCCCTTGCCTTCTGG - Intergenic
985279376 4:188270427-188270449 CCCAGCGCTCTGCGGCCTTCCGG - Intergenic
985652794 5:1114710-1114732 CCCAGCAGTCCCCTGGCTCCAGG - Intergenic
985693261 5:1325311-1325333 CCCAGCCCTCATCTGCCTAGGGG + Intronic
986816324 5:11415734-11415756 TCCAGCACTCCTCTCCTTGCAGG + Intronic
987347379 5:16990976-16990998 GCCAGCACTCCTCAGCCCTTGGG + Intergenic
988201715 5:28077663-28077685 GCCCGCACTCCTCAGCCTTTGGG + Intergenic
988614943 5:32766083-32766105 CCCCGCCATCCTCTGGCTTCCGG - Intronic
989396999 5:40967803-40967825 CCCAGCACTACTGGGCCTGCAGG - Intronic
989456497 5:41650128-41650150 GCCAGCTCTCCCCTGACTTCAGG - Intergenic
989950633 5:50293213-50293235 GCCAGCACTCCTCAGCCCTTGGG - Intergenic
990512080 5:56498654-56498676 GCCCGCACTCCTCAGCCTTTGGG + Intergenic
991049250 5:62254994-62255016 ACCAGGGCTCCTTTGCCTTCTGG + Intergenic
993233519 5:85270828-85270850 CTCAGCACACCCCTGCCTCCAGG + Intergenic
994210712 5:97085225-97085247 ACCTGCACTCCTCAGCCTTTGGG + Intergenic
995700464 5:114929273-114929295 GCCTGCACTCCTCAGCCCTCAGG - Intergenic
996026291 5:118649784-118649806 CCAAGCATTCTTCTGCCTGCAGG + Intergenic
996133297 5:119808885-119808907 CCCAGCACTATGCTGGCTTCAGG - Intergenic
996397867 5:123031582-123031604 AGCATCTCTCCTCTGCCTTCTGG - Intronic
997093202 5:130880642-130880664 TACAGTACTCCTCTGCCTTCTGG + Intergenic
999426039 5:151488410-151488432 CCCACCTCTCCCCTGCCCTCAGG - Exonic
999768472 5:154757148-154757170 CCCAGCATTCCTCTGCAGCCGGG + Intronic
1000651230 5:163821581-163821603 CCCAGCACTGTGCTGGCTTCAGG - Intergenic
1001049652 5:168404157-168404179 CCCAGCTGTCCTCTGCCAACAGG - Intronic
1002350812 5:178582534-178582556 CCCCGCTGTCCTCTGCTTTCAGG - Intronic
1002448743 5:179307257-179307279 CCCTGCAAGCCTCAGCCTTCAGG + Intronic
1002759691 6:191934-191956 GCCAGCACCCCTCTGTCTTCTGG - Intergenic
1003578258 6:7316818-7316840 GCCAGCACTCCTCAGCCCTTGGG + Intronic
1005562936 6:27059968-27059990 GCCGGCTCTCCCCTGCCTTCAGG + Intergenic
1005661513 6:28003374-28003396 GCCTGCTCTCCCCTGCCTTCAGG - Intergenic
1006408663 6:33859529-33859551 CCCAGCCCTCCTCTGCTCCCTGG - Intergenic
1006434063 6:34017169-34017191 GCCAGCACTCCTCAGCCCTTGGG + Intergenic
1006436513 6:34028450-34028472 CCCGGCATCCCGCTGCCTTCAGG + Intronic
1006854441 6:37123419-37123441 CCCTGTCCTCCTCTGGCTTCTGG - Intergenic
1006930567 6:37685610-37685632 CACAGAGCTCTTCTGCCTTCGGG + Intronic
1006996097 6:38262447-38262469 CCCAGCACTTCACTGCTTTTAGG - Intronic
1007073733 6:39053926-39053948 CACAGCTCTCCTCTGCTCTCCGG + Intronic
1007593504 6:43037691-43037713 CCCAGAGCTTCTCTACCTTCCGG - Exonic
1007636858 6:43304908-43304930 CCCAGCAGCCCACTGCATTCTGG - Exonic
1007647425 6:43393712-43393734 GCCAGCTCTCCCTTGCCTTCAGG - Intergenic
1008270122 6:49481821-49481843 GCCAGCACTCCTCAGCCCTTGGG + Intronic
1009783275 6:68297456-68297478 CCTAGCACTGCTCTGGCTTCAGG + Intergenic
1010313812 6:74421070-74421092 CCCAGTGCTCTGCTGCCTTCAGG + Intergenic
1011343327 6:86341152-86341174 CCCAGCACTGTGCTGGCTTCAGG + Intergenic
1011477518 6:87762589-87762611 CCCAGGTTTCCTCTGGCTTCTGG - Intergenic
1011969861 6:93209739-93209761 CCCAACACTACTCTTCCTGCAGG + Intergenic
1012283012 6:97352100-97352122 GCCAGCACTTCTCAGCCTTTTGG - Intergenic
1012524500 6:100161073-100161095 ACCAGCGCTCCTCTCCCTACAGG + Intergenic
1012733496 6:102910717-102910739 GCCAGCACTCCTCAGCCCTTGGG + Intergenic
1012851049 6:104446652-104446674 GCCGGCACTCCTCTGCCCTTGGG - Intergenic
1013025654 6:106269401-106269423 CCCCGCACTCCTCAGCCCTTGGG + Intronic
1014507825 6:122280946-122280968 GCCCGCACTCCTCAGCCTTTGGG - Intergenic
1016041785 6:139438983-139439005 CTCATCTCTCCTATGCCTTCAGG - Intergenic
1017173852 6:151483350-151483372 CCCAGGACTCGTCTTCCCTCAGG - Intergenic
1017327179 6:153152716-153152738 GCCAGCTCTCCCTTGCCTTCAGG - Intergenic
1017839431 6:158209745-158209767 GCCCGCACTCCTCAGCCTTTGGG + Intergenic
1017909516 6:158781158-158781180 CTCAGCACTCCTCAGACTTCAGG + Intronic
1018536622 6:164827254-164827276 GCCAGCTCTCCTCTGCCTTCAGG - Intergenic
1018627424 6:165792943-165792965 CCCAGCACCACTGTGCCTGCCGG - Intronic
1020120550 7:5500841-5500863 CCCAGCCCTCCTCCGTGTTCTGG - Exonic
1021130896 7:16912599-16912621 CCCAGCACTGTGCTGGCTTCAGG - Intergenic
1021367886 7:19803983-19804005 TCCAGCTCTCCTCTGTCTACTGG - Intergenic
1022749775 7:33212960-33212982 CCCAGTACTACACTGGCTTCAGG - Intronic
1023615372 7:42014309-42014331 CCCACTACCCTTCTGCCTTCCGG + Intronic
1024284618 7:47746575-47746597 CCCAGCACTGCTCTGGCACCTGG - Intronic
1024731784 7:52261278-52261300 GCCAGCCCTCCTCTTCTTTCTGG + Intergenic
1025019668 7:55471120-55471142 CCAAACACTCCTCTTCCTCCAGG - Exonic
1025614643 7:63107132-63107154 ACCAGCATTCCCTTGCCTTCAGG - Intergenic
1026674392 7:72416889-72416911 CCCTGCACTTCTCTGCCTCCTGG - Intronic
1026864865 7:73817316-73817338 CCCAGCTCTCCCATGCCTCCGGG + Intronic
1027698217 7:81437084-81437106 GCCCGCACTCCTCAGCCTTTGGG + Intergenic
1027772462 7:82424812-82424834 CCCATCACTCTTTTGCCTTCAGG - Intronic
1028058665 7:86282146-86282168 ACCTGCACTCCTCGGCCTTTGGG + Intergenic
1029687241 7:102157213-102157235 ACCTGCACTCTGCTGCCTTCAGG - Intronic
1030662801 7:112239426-112239448 CCCAGTACTGCTCCGGCTTCAGG + Intronic
1030733549 7:113017709-113017731 CCCCGCACTCCTCAGCCCTTGGG - Intergenic
1031412521 7:121456925-121456947 CCCAGCACCCTGCTGGCTTCAGG - Intergenic
1031450395 7:121910173-121910195 GCCAGCACTGCTCTTCCCTCAGG + Intronic
1034677628 7:152903033-152903055 CCCAGCCCTCCACTCCCTACAGG - Intergenic
1034685842 7:152970645-152970667 CCCAGCAATCCTCTGTCTCCTGG + Intergenic
1034839508 7:154382798-154382820 CTCAGCTCACCTCTGCCTCCTGG + Intronic
1034962978 7:155373985-155374007 ACCCGCACTCCGCTGCCTCCTGG + Intergenic
1035245133 7:157558308-157558330 CTCAGCAGTCCCCTGCCTTGGGG - Intronic
1036597395 8:10226279-10226301 CCCAGCTCTGCTGTTCCTTCTGG + Intronic
1037729531 8:21512600-21512622 GCAAGCACACCTCTACCTTCAGG + Intergenic
1039270421 8:35874486-35874508 CCAATCATTCCTCTGCCTTTGGG + Intergenic
1039280262 8:35976876-35976898 CCAGGCACTTCCCTGCCTTCAGG - Intergenic
1039555353 8:38471331-38471353 CTCAGCTCACCTCTGCCTTCTGG + Intergenic
1039592941 8:38765408-38765430 TCCAGCACTTATCTGACTTCTGG - Intronic
1040828593 8:51651567-51651589 CTCCTCACTCATCTGCCTTCTGG - Intronic
1041214431 8:55585753-55585775 CCCACCTCTCCCCTGGCTTCTGG + Intergenic
1041748875 8:61237671-61237693 CCCATCAAACCCCTGCCTTCTGG - Intronic
1042450575 8:68940623-68940645 GCCAGCTCTCCCTTGCCTTCAGG + Intergenic
1042726776 8:71887864-71887886 CCCAGCACTCTGCTGCCTTCAGG - Intronic
1042908616 8:73801014-73801036 CTCACCGCACCTCTGCCTTCTGG - Intronic
1043354873 8:79400625-79400647 CCCAACTCTCCTCTTACTTCCGG + Intergenic
1043854153 8:85245643-85245665 CCCCGCACGCCTCTGCCGTCTGG + Exonic
1044395121 8:91702554-91702576 CCCAGCACTTTTCTGGCTTCAGG - Intergenic
1044727400 8:95204576-95204598 GCCAGCTCTCCCTTGCCTTCAGG - Intergenic
1044799912 8:95943545-95943567 CTCAGCAGTCCTATCCCTTCAGG - Intergenic
1044821364 8:96158156-96158178 CCCAGCCCTCCACCGCATTCCGG + Intronic
1044973831 8:97644539-97644561 CCGAGCCCTCCTCGGCCTGCTGG - Exonic
1045023486 8:98064410-98064432 CCCTGCCCTCCTCTGCGTCCTGG + Exonic
1045057525 8:98382428-98382450 CTCTGACCTCCTCTGCCTTCTGG - Intergenic
1045547274 8:103140538-103140560 CCCAGCCCTCCTCCGGCTGCGGG + Intronic
1046184082 8:110690372-110690394 GCCGGCTCTCCCCTGCCTTCAGG + Intergenic
1046268092 8:111858263-111858285 CCCAGCACTGTGCTGGCTTCAGG - Intergenic
1047285251 8:123482236-123482258 CCCATCACTTCTCGGCCTTCTGG + Intergenic
1048757714 8:137756546-137756568 CCCTGCACTCCTCTGGCTCTGGG - Intergenic
1049160104 8:141091831-141091853 CCCAGCAAGCCTCTGTCTCCTGG - Intergenic
1049190407 8:141284408-141284430 CCCAGCACTCCACGGCCATCCGG + Intronic
1052094064 9:24362948-24362970 CCCAGTGCTGCTCTGGCTTCAGG + Intergenic
1053290453 9:36876202-36876224 CCCACCTCTCCTCTGGCCTCAGG + Intronic
1053481090 9:38417115-38417137 CTAAGCACTCCTCTGCCTACAGG + Intronic
1054459620 9:65455691-65455713 CCCAGCTCTGCTCTGCCACCAGG + Intergenic
1054820613 9:69516994-69517016 CCCCGCGCTCCTCTTCCTCCTGG + Exonic
1055925688 9:81507734-81507756 CCCTGTACTCCTCAGCCTTTGGG - Intergenic
1056305827 9:85289413-85289435 GCCAGCACTCCTCAGCCCTTGGG - Intergenic
1056552619 9:87664142-87664164 CCTGGGGCTCCTCTGCCTTCAGG + Intronic
1057005129 9:91550546-91550568 CCCAGCACTGCTCTGCTTCTAGG - Intergenic
1057039401 9:91836600-91836622 CCCAGGTCTCCTCTGTCCTCTGG + Intronic
1057511197 9:95680696-95680718 CCCCGCACTCCTCAGCCCTTGGG - Intergenic
1059669148 9:116476950-116476972 CCCAGCTCCCCTCCGCCTGCAGG + Intronic
1060091403 9:120746710-120746732 ACCCACACTCCTCAGCCTTCGGG - Intergenic
1060885635 9:127150192-127150214 CCCAGCATTCTTTTGCCTGCAGG + Intronic
1061630566 9:131869684-131869706 CCCCGCATTCCTCTTGCTTCAGG - Intronic
1062074400 9:134576665-134576687 ACAAGCATTCCTGTGCCTTCTGG + Intergenic
1062118042 9:134819587-134819609 CCCAGCTCTCATTTGCCTTGGGG - Intronic
1062398488 9:136362285-136362307 CCCAGCACTCCTGTGGCATCAGG + Intronic
1062483605 9:136763568-136763590 CCCGCCCCTCCTCTGTCTTCGGG - Intronic
1062543373 9:137051292-137051314 CCCAGTACCCCTTTGACTTCCGG - Exonic
1062577833 9:137216790-137216812 CGCTGCACTCCTCTGCCCTGGGG + Exonic
1062706419 9:137946503-137946525 CCTATCATTCCTCGGCCTTCAGG + Intronic
1185715975 X:2342481-2342503 GCCAGCACTTATCTGCCTTTGGG + Intronic
1186848910 X:13560178-13560200 GCCAGGACTCCTCTGGCTGCAGG + Intergenic
1186984611 X:14998611-14998633 ACCAGCAACCCTCTGCCTTTAGG + Intergenic
1187270434 X:17775623-17775645 CCCAGCTTTCCTCTGCCTTGGGG - Intergenic
1187320076 X:18230102-18230124 CCCAGCTTTCCTCTGCCTTGGGG + Intergenic
1188108165 X:26167267-26167289 CCCAGCACTGTGCTGGCTTCAGG - Intergenic
1189698522 X:43692174-43692196 CAAAGCACTGCTCAGCCTTCGGG - Intronic
1189820974 X:44870327-44870349 GGCTGCACTACTCTGCCTTCCGG + Intergenic
1190507829 X:51145239-51145261 CCCAGCACTTTACTGGCTTCAGG - Intergenic
1191191708 X:57675092-57675114 CCATTCACTCCTCGGCCTTCAGG + Intergenic
1191877240 X:65809354-65809376 ACCATCACTGCTCAGCCTTCTGG - Intergenic
1192022526 X:67409022-67409044 GCCTGCACTCCTCAGCCTTTGGG - Intergenic
1192397389 X:70795534-70795556 CCCAGTACTACGCTGGCTTCAGG + Intronic
1193047754 X:77070312-77070334 GCCAGCTCTCCGCTGCTTTCAGG - Intergenic
1193175265 X:78384805-78384827 CCCAGCACTATGCTGGCTTCAGG + Intergenic
1194264960 X:91742819-91742841 CCCAGCACTGTTCTGGCTTCAGG - Intergenic
1194285589 X:92007055-92007077 CCCAGCACTGTGCTGGCTTCAGG - Intronic
1194506683 X:94742666-94742688 CCCAGCACTGTGCTGGCTTCAGG - Intergenic
1194890429 X:99372067-99372089 CCCTGCACTCCTCAGCCCTTGGG + Intergenic
1196006582 X:110843554-110843576 CCCAGCACTTCCCTGCCCACAGG - Intergenic
1196319474 X:114270556-114270578 GCCCGCACTCCTCAGCCTTTGGG + Intergenic
1196467908 X:115991779-115991801 CCCAGCACTGTGCTGGCTTCAGG + Intergenic
1196856537 X:119990493-119990515 GCCAGCACTGCTCTCCCCTCTGG - Intergenic
1198756574 X:139988427-139988449 CACAGGACTCCCCTTCCTTCAGG - Intergenic
1199258646 X:145745322-145745344 CCCAGCACTGTGCTGACTTCAGG + Intergenic
1199574824 X:149303733-149303755 CCCAGCACTGATCTGCTATCTGG - Intergenic
1199831739 X:151555187-151555209 CCCTGCACTCCTCAGCCCTTGGG + Intergenic
1199983991 X:152937389-152937411 GCCAGCTCTCCCTTGCCTTCAGG + Intronic
1200582110 Y:4963265-4963287 CCCAGCACTGTTCTGGCTTCAGG - Intergenic
1200603157 Y:5231593-5231615 CCCAGCACTGTGCTGGCTTCAGG - Intronic
1201488215 Y:14513178-14513200 ACCTGCACTCCTCAGCCTTTGGG - Intergenic
1201912718 Y:19149595-19149617 CATAGCACTGCTCTGCTTTCTGG - Intergenic
1202084402 Y:21120755-21120777 CCCAGGATCCATCTGCCTTCTGG - Intergenic
1202269113 Y:23053453-23053475 CCGAGCACTCCTTGGTCTTCGGG - Intergenic
1202422105 Y:24687193-24687215 CCGAGCACTCCTTGGTCTTCGGG - Intergenic
1202448681 Y:24982885-24982907 CCGAGCACTCCTTGGTCTTCGGG + Intergenic
1202627093 Y:56870906-56870928 CCCAGCACTCCTATTCCTTGAGG - Intergenic