ID: 902241927

View in Genome Browser
Species Human (GRCh38)
Location 1:15095216-15095238
Sequence CCAGCACTCCTCTGCCTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 7, 3: 57, 4: 492}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902241916_902241927 8 Left 902241916 1:15095185-15095207 CCCCAACCAATGCGGGAACCTCA 0: 1
1: 0
2: 0
3: 5
4: 73
Right 902241927 1:15095216-15095238 CCAGCACTCCTCTGCCTTCCGGG 0: 1
1: 0
2: 7
3: 57
4: 492
902241917_902241927 7 Left 902241917 1:15095186-15095208 CCCAACCAATGCGGGAACCTCAC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 902241927 1:15095216-15095238 CCAGCACTCCTCTGCCTTCCGGG 0: 1
1: 0
2: 7
3: 57
4: 492
902241911_902241927 19 Left 902241911 1:15095174-15095196 CCCTAGTACACCCCCAACCAATG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 902241927 1:15095216-15095238 CCAGCACTCCTCTGCCTTCCGGG 0: 1
1: 0
2: 7
3: 57
4: 492
902241915_902241927 9 Left 902241915 1:15095184-15095206 CCCCCAACCAATGCGGGAACCTC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 902241927 1:15095216-15095238 CCAGCACTCCTCTGCCTTCCGGG 0: 1
1: 0
2: 7
3: 57
4: 492
902241919_902241927 2 Left 902241919 1:15095191-15095213 CCAATGCGGGAACCTCACGAGCC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 902241927 1:15095216-15095238 CCAGCACTCCTCTGCCTTCCGGG 0: 1
1: 0
2: 7
3: 57
4: 492
902241912_902241927 18 Left 902241912 1:15095175-15095197 CCTAGTACACCCCCAACCAATGC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 902241927 1:15095216-15095238 CCAGCACTCCTCTGCCTTCCGGG 0: 1
1: 0
2: 7
3: 57
4: 492
902241918_902241927 6 Left 902241918 1:15095187-15095209 CCAACCAATGCGGGAACCTCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 902241927 1:15095216-15095238 CCAGCACTCCTCTGCCTTCCGGG 0: 1
1: 0
2: 7
3: 57
4: 492
902241910_902241927 26 Left 902241910 1:15095167-15095189 CCAAAGGCCCTAGTACACCCCCA 0: 1
1: 0
2: 0
3: 6
4: 102
Right 902241927 1:15095216-15095238 CCAGCACTCCTCTGCCTTCCGGG 0: 1
1: 0
2: 7
3: 57
4: 492
902241920_902241927 -10 Left 902241920 1:15095203-15095225 CCTCACGAGCCCCCCAGCACTCC 0: 1
1: 0
2: 1
3: 40
4: 379
Right 902241927 1:15095216-15095238 CCAGCACTCCTCTGCCTTCCGGG 0: 1
1: 0
2: 7
3: 57
4: 492
902241908_902241927 28 Left 902241908 1:15095165-15095187 CCCCAAAGGCCCTAGTACACCCC 0: 1
1: 0
2: 0
3: 8
4: 70
Right 902241927 1:15095216-15095238 CCAGCACTCCTCTGCCTTCCGGG 0: 1
1: 0
2: 7
3: 57
4: 492
902241909_902241927 27 Left 902241909 1:15095166-15095188 CCCAAAGGCCCTAGTACACCCCC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 902241927 1:15095216-15095238 CCAGCACTCCTCTGCCTTCCGGG 0: 1
1: 0
2: 7
3: 57
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902241927 Original CRISPR CCAGCACTCCTCTGCCTTCC GGG Intronic
900142496 1:1144577-1144599 CCAGCGCTCCCCTCCCTGCCAGG + Intergenic
900380469 1:2381575-2381597 TCCCCACTCCTCTGCCGTCCAGG - Intronic
900585896 1:3432199-3432221 CCAGCACTCCTCTCCCGCCGTGG + Intronic
900626353 1:3610431-3610453 CCAGCACTCCCTGGCCTTGCTGG - Intronic
900769297 1:4528156-4528178 CCAGCTCTCCTTTGCCAGCCTGG + Intergenic
901624047 1:10613520-10613542 CCTGCACACCTGGGCCTTCCTGG - Intronic
901632307 1:10653803-10653825 CCAGCAGTCCTCTGCGTCCCTGG - Exonic
902108920 1:14061423-14061445 CAAGCTCTCTTCTGCCTGCCTGG - Intergenic
902241927 1:15095216-15095238 CCAGCACTCCTCTGCCTTCCGGG + Intronic
903340912 1:22653663-22653685 TCAGCACTGCTGTGCCTTACAGG + Intronic
903389696 1:22955144-22955166 CCAGCTCTCCCCTGTCTTGCTGG + Intronic
903629936 1:24760541-24760563 TCTGCACTTCTCTGCCTTCATGG + Intronic
903654774 1:24942571-24942593 CCAGCCCCCTTCTCCCTTCCTGG - Intronic
904028989 1:27522300-27522322 CCACCAGTACTGTGCCTTCCTGG - Intergenic
904603965 1:31689005-31689027 GCTGCCCTCCTCTGCCTACCTGG - Intronic
904944382 1:34188717-34188739 CCAGCCCTCCTCCACCCTCCGGG - Intronic
906818753 1:48906611-48906633 CCAGCATTTCTCTGTTTTCCAGG - Intronic
907441365 1:54480582-54480604 CCAGCACTGGCCTGGCTTCCTGG + Intergenic
909548185 1:76869326-76869348 CCTGTCTTCCTCTGCCTTCCGGG + Intronic
909791184 1:79680204-79680226 CCAGCTTTCCTCTACTTTCCAGG - Intergenic
911111946 1:94198368-94198390 CAAGCAATCCTCAGCCTCCCAGG - Intronic
912427866 1:109610542-109610564 CCAGTTCTCCTCAGCCTTCCAGG + Exonic
913172611 1:116246281-116246303 CCAGCAATCCTTGGCTTTCCTGG - Intergenic
915320022 1:155051427-155051449 CGGGCAGCCCTCTGCCTTCCTGG + Exonic
915439051 1:155933010-155933032 CCTGAACTCCTCTGACTTCAGGG + Intronic
915460531 1:156068091-156068113 CCAAGGCTCCTCTGCCTTCCAGG - Intronic
916020697 1:160789766-160789788 CCACCCCTCCACTGCCTCCCAGG - Intergenic
916757326 1:167785287-167785309 CCAGCTGTCCTCTGTCTGCCTGG - Intronic
916958524 1:169865470-169865492 CCAGCATTCCCCTCTCTTCCAGG + Intronic
916986566 1:170198318-170198340 ACAGCATTTCTCTGCCATCCTGG - Intergenic
917515004 1:175699863-175699885 CCAAGAATCCTCTCCCTTCCTGG + Intronic
917981321 1:180271543-180271565 CCAGCACTCCTGTGCCCTCCGGG + Intronic
918259411 1:182782153-182782175 CCAGCAGTCCTCTTCCCTTCAGG - Intergenic
918688980 1:187456775-187456797 CCAGCTCTCCCTTGCCTTCAGGG + Intergenic
919659224 1:200227059-200227081 CCACCACTCTTCTGCCTGCCCGG - Intergenic
919713782 1:200754050-200754072 CCACGCCTCCCCTGCCTTCCTGG - Intronic
919915756 1:202138125-202138147 CCTACTCTCCTCTGCCTCCCCGG + Intronic
920109069 1:203574465-203574487 AATGCACTCCTCTGCCTCCCAGG + Intergenic
920678140 1:208052657-208052679 ACATGACTCTTCTGCCTTCCCGG - Intronic
921888401 1:220329292-220329314 CCAGCACACCTCTGCCTTTGGGG + Intergenic
921938833 1:220818868-220818890 CCAGCTGTCCTCGGCCGTCCTGG - Exonic
922575200 1:226656451-226656473 CCAGCACAGCTGTGGCTTCCGGG - Intronic
922601890 1:226862503-226862525 CCAGCAATCCTCAACCTTCTTGG - Intergenic
923029176 1:230233662-230233684 CCTTCACTCTTATGCCTTCCAGG - Intronic
923171479 1:231421589-231421611 CCGGCGCGCCGCTGCCTTCCTGG + Exonic
1063666332 10:8062795-8062817 CCAGGACTCCCCTTCCTTGCAGG - Intronic
1063814724 10:9758967-9758989 CCACCACTGTTCTGGCTTCCAGG - Intergenic
1063818554 10:9807309-9807331 CCATCACTCATCTGTGTTCCAGG - Intergenic
1064138581 10:12771364-12771386 CCGGCTCTCCTCAGCCTGCCTGG - Intronic
1064276831 10:13914014-13914036 CCAACACCCCTCTCCCTCCCTGG + Intronic
1064292096 10:14044578-14044600 CCAGCAGTCCTTGGCATTCCTGG - Intronic
1064434114 10:15295782-15295804 CCAGCACTCCTGTGGCTGCCTGG + Intronic
1064436386 10:15314681-15314703 CCAGCACTCTTCTGCTTTGCTGG + Intronic
1067079474 10:43205044-43205066 CCAGACCTCCACTGCCTTCCTGG - Intronic
1067181007 10:43986053-43986075 CCTGCCCTCCCCTGCGTTCCTGG + Intergenic
1067298407 10:44989246-44989268 CCTGAACTTCTCTCCCTTCCTGG + Intronic
1069578314 10:69546140-69546162 CCAGAACTCCACTCTCTTCCTGG + Intergenic
1070216253 10:74384592-74384614 ACCGCAAACCTCTGCCTTCCAGG - Intronic
1070281349 10:75051098-75051120 CCTGCTCTCCTAGGCCTTCCAGG - Intronic
1070669138 10:78365806-78365828 CCAGCAGACCTGTGTCTTCCTGG + Intergenic
1070979521 10:80633081-80633103 CCATCACTCTCCTGCCTCCCAGG - Intronic
1071066146 10:81638573-81638595 CTGGGACTCCTATGCCTTCCTGG - Intergenic
1071570707 10:86695291-86695313 CCATCACTGCTCTGCCTCCAAGG + Intronic
1073321670 10:102619670-102619692 CCAGCCCTCCTCCCCCTGCCAGG + Intronic
1073429309 10:103476160-103476182 CCAGCACTTCCCTGCCTCCTGGG + Intronic
1074367145 10:112868082-112868104 CAGGCACTCTTTTGCCTTCCTGG + Intergenic
1074432570 10:113406465-113406487 CCAGAAATCCTTGGCCTTCCCGG - Intergenic
1074704000 10:116115491-116115513 CCAGCCCTGCCCTGCCCTCCAGG + Intronic
1075023466 10:118967559-118967581 TCAGGCCTCCTCTGGCTTCCTGG + Intergenic
1075710073 10:124526082-124526104 CCACCACTCCAGCGCCTTCCAGG - Intronic
1075717723 10:124566640-124566662 CCAGCACACGTCTGCCTTTTGGG + Intronic
1076438644 10:130463871-130463893 CCAGCTCTCCCTTGCCTTCAGGG + Intergenic
1076827920 10:132979315-132979337 CCAGCACACCTGTGCCTTCCTGG - Intergenic
1077242067 11:1515811-1515833 CCTGCACTCCTTGGCCCTCCAGG + Intergenic
1077365822 11:2161199-2161221 CCAGCAGCCCTCAGCCCTCCAGG - Exonic
1078489945 11:11759421-11759443 CCTCCACTGCTCTGCCTTGCAGG + Intergenic
1079094805 11:17503294-17503316 CCAGCACTGCCCAGCCTTCCAGG - Intronic
1079180967 11:18193167-18193189 GCAGGGCTCCTCTGCCTGCCTGG - Intronic
1079336220 11:19573082-19573104 CAGGCACTCCTCTGGCTTTCAGG + Intronic
1079355964 11:19730508-19730530 CCAGCACTGCACTGCCTGCCCGG - Intronic
1080433303 11:32217780-32217802 CCAGCTCACCTCTGTCCTCCAGG + Intergenic
1080514756 11:33009849-33009871 CTACCACACCTCTGCCTCCCAGG - Intergenic
1080872493 11:36249286-36249308 CCAGCACACCACTGCCTTTTAGG - Intergenic
1080886098 11:36369668-36369690 TCACCACACCTCTGCCTCCCAGG + Intronic
1081758968 11:45563710-45563732 TCAGCACAGCCCTGCCTTCCAGG - Intergenic
1083529620 11:63407781-63407803 CAGGGACTCCTCTGCCTACCTGG - Intronic
1083644570 11:64165110-64165132 CCCGCACTCTGATGCCTTCCTGG - Intronic
1083692620 11:64419571-64419593 ACTGCACTGCACTGCCTTCCCGG - Intergenic
1084040865 11:66541968-66541990 CCAGGCCTTCTCTGCCCTCCTGG - Intronic
1084571086 11:69960301-69960323 CCGGCAATCCTCGGCCATCCAGG - Intergenic
1084615551 11:70233520-70233542 CATACACTCCACTGCCTTCCAGG + Intergenic
1084942891 11:72623327-72623349 CCTGGTCTCCTCTGCCTCCCTGG + Intronic
1085040270 11:73322756-73322778 CCAGCTCCCCTCTCCCTTTCTGG + Intronic
1085114564 11:73919276-73919298 CCACCACTCTTCTGCCTTAAAGG + Intronic
1085830768 11:79898703-79898725 TCAACACTCCTCTTCCTACCTGG - Intergenic
1088070955 11:105784510-105784532 CCAGCACTCTGCTGTCTACCAGG - Intronic
1088108485 11:106231826-106231848 CCAGCACTCATCTGTTTTACGGG - Intergenic
1088361218 11:108992072-108992094 CCAGCACTCGACTGCTTGCCAGG + Intergenic
1089069733 11:115690047-115690069 CCAGCAATCCACTGCCTCCAGGG - Intergenic
1090085160 11:123644069-123644091 ACGGCACTGCTTTGCCTTCCTGG - Intronic
1090201460 11:124860810-124860832 CCAGCAGTGCTTGGCCTTCCTGG - Intergenic
1090541431 11:127710813-127710835 CCAACACTCTCCTGCCTCCCTGG + Intergenic
1090884346 11:130862570-130862592 CCAGGAGTCCTCTGGTTTCCAGG + Intergenic
1091043087 11:132300742-132300764 TCAGCACCCATCTGCCTGCCTGG + Intronic
1091793015 12:3282226-3282248 CCTGCACTCCTCTGGGTCCCCGG + Intronic
1091826807 12:3519013-3519035 CCGGCTCTCCCCTGCCTTCAGGG - Intronic
1094020127 12:25905034-25905056 CCAGCACACCTGTCCCCTCCAGG - Intergenic
1094213365 12:27915899-27915921 CCAGCAGTCCTTTACCTGCCAGG - Intergenic
1094475722 12:30839319-30839341 CTGTCACTCCTTTGCCTTCCAGG + Intergenic
1094480172 12:30875170-30875192 CCAGCCCTCCCCTCCCTGCCTGG - Intergenic
1094719367 12:33047676-33047698 GCAGGCCTCCTCTGCCTTCCTGG - Intergenic
1095298666 12:40556842-40556864 CCAGAACTCCTCTCCTTTTCAGG - Intronic
1096252260 12:50040779-50040801 CCCGCTGTCCTCTGCCATCCAGG - Intergenic
1096777799 12:53974557-53974579 GCAGGACTCCACTGCGTTCCAGG + Intronic
1096988293 12:55776943-55776965 CCAGCACTCTTCTCCCTTTCAGG + Intronic
1098568568 12:71963017-71963039 CCTGAACACCTCTGCATTCCAGG + Intronic
1099708941 12:86195031-86195053 TCAGCACTCCTCTTGCTTTCTGG + Intronic
1100535481 12:95504966-95504988 CCAGTCCTCCTCTGGCTCCCAGG + Intronic
1101208412 12:102512285-102512307 CCAGCACGTGTTTGCCTTCCTGG + Intergenic
1101389129 12:104284175-104284197 CCAGCAATCCTTTGCATCCCTGG - Intronic
1102068174 12:109996131-109996153 CCCGCTCCCCTCTGCTTTCCTGG - Intronic
1102181149 12:110913256-110913278 TCAGCACCCCTTTGCCTTCAGGG + Exonic
1102894328 12:116586610-116586632 CAAGAACTCCACTGCCTGCCAGG + Intergenic
1103450625 12:121026104-121026126 CCGGCTCCCCTCTGCCTCCCAGG - Intronic
1104807533 12:131599058-131599080 CCAGCCCTCCACTCCCCTCCTGG + Intergenic
1104836552 12:131795683-131795705 CCTGGCCTCCTCTGCCTTCCAGG - Intronic
1105026535 12:132852929-132852951 CCAGCTCTCCTCTGACTTCCTGG + Intronic
1105898085 13:24734777-24734799 CCACCACCCCTCTCCATTCCTGG + Intergenic
1106664944 13:31841870-31841892 GCAGCCAACCTCTGCCTTCCAGG - Intergenic
1107761600 13:43685307-43685329 CCTCTTCTCCTCTGCCTTCCTGG - Intronic
1109818782 13:67623735-67623757 CCAGCAGTCCTCAACCTTCTTGG - Intergenic
1110483590 13:76012640-76012662 CCAGCACTGCCCTGGCTTGCTGG + Intergenic
1111694133 13:91601925-91601947 CCAGCACTCCTCAACCTTTTTGG - Intronic
1111933854 13:94538934-94538956 CCAGCACTACTCTAGCTTCTAGG + Intergenic
1112326239 13:98444370-98444392 CCACCGCTCCTCTCCCTTCTTGG - Intronic
1113378484 13:109784268-109784290 CCAGCCCTCCTCTGCCTCGCTGG - Exonic
1113784521 13:112995519-112995541 CCAGCTCCCCTCTGCTCTCCTGG - Intronic
1113917787 13:113884454-113884476 CCAGCACCCCGCTGTCCTCCCGG - Intergenic
1113968159 13:114166492-114166514 TCAGCTGCCCTCTGCCTTCCTGG + Intergenic
1114543660 14:23482726-23482748 CCAGCACTGCTCTGGCTTCTTGG - Intronic
1114602092 14:23965307-23965329 CTAGCACTTCTCTGGCTTCTGGG - Intronic
1114606264 14:24000422-24000444 CTAGCACTTCTCTGGCTTCTGGG - Intronic
1115475037 14:33805349-33805371 CAAGCACCCCTCTGCCTTGTGGG - Intergenic
1116237540 14:42298038-42298060 CCTGCAACACTCTGCCTTCCAGG + Intergenic
1117018568 14:51545606-51545628 CCAGCACACCACTGCCTCCCGGG + Intronic
1117253797 14:53958056-53958078 CCAGCACTCCTCTGGCTACCTGG - Intronic
1118550531 14:66944885-66944907 CCTGCACTCCTCTCCCTGCCAGG - Intronic
1119294310 14:73520784-73520806 CCAGCAATCTTCCACCTTCCTGG + Intronic
1119422508 14:74516004-74516026 CAAGCTCTTCTCTGACTTCCAGG + Intronic
1119494035 14:75063572-75063594 CCTTCACTCTTCTGCTTTCCTGG - Intronic
1119615547 14:76096525-76096547 CCATCACTCCTCTGCCTATCGGG - Intergenic
1119855698 14:77898966-77898988 CCATCCCTCCTCTGAATTCCAGG - Intronic
1119863793 14:77956434-77956456 CCCCCACTCCCCTGCCTGCCCGG + Intergenic
1121017754 14:90558693-90558715 CCAGCGCTCCTCTGCCCTGCCGG + Intronic
1121107827 14:91292681-91292703 CCAGCACACCAATGCCTGCCCGG + Intronic
1121234067 14:92379622-92379644 CCAGCACTCCCATGCCCTTCAGG - Intronic
1121271846 14:92642792-92642814 CCAGAACTCCTCCTACTTCCTGG - Intronic
1121405188 14:93715559-93715581 CCACCACTCATCTGCTATCCAGG - Intergenic
1121634277 14:95443175-95443197 CCAGCTTTCCTCCGACTTCCAGG - Exonic
1121944146 14:98103091-98103113 CCTGCTCTCTTCTGCCTTCTAGG + Intergenic
1122156533 14:99753487-99753509 TCAGCACCCATCTCCCTTCCTGG + Intronic
1122821118 14:104345674-104345696 CCGGCACTCCTCACCCTCCCTGG - Intergenic
1122907986 14:104811146-104811168 CCCGCTCTCCAGTGCCTTCCAGG - Intergenic
1123029061 14:105442278-105442300 ACCTCACTCATCTGCCTTCCGGG - Intronic
1124042991 15:26122004-26122026 CCACCATGCCTCTGCCTTGCAGG + Intergenic
1124640126 15:31391908-31391930 GCAGGAATCCTCTGCCTTCCCGG - Intronic
1125359590 15:38850871-38850893 ACTGCAATCCTCTGCCTCCCGGG - Intergenic
1125689679 15:41585886-41585908 CTAGCTCTCATCTCCCTTCCAGG - Intergenic
1126113345 15:45187887-45187909 CCAGCGCTCCCCTGCGTTCGCGG + Intronic
1128311173 15:66632490-66632512 CCTGCAGTCCCCTCCCTTCCCGG + Intronic
1128465957 15:67911517-67911539 ACAGCACACCTCAGCCTCCCAGG - Intergenic
1129190038 15:73931760-73931782 CCTGCCCACCTCTGCCCTCCAGG + Intronic
1129302434 15:74633161-74633183 CCAGCAGACCACTGCCCTCCTGG + Intronic
1129641846 15:77387926-77387948 CCAACTCTCCTCTGACTTCTGGG - Intronic
1129786490 15:78313516-78313538 CCACCCCGCCTCTGCCTCCCCGG - Intergenic
1129831313 15:78672778-78672800 CCAGCTCTCCTTTGCCTTCAGGG - Intronic
1129882485 15:79016532-79016554 CCACCAGGCCTCTGCCCTCCTGG - Intronic
1129922287 15:79329586-79329608 CCAGGCCACCTCTGCCTTACAGG - Intronic
1130012633 15:80163466-80163488 CCGGCTCTCCTCTCACTTCCTGG - Intronic
1130223671 15:82043071-82043093 CCAGCGCTCGCCTGCCTCCCTGG - Exonic
1130307722 15:82725950-82725972 TCAGCTCACCTCTGCCTCCCAGG + Intergenic
1130585455 15:85177433-85177455 CCAGCTCTCCCTTGCCTTCAGGG - Intergenic
1130902960 15:88220756-88220778 CCAGCATTCCTCTGGCTTGAGGG - Intronic
1131030953 15:89185588-89185610 CCAGGACTCCTGTTCCTTCAGGG + Intronic
1132464387 16:71090-71112 CCAGGTCTCCCCTGCCTTTCAGG - Intronic
1132657156 16:1046106-1046128 CCAGCACACGCCTGCCCTCCCGG - Intergenic
1132721381 16:1317880-1317902 CCAGCACTTCACTGCATCCCTGG - Intronic
1132900910 16:2253815-2253837 GCAGCACCCCTCTGCCAGCCGGG - Exonic
1132994105 16:2814075-2814097 CCAGCATTCCTCTGACTTTCAGG + Intergenic
1133209958 16:4258024-4258046 CCAGCCCTCCTCTCCCTTCTGGG - Exonic
1133305676 16:4806880-4806902 CCAGCTCTGCTCTGCCTCCCGGG + Intronic
1133439314 16:5807233-5807255 CCATCCCTCCTCTCCCTTCACGG + Intergenic
1135539478 16:23318984-23319006 GCAGGACTCCTCCTCCTTCCTGG - Intronic
1135725407 16:24850372-24850394 ACAGCCCTTCTCTGCCTTCCAGG + Intronic
1135995387 16:27244103-27244125 TCCCCACTCCTCTGCCTTCCTGG + Intronic
1136333327 16:29595611-29595633 CCAGCCCTCCGGTGCTTTCCGGG - Intergenic
1136593063 16:31229307-31229329 CAAACACTCCTGTGCCTTCCGGG + Intergenic
1137244490 16:46690987-46691009 CAAGTACTCCTCTGCTTTCCTGG - Exonic
1137486992 16:48899758-48899780 CCTGCTCTCTTCTGCCTCCCAGG + Intergenic
1138084519 16:54121632-54121654 CCAGCACTCCTGAGCCCTTCGGG + Exonic
1138261642 16:55627649-55627671 CCAGCCCTGGTCTGGCTTCCTGG + Intergenic
1138431264 16:56970670-56970692 CCAGTTCCCTTCTGCCTTCCAGG - Intronic
1138803458 16:60063657-60063679 CCAGGACTCCACTTCCATCCAGG + Intergenic
1138964713 16:62070507-62070529 CCAGCAGTCCTCAGCCTTTTTGG + Intergenic
1139662684 16:68432037-68432059 TCAGTGCACCTCTGCCTTCCTGG - Intronic
1139914753 16:70421142-70421164 CCAGCACACACCTGCCTTCATGG + Intronic
1140195261 16:72849807-72849829 CCAGCTCTCAGCTGACTTCCAGG + Intronic
1140473841 16:75228918-75228940 CCACTCCTCCTCTGCCCTCCCGG + Intronic
1140553245 16:75890912-75890934 CCTGCACCCCTCTGCCTGACAGG + Intergenic
1141082274 16:81062659-81062681 GCAGGGCTCCTCTGCATTCCAGG - Intronic
1141580448 16:84994562-84994584 CCAGCTCAGCTCCGCCTTCCTGG + Intronic
1141626403 16:85263899-85263921 CCAGGTCTCCTCTGCCGTCCTGG + Intergenic
1142253012 16:89001404-89001426 TCAGCACTCCTCCTCCTCCCTGG - Intergenic
1142365709 16:89648451-89648473 CCAGGACTGCTGTGCCCTCCTGG + Intronic
1142861247 17:2763375-2763397 ACAGCATTTCTCTGCCTGCCTGG - Intergenic
1143274890 17:5703088-5703110 CAAGCCCTCCTCTGACTCCCAGG - Intergenic
1143370713 17:6437258-6437280 TCAGCAGCCTTCTGCCTTCCAGG - Intergenic
1143512691 17:7405074-7405096 CCCGCCCTCCTCTGACTCCCCGG + Intronic
1143823874 17:9588402-9588424 CCAGCTCTACCCTGCCTTCAGGG - Intronic
1145004418 17:19329282-19329304 CCAGCACCCCTTTGCCTTTTGGG + Intronic
1146960992 17:36978776-36978798 CCTGCAGTCCTCTGTCTTACTGG + Intronic
1147161394 17:38571433-38571455 CCAGCACTGCTCAGCCTTCTGGG + Intronic
1147586257 17:41655411-41655433 CCAGCCCTTCTCCACCTTCCGGG + Intergenic
1147948241 17:44092615-44092637 CAAGCCCACCTCTGCCTCCCAGG + Intronic
1148086855 17:44998745-44998767 CCAGCTCCCCTCTGCCTTACTGG - Intergenic
1148158954 17:45439236-45439258 CCAGGACTCCTCTGCCTCTATGG - Intronic
1148161920 17:45455048-45455070 ACTGCAATCCCCTGCCTTCCCGG - Intronic
1148203352 17:45764385-45764407 CCAGCTCTGCTCTGCCTTGAGGG + Intergenic
1148784866 17:50141044-50141066 CCACCAGTACTCAGCCTTCCTGG - Intronic
1148847510 17:50538009-50538031 CCCACACCCCTCTGCCTGCCAGG - Intronic
1148905595 17:50909897-50909919 CCACCACTCCTGTGCCCTCCAGG + Intergenic
1149305832 17:55345818-55345840 CCAGCACTCCTTGGCATTCTTGG - Intergenic
1149335418 17:55630487-55630509 CCAGCACTGATTTGCCTGCCTGG + Intergenic
1149657470 17:58318017-58318039 CCAGCACTCCAGAGCCTCCCTGG + Intronic
1150135530 17:62693009-62693031 CCATCACTCCTGTGCCTGCTGGG + Exonic
1150655117 17:67034153-67034175 CCATCACTCCTCCACCCTCCTGG + Intergenic
1150706327 17:67490583-67490605 CCAGCAGTCCCCTGCCTGCGGGG - Intronic
1151025054 17:70668743-70668765 CCGGCTCTCCCTTGCCTTCCGGG - Intergenic
1151582468 17:74988075-74988097 CCAGGACTCCTCTTCCTCCGCGG - Exonic
1151620363 17:75241250-75241272 CAAGCAATCCTCCGGCTTCCCGG - Intronic
1151816557 17:76474142-76474164 CCAGCCTTCTTCTGCCCTCCAGG - Exonic
1151976700 17:77487580-77487602 GCAGGACGCCCCTGCCTTCCTGG + Intronic
1151976726 17:77487665-77487687 GCAGGACTCCTCTGCCTTCCTGG + Intronic
1151976746 17:77487749-77487771 GCAGGACGCCCCTGCCTTCCTGG + Intronic
1151998988 17:77632921-77632943 GCAGCACTCCTCTGTTTTTCTGG + Intergenic
1152148110 17:78581387-78581409 CAAGCAGTCCTCGGCATTCCTGG + Intergenic
1152319381 17:79599623-79599645 CAAGCACTCCTCAGCTCTCCCGG - Intergenic
1152569854 17:81116887-81116909 CCAGCTCTCAACTGCCCTCCTGG - Exonic
1152781810 17:82230129-82230151 CCAGCACCCACCTGACTTCCAGG - Intronic
1156030699 18:32708895-32708917 CCAGTACTGCCCTGCCCTCCTGG + Intronic
1156562700 18:38146399-38146421 CCACCACTCCACTGCCACCCTGG - Intergenic
1157992317 18:52511551-52511573 GTAGCACTCCTCTGCCCCCCAGG - Intronic
1158333890 18:56393854-56393876 CCTGCCATGCTCTGCCTTCCTGG - Intergenic
1159090954 18:63848400-63848422 CCAGCACTTGTCTGACTTCACGG - Intergenic
1159603752 18:70453265-70453287 CCAGCAAGCCTCAGCATTCCTGG + Intergenic
1159609919 18:70513697-70513719 CCGGCTCTCCCCTGCCTTCAGGG + Intergenic
1160231834 18:77054559-77054581 CAAGCCCTCCTCTGCCCACCTGG - Intronic
1160505087 18:79422563-79422585 CCCTCACTCCCCTGCCCTCCGGG - Intronic
1160977688 19:1801907-1801929 CCTGCACTCCTCTGTGTTCCTGG + Intronic
1161627727 19:5336972-5336994 CCAGCTCTCCTCTGCATCCAGGG - Intronic
1161948243 19:7452265-7452287 CCCGCCCTTCTCTGCCTCCCTGG - Intronic
1163005820 19:14396116-14396138 CCCCTTCTCCTCTGCCTTCCTGG - Intronic
1163196895 19:15728307-15728329 CCAGCGCTCCATCGCCTTCCTGG + Exonic
1163204726 19:15794312-15794334 CCAGCGCTCCATCGCCTTCCTGG + Exonic
1163206577 19:15807752-15807774 CCAGCGCTCCATCGCCTTCCTGG - Exonic
1163904769 19:20142727-20142749 TCAGCTCACCTCTGCCTCCCAGG - Intergenic
1165039370 19:33058232-33058254 CCAGCACTGCTCAGCACTCCAGG + Intronic
1165100663 19:33436732-33436754 CCTGCCCACCCCTGCCTTCCGGG + Intronic
1165350279 19:35271511-35271533 CCCGCACTCCCATGCCTGCCTGG + Intronic
1165353919 19:35292141-35292163 CTCGCAGTCCCCTGCCTTCCAGG - Exonic
1166387962 19:42392523-42392545 CCATCACTCCTCAGCCCCCCAGG - Intergenic
1166499164 19:43328309-43328331 CCACCCCTTCTCTGCTTTCCTGG - Intergenic
1167042881 19:47032905-47032927 ATAGCCCTCCTCTGCCTTCAAGG - Intronic
1167303270 19:48692148-48692170 CCACCCCGCCTCTGCCTCCCAGG + Intergenic
1167583556 19:50360316-50360338 CCTGCTCTCCTCCACCTTCCAGG - Intronic
1168417283 19:56176676-56176698 CCTCCACCCCTCTGCCCTCCTGG - Intronic
925294886 2:2769755-2769777 CCAGCACTCATCTCCCCTCCGGG - Intergenic
925613633 2:5724721-5724743 CCATCCCTCCTCTGACTTACCGG - Intergenic
925747252 2:7054063-7054085 CCGGCTCTCCCCTGCCTTCAGGG - Intronic
925912310 2:8581859-8581881 CAGGCAGTCCTCTGGCTTCCAGG + Intergenic
926772944 2:16394206-16394228 TTTGCACTCCTCTGCCTTCCAGG + Intergenic
928665687 2:33548527-33548549 CCAGCACTCTCCAGCCTCCCCGG - Intronic
929061157 2:37925570-37925592 CCAGCGGTGCTCTGCGTTCCCGG + Intronic
929789691 2:45013757-45013779 CCGCCACCCCTCTGCCCTCCAGG + Intergenic
929878188 2:45814387-45814409 TCAGCAAACCACTGCCTTCCAGG - Intronic
930107886 2:47654409-47654431 CCGGCTCTCCCCTGCCTTCAGGG + Intergenic
930651065 2:53965743-53965765 GCAGCCAGCCTCTGCCTTCCGGG + Intronic
931275935 2:60743967-60743989 CCAGCTCTCCTTTGCCTTCAGGG + Intergenic
931276292 2:60746506-60746528 CCGGCTCTCCTTTGCCTTCAGGG + Intergenic
931980181 2:67686110-67686132 TCACCACTCATCTGCCTGCCTGG + Intergenic
932379360 2:71268313-71268335 TCATCCCTCCTCAGCCTTCCAGG - Intergenic
932566795 2:72916022-72916044 CCAGCACTCCTCCGCGTCCTGGG - Intergenic
932580506 2:72990112-72990134 CCAGCACTTCCTTGTCTTCCTGG - Intronic
933739826 2:85524718-85524740 CCAGCACTCCACAGCCTTCTAGG + Intergenic
933782272 2:85811012-85811034 CCAGCACCCCTCTCCCTGCCAGG - Intergenic
933844472 2:86314376-86314398 CCAGCCCTGCAGTGCCTTCCAGG - Intronic
934577047 2:95409382-95409404 TCAGCACACCTCTGCCTCCTGGG + Intronic
934983794 2:98869579-98869601 TCAGCATTCCTCTTTCTTCCTGG - Intronic
935112145 2:100104240-100104262 CCAGCCCTTTTCTGCCTCCCCGG - Intronic
935385815 2:102499121-102499143 CAAGGAGTCCTTTGCCTTCCAGG + Intronic
936075981 2:109402178-109402200 CCTGCTCTGCACTGCCTTCCTGG + Intronic
936076220 2:109403472-109403494 CCAGCCCTCCCTGGCCTTCCAGG + Intronic
936122830 2:109760911-109760933 CCAGCCCTTTTCTGCCTCCCCGG + Intergenic
936221859 2:110610553-110610575 CCAGCCCTTTTCTGCCTCCCCGG - Intergenic
937256857 2:120561707-120561729 CCATCACACCTCTGTCATCCAGG - Intergenic
937474460 2:122202631-122202653 TCAGCACTCCCCCGACTTCCCGG - Intergenic
937826245 2:126371442-126371464 CCAGCTCTCCCTTGCCTTCAAGG + Intergenic
937832036 2:126434695-126434717 CTAGAAAACCTCTGCCTTCCAGG + Intergenic
937866150 2:126753075-126753097 CCAAGACCCCTCTGCCTTCCTGG - Intergenic
940279649 2:151976213-151976235 CCAGCACATTTCTGACTTCCTGG - Intronic
940537080 2:154958981-154959003 TCAGCTCCCCTCTGCCTCCCAGG + Intergenic
940638285 2:156323127-156323149 TCAGCACTCATCTCCCTCCCAGG - Intergenic
941044391 2:160655967-160655989 TCAGCATTCCTCTGACCTCCTGG - Intergenic
943696462 2:190940672-190940694 CCAGGATTCTTCTGGCTTCCTGG + Intronic
943732629 2:191319040-191319062 GCAGCCCTCCTCTTCCTTACTGG - Intronic
944341449 2:198605536-198605558 CCACCACTCCTTTGGGTTCCAGG - Intergenic
946214378 2:218172778-218172800 TCAGCTCACCTCTGCCTCCCAGG - Intergenic
946313487 2:218895624-218895646 CTAACCCTCCTCTGCCTTCAAGG + Intronic
947636067 2:231681250-231681272 CCCGCTCCCCTCTGCCTTCCCGG + Intergenic
947663954 2:231891319-231891341 CCAGCTCTCCACTGCCTTCAGGG - Intergenic
949056943 2:241932863-241932885 CCAGCACATCTCAGCCTCCCTGG + Intergenic
1168775244 20:441804-441826 GCATCACTCCTCAGCCGTCCTGG - Intronic
1169189713 20:3650479-3650501 CCAGGAGGCCTCTGCCGTCCTGG - Exonic
1169257317 20:4109395-4109417 CCACCAATCCTCTGACTTCGTGG + Intergenic
1169266008 20:4167786-4167808 CCAGCAGTCCTTTTACTTCCTGG + Intronic
1169789199 20:9391843-9391865 CCTGCTCTTCTCTGCCTTCCAGG + Intronic
1171196139 20:23201055-23201077 CCGCCACTCCTCAGCCTCCCTGG - Intergenic
1172108150 20:32528726-32528748 CCAGCAGTCCGTTCCCTTCCGGG - Intronic
1172227074 20:33312120-33312142 CCACGACTCCACTGCCTTGCTGG + Intergenic
1172811641 20:37652196-37652218 CCCTCTCTCCTCTTCCTTCCAGG - Intergenic
1173221221 20:41134607-41134629 TCAGCCCCCGTCTGCCTTCCTGG + Intergenic
1173743078 20:45416260-45416282 TCATCACCCCGCTGCCTTCCGGG + Exonic
1173860584 20:46280631-46280653 TCAGCACTACACTGCCTCCCAGG - Intronic
1174088225 20:48025413-48025435 CCTGCACTCCTCAGCCCTCGTGG - Intergenic
1174400220 20:50271989-50272011 TCCGCCCACCTCTGCCTTCCTGG + Intergenic
1174482672 20:50842354-50842376 TCATCTCTCCTCTGTCTTCCTGG + Intronic
1175560823 20:59928154-59928176 ACAGCATTCCTCTTTCTTCCTGG - Intronic
1175865953 20:62176725-62176747 TCAACTCACCTCTGCCTTCCCGG - Intronic
1175900991 20:62359880-62359902 CCCGCCCTCCTCAGCCTTCCAGG + Intronic
1176139040 20:63537180-63537202 CCACCACTGCTCCTCCTTCCTGG + Exonic
1176386643 21:6141315-6141337 CCAGCTCTACTCTGCCTGCGCGG + Intergenic
1176893467 21:14347325-14347347 CCTGCAAACCTCTGCCTCCCAGG - Intergenic
1177735082 21:25079145-25079167 CCTGCACTCATCTCCTTTCCTGG - Intergenic
1179012575 21:37567308-37567330 CCAGCTCTCCCTTGCCTTCAAGG - Intergenic
1179022925 21:37656378-37656400 CCAGCTCTCCTCTCCCTGCTGGG + Intronic
1179144492 21:38755590-38755612 GCAGCAGTCCTCTGCTTTGCTGG - Intergenic
1179179143 21:39030607-39030629 CCAGCCCTCACCTGCATTCCTGG + Intergenic
1179296269 21:40065651-40065673 CCAGTACTCTCCTGCCTTCCAGG + Intronic
1179736830 21:43396937-43396959 CCAGCTCTACTCTGCCTGCGCGG - Intergenic
1179879254 21:44286628-44286650 CCAGGACTCCACAGCCATCCTGG + Exonic
1180155813 21:45977056-45977078 CCTGCCCTCCCCTGCCTCCCGGG + Intergenic
1180845071 22:18976368-18976390 CCAGCTCTGCCCTGCCTCCCAGG + Intergenic
1180872552 22:19154780-19154802 GCAGCCTGCCTCTGCCTTCCAGG + Intergenic
1181003560 22:19999099-19999121 CCTGGCCTCCTCTGCCTCCCTGG - Intronic
1181037600 22:20177446-20177468 CCAGAGCACCTCTGCCCTCCAGG + Intergenic
1181177930 22:21048234-21048256 CCATCACTCCCCTCCCTTGCTGG + Intronic
1182074366 22:27484949-27484971 CCAGCCTTGCTCTGCCATCCAGG + Intergenic
1182325773 22:29511527-29511549 CCTGCACACCTCTGTTTTCCTGG - Intronic
1182522563 22:30892595-30892617 CCGGCCCTCCCCTGCCTTGCTGG - Intronic
1183449917 22:37887708-37887730 CCAGCTCTCCTCTCCCTCCCTGG + Intronic
1183544613 22:38448890-38448912 CCAGCTCCCCTCTGCCCTGCTGG + Intronic
1183623482 22:38988020-38988042 CCAGCACTGCTGTCCCTCCCGGG - Intronic
1183723151 22:39573814-39573836 CCAGTACTCCTCTCCCTCCTGGG - Intronic
1184490823 22:44807790-44807812 TCAGCAGTCCTGGGCCTTCCAGG + Intronic
1184921713 22:47609957-47609979 CCAGCACTCCCCTGGCTGCGCGG + Intergenic
1185157854 22:49205052-49205074 CCATTACTCCACTGCCTTCAGGG - Intergenic
1185288104 22:50011246-50011268 CCAGCACTTCCCCTCCTTCCTGG + Intronic
1203325160 22_KI270738v1_random:6498-6520 CCAGCACTGCTTGGCATTCCTGG + Intergenic
949327292 3:2881017-2881039 CCAACACTCCTCATCATTCCAGG + Intronic
950106769 3:10393523-10393545 CCATCCCAGCTCTGCCTTCCTGG - Intronic
950272891 3:11633370-11633392 CTGGCCCTCCTCTGCCTTCTTGG - Intronic
950385236 3:12653667-12653689 TCAGCTCTCCTCTGCCTCCTGGG - Intronic
950510909 3:13426009-13426031 CCAGCCCTCCACAGCCTCCCAGG + Intergenic
951726377 3:25765382-25765404 TCAGCTCACCTCTGCCTCCCAGG - Intronic
952384464 3:32830028-32830050 CCAGCATTCTCCTGCCTCCCCGG + Intronic
953164845 3:40455783-40455805 CAAGCAGTTCTCTGCCTCCCGGG - Intergenic
953498245 3:43407440-43407462 CCTGCACTTCTCTGACTCCCAGG + Intronic
953570252 3:44065818-44065840 CCTGCACTCCCCCGCCTTGCTGG + Intergenic
953699466 3:45184627-45184649 TCAGCTCCCCTCTGCCTTCCAGG + Intergenic
954198805 3:49012185-49012207 CCAGCAATCCCTTGCTTTCCAGG - Exonic
954291825 3:49653938-49653960 GTGGCACTCCTCAGCCTTCCCGG + Exonic
954989682 3:54829993-54830015 CAAGCAATTCTCTGCCTCCCGGG + Intronic
955324876 3:58002213-58002235 TCAGCTCACCTCCGCCTTCCAGG - Intergenic
956490185 3:69762959-69762981 CCAGCAATCCTCAGTCGTCCTGG + Intronic
956727603 3:72169263-72169285 CCATCCCTCCTCTACCTTCAGGG + Intergenic
956853080 3:73249219-73249241 ACAGCTCTCATCTGCCTCCCTGG + Intergenic
957475246 3:80713882-80713904 TCACCACGCCTCTGCCTTCTGGG - Intergenic
957897188 3:86438205-86438227 TCTGCTCACCTCTGCCTTCCAGG + Intergenic
957965105 3:87312176-87312198 CCAGCAGTACCCTGCCTTCTTGG - Intergenic
960517550 3:118618716-118618738 TCAGCACTTTTCTGGCTTCCAGG + Intergenic
961287749 3:125820148-125820170 ACAGGACACCTCTGCCTCCCAGG - Intergenic
961786166 3:129348102-129348124 CCAGCCCGCCTCTTGCTTCCTGG - Intergenic
962058660 3:131901767-131901789 CCAGCACTCCTCTGGGTGACAGG - Intronic
962273072 3:133992467-133992489 CCTGCCCTCTTCTGCCTGCCTGG - Intronic
962969594 3:140386569-140386591 CCAGCTCTCCCCTGCCTTCAGGG + Intronic
963844406 3:150140824-150140846 CCAGCTCTCCCTTGCCTTCAGGG + Intergenic
963942848 3:151112379-151112401 CAAGCAATTCTCTGCCTTCTAGG + Intronic
965933101 3:174071249-174071271 CCAACATTTCTCTGTCTTCCTGG - Intronic
966667358 3:182486948-182486970 CCAGCATTCCTATCCCTGCCAGG - Intergenic
966900623 3:184481385-184481407 CCAGTACTCTTCTGTCTGCCTGG + Intronic
966906263 3:184528038-184528060 CCTATACTCCTCTGCCTCCCAGG + Intronic
966940470 3:184742946-184742968 CCATCCCTCCTCTCCCTTCTTGG - Intergenic
967212388 3:187180290-187180312 CCACCCCTTCTCTGCTTTCCTGG - Intronic
968270492 3:197399632-197399654 CCAGCTCTCCTCTGCATCCCTGG - Intergenic
968449984 4:670959-670981 CCAGCCCTGCACTGCCCTCCTGG - Intergenic
968556142 4:1247452-1247474 CCAGGTCTCCCCTGCCTGCCCGG - Intronic
968759969 4:2437541-2437563 GCCCCACTCCTCTCCCTTCCTGG - Intronic
968799557 4:2733188-2733210 CTCACCCTCCTCTGCCTTCCTGG - Intergenic
968952922 4:3703794-3703816 CCAGGACTCTCCTGCCTCCCTGG + Intergenic
969010163 4:4055362-4055384 ACAGGACACCTCTGCCTCCCAGG + Intergenic
969224892 4:5789327-5789349 CTTGCACTCCTCTGGCTTTCTGG + Intronic
969401059 4:6955823-6955845 CCAGCTGTCCTCTGCCTTCAGGG + Intronic
969576451 4:8038809-8038831 GCAGCTCCCCTCTGCCTTCTGGG + Intronic
969599471 4:8167397-8167419 CCATCACACCCCTGCCTGCCAGG + Intergenic
969640939 4:8398083-8398105 CAACCTCTCCTCTGCCTCCCGGG - Intronic
969669886 4:8583765-8583787 CCAGCTCTCTCCTGCCTGCCAGG + Intronic
969803470 4:9588003-9588025 ACAGGACACCTCTGCCTCCCAGG - Intergenic
969846429 4:9923620-9923642 CCAGCTCTCCCTTGCCTTCAGGG - Intronic
970001931 4:11373019-11373041 GCAGCACCCCTCTGCCAGCCGGG + Intergenic
971346572 4:25816928-25816950 CCAGAACACCTCAGCCCTCCAGG + Intronic
972991894 4:44830740-44830762 CCAGCTCTCCCTTGCCTTCAGGG - Intergenic
973774730 4:54232919-54232941 CTAGCTCTCCTCAGCATTCCCGG + Intronic
975754304 4:77557730-77557752 CCAGCACTCCTCAGCAGGCCAGG - Intronic
975838557 4:78450345-78450367 CCAGTTCTCTTCTGCCTACCAGG + Intronic
976821637 4:89213596-89213618 CCAGCAATCCTCAGCCATTCTGG - Intergenic
980423909 4:132600094-132600116 CCAGCACAGCTCTGGCCTCCTGG - Intergenic
980974638 4:139598900-139598922 GCAGCAGTCCTCATCCTTCCGGG - Intronic
981075677 4:140588962-140588984 CCAGCTCTCCCTTGCCTTCAGGG + Intergenic
981748606 4:148073150-148073172 CCAGCATGCCTCTGCCTTCCAGG + Intergenic
983453013 4:167930345-167930367 TCAGAACTTTTCTGCCTTCCAGG - Intergenic
983778788 4:171642577-171642599 CCAGCTCTCCCTTGCCTTCTGGG - Intergenic
985158449 4:187018173-187018195 CCTGCAGTCCTCTGCTTACCTGG - Intergenic
985573422 5:662689-662711 CCTGCCCTCCTCGGCCTCCCTGG - Exonic
985926697 5:3024827-3024849 CCAGCCGTCCTCTCCCTTCAAGG + Intergenic
987290537 5:16504483-16504505 CCATCACACCGCTGCCTACCTGG + Intronic
989456495 5:41650127-41650149 CCAGCTCTCCCCTGACTTCAGGG - Intergenic
989646884 5:43643909-43643931 TCAGCACTGCTCTCCCTACCCGG - Intronic
991607791 5:68420731-68420753 TGAGTACTCCTCTGCCTACCAGG - Intergenic
993899904 5:93578450-93578472 CCTTCCTTCCTCTGCCTTCCTGG - Intergenic
995294569 5:110504673-110504695 GCAGAACTCCTCTGCCTGACTGG - Intronic
995347310 5:111135424-111135446 GCAGCACACATCTGCCTTCTCGG + Intergenic
997230120 5:132236168-132236190 CCAGCACTCTTCTGGGTTTCAGG + Intronic
997464442 5:134078000-134078022 CCACCTCTCCCCTGCCTCCCAGG - Intergenic
997586997 5:135049116-135049138 CCTGCATTCCTCTGTCCTCCAGG - Intronic
1000264467 5:159621428-159621450 CCAGCTTTCCTCCACCTTCCTGG + Intergenic
1001524869 5:172421677-172421699 CACACACTCCTGTGCCTTCCCGG - Intronic
1001535842 5:172497330-172497352 CCCGGACTCAGCTGCCTTCCAGG - Intergenic
1001656566 5:173355303-173355325 CTAGCACCCCTCTGCCTCGCAGG - Intergenic
1002069719 5:176672094-176672116 CCTACACTGCTCAGCCTTCCTGG - Intergenic
1002473220 5:179449942-179449964 CAGCCCCTCCTCTGCCTTCCTGG - Intergenic
1002481002 5:179500711-179500733 CAGCCCCTCCTCTGCCTTCCTGG + Intergenic
1002759689 6:191933-191955 CCAGCACCCCTCTGTCTTCTGGG - Intergenic
1004470489 6:15924633-15924655 CCACCAATCCTCTCCCATCCTGG + Intergenic
1005562938 6:27059969-27059991 CCGGCTCTCCCCTGCCTTCAGGG + Intergenic
1005661511 6:28003373-28003395 CCTGCTCTCCCCTGCCTTCAGGG - Intergenic
1006339160 6:33436967-33436989 CCAGCAGTCCTTGGCATTCCTGG + Intronic
1007647423 6:43393711-43393733 CCAGCTCTCCCTTGCCTTCAGGG - Intergenic
1007934305 6:45719479-45719501 CCATCTCTCCTCTACCTCCCAGG - Intergenic
1009029374 6:58038196-58038218 CCACCCCTCCTCTGCCTTCTTGG + Intergenic
1009204917 6:60789586-60789608 CCAACCCTCCTCTGCCTTCTTGG + Intergenic
1010141737 6:72621536-72621558 ACAGCCCTGCCCTGCCTTCCAGG - Intergenic
1011032397 6:82937904-82937926 CCATCATTCCTGTCCCTTCCTGG + Intronic
1012413176 6:98983444-98983466 CCAGCACTCCTGCCCCTGCCTGG - Intergenic
1012524502 6:100161074-100161096 CCAGCGCTCCTCTCCCTACAGGG + Intergenic
1014170264 6:118270827-118270849 CCAGGACTTCTCTGCTTGCCTGG + Intronic
1015454597 6:133411947-133411969 CAAGAACTCCTCTGCCATGCTGG - Intronic
1017042184 6:150316457-150316479 CCAGGACCCCTCAGCCTTGCTGG - Intergenic
1017327177 6:153152715-153152737 CCAGCTCTCCCTTGCCTTCAGGG - Intergenic
1017788892 6:157778171-157778193 CCAGCAATCCTTAGCCTTTCTGG + Intronic
1018519767 6:164635165-164635187 CCAGCATCCCTGTGCATTCCTGG - Intergenic
1018536620 6:164827253-164827275 CCAGCTCTCCTCTGCCTTCAGGG - Intergenic
1019541645 7:1554394-1554416 CCAGCCCTCCACAGCCTTCCTGG + Intronic
1020282402 7:6656200-6656222 CCAGCACCCCAATGCCTCCCTGG - Exonic
1021925273 7:25528479-25528501 TCAGCACTCTTCTGATTTCCTGG - Intergenic
1022523531 7:31022897-31022919 CCACGCCTCCTCTGCCTCCCTGG - Intergenic
1023817581 7:43962222-43962244 CCTGCACAGCTCTGCCTCCCAGG + Intergenic
1024883417 7:54115169-54115191 CCAGCACAGCTCTGCTGTCCTGG + Intergenic
1026947856 7:74327799-74327821 CCAGCACCTGTCTGCCTGCCTGG + Intronic
1027177498 7:75914274-75914296 CCCCCACTCCTCTTCCATCCAGG + Intronic
1028500577 7:91514859-91514881 CCTTCACTCCTCACCCTTCCTGG + Intergenic
1029069271 7:97881924-97881946 ACAGGACACCTCTGCCTCCCAGG + Intergenic
1029238890 7:99144322-99144344 CCAGCTCTGCTCTCCCTTCCCGG - Intergenic
1032085011 7:128879332-128879354 TCAGAACTCCTCTGACTGCCTGG + Intronic
1032197327 7:129796813-129796835 CCAGCACTGTGCTGGCTTCCTGG + Intergenic
1032229491 7:130061929-130061951 CCATCCCTCCTCTCCCTCCCTGG + Intergenic
1032762147 7:134953398-134953420 CCAGCTAACCTCTGCCTCCCAGG - Intronic
1033177291 7:139136495-139136517 CCATCACGCCACTGCATTCCAGG - Intronic
1034093264 7:148383262-148383284 GCAGCCCTGCTCTGCCCTCCTGG - Intronic
1034266433 7:149783313-149783335 CCTGCACAGCTCTGTCTTCCAGG + Intergenic
1034443890 7:151101867-151101889 CCGGCCCACCTTTGCCTTCCAGG - Intronic
1035381721 7:158445062-158445084 CCAGCTCTCCCCAGCCCTCCTGG - Intronic
1035670911 8:1416550-1416572 CCAGAACCCCTCTGCCTCCACGG + Intergenic
1035671621 8:1422518-1422540 CAAACACTCTTCTGCCTTCATGG - Intergenic
1036642676 8:10593821-10593843 CCAGCTCTCCTCTTTCTTCAAGG + Intergenic
1036693811 8:10961633-10961655 CCAGCACACCTCCAGCTTCCTGG + Intronic
1036705422 8:11042900-11042922 CCTGCACTCCTCTTCCTGCCAGG + Intronic
1036821123 8:11940964-11940986 CGATCTCTCCTCTGCCTCCCAGG - Intergenic
1037893633 8:22637308-22637330 TCTGCACTCTGCTGCCTTCCTGG - Intronic
1037903166 8:22700065-22700087 CAAGCAATTCTCTGCCTCCCGGG + Intergenic
1039555354 8:38471332-38471354 TCAGCTCACCTCTGCCTTCTGGG + Intergenic
1039608415 8:38901164-38901186 CCGGCACCCCTCTCCCTCCCCGG + Intergenic
1039841686 8:41297971-41297993 CCAGCACTTCCCTGGCATCCAGG - Intronic
1040598929 8:48865497-48865519 CCCTCAGGCCTCTGCCTTCCAGG - Intergenic
1042426641 8:68656753-68656775 CCTGGATCCCTCTGCCTTCCTGG + Intronic
1042450577 8:68940624-68940646 CCAGCTCTCCCTTGCCTTCAGGG + Intergenic
1043354875 8:79400626-79400648 CCAACTCTCCTCTTACTTCCGGG + Intergenic
1044727398 8:95204575-95204597 CCAGCTCTCCCTTGCCTTCAGGG - Intergenic
1044821366 8:96158157-96158179 CCAGCCCTCCACCGCATTCCGGG + Intronic
1046184084 8:110690373-110690395 CCGGCTCTCCCCTGCCTTCAGGG + Intergenic
1046619131 8:116509254-116509276 CCATCACTCCTTAGACTTCCTGG - Intergenic
1047097543 8:121640615-121640637 CCAGAAATCCGCTGCCTTTCTGG - Intronic
1048283764 8:133125161-133125183 GCAGCTCTTCTCTGCCTTGCAGG - Intronic
1048948420 8:139472289-139472311 CCAGAAATCCTCTACCTTCATGG - Intergenic
1049190409 8:141284409-141284431 CCAGCACTCCACGGCCATCCGGG + Intronic
1049277954 8:141729323-141729345 CCAGAGATGCTCTGCCTTCCTGG + Intergenic
1049428813 8:142549826-142549848 GCAGCACACCTCTGCCCACCCGG + Intergenic
1049618405 8:143586625-143586647 CCAGGGTGCCTCTGCCTTCCTGG + Intronic
1049781198 8:144429755-144429777 CCAGCACTCGGGGGCCTTCCTGG + Intronic
1049924588 9:396463-396485 CCAGCTCAGGTCTGCCTTCCAGG + Intronic
1050092935 9:2033767-2033789 CCAGCAATCCTTGGCATTCCTGG + Intronic
1051166290 9:14265679-14265701 ACAGCATTCCTCTCCCTTCTAGG + Intronic
1051380338 9:16451619-16451641 TCTGCACCCCTCTGCCTTTCTGG + Intronic
1053595059 9:39552219-39552241 CCAGCACACCTCTGGCCTTCAGG + Intergenic
1053852843 9:42307247-42307269 CCAGCACACCTCTGGCCTTCAGG + Intergenic
1053907678 9:42860334-42860356 ACAACCCTCCTCTGTCTTCCCGG - Intergenic
1054571195 9:66812755-66812777 CCAGCACACCTCTGGCCTTCAGG - Intergenic
1054767491 9:69054343-69054365 CCAGCACTTCCCTGGCTTCTAGG - Intronic
1056717371 9:89043206-89043228 CCAGCACACCACTGTCTCCCAGG + Intronic
1057119144 9:92555300-92555322 TCACCACACCTCTGCCTCCCAGG + Intronic
1057973368 9:99578488-99578510 TCAGCACTCCTCTGCCATAATGG + Intergenic
1057986070 9:99715379-99715401 CCTGCAAACCTCTGCCTCCCGGG + Intergenic
1058359799 9:104131255-104131277 CCTGCACTATTCTCCCTTCCTGG - Intronic
1058941496 9:109816798-109816820 CCATGACTCCTCTGCCCTCATGG - Intronic
1059423662 9:114207593-114207615 CCAGCACTCCTGTCTCTTACAGG + Intronic
1059668780 9:116474261-116474283 CCAGCTCTGCTCTGCCTGTCTGG + Intronic
1061029202 9:128069293-128069315 CCAGCACTTCTCTTCCTGGCAGG - Intronic
1061973354 9:134056319-134056341 ACTGCACCCCTCAGCCTTCCAGG - Intronic
1061985762 9:134129368-134129390 CCAGCACCTCCCTTCCTTCCTGG - Intergenic
1062074401 9:134576666-134576688 CAAGCATTCCTGTGCCTTCTGGG + Intergenic
1062543371 9:137051291-137051313 CCAGTACCCCTTTGACTTCCGGG - Exonic
1185684492 X:1917287-1917309 CCACCGCGCCTCTGCCTCCCAGG - Intergenic
1186530744 X:10292800-10292822 CCAGCATTCCTCTGGATGCCTGG - Intergenic
1186613896 X:11166300-11166322 CCAGGTCTGTTCTGCCTTCCAGG + Intronic
1186638107 X:11427660-11427682 CCCGCACTTCACTGCCATCCTGG + Intronic
1187433877 X:19249165-19249187 CAAGCACTCCTCCGCCATCTTGG + Intergenic
1188281947 X:28281096-28281118 CCACCGCACCTCTGCCTCCCAGG - Intergenic
1189569106 X:42276161-42276183 CCAGCAATCCTTGGCATTCCCGG - Intergenic
1195125264 X:101802725-101802747 CCAGCACTCCTGCCCCTTCATGG - Intergenic
1195179476 X:102342910-102342932 CCAGCACTCCTGCCCCTTCGTGG + Intergenic
1195666542 X:107436518-107436540 GTAGGTCTCCTCTGCCTTCCAGG - Intergenic
1196816544 X:119669537-119669559 CCAGCACACCACTGCCTGCCAGG - Intronic
1196856535 X:119990492-119990514 CCAGCACTGCTCTCCCCTCTGGG - Intergenic
1197856092 X:130915562-130915584 CCATTACCCCTCTTCCTTCCTGG - Intergenic
1198301052 X:135334522-135334544 CCACCACTGCTCGGCCTTCTAGG + Intronic
1199949952 X:152699359-152699381 TCAGGACTCCACTGTCTTCCAGG - Intronic
1199959722 X:152769102-152769124 TCAGGACTCCACTGTCTTCCAGG + Intronic
1199983993 X:152937390-152937412 CCAGCTCTCCCTTGCCTTCAGGG + Intronic