ID: 902244885

View in Genome Browser
Species Human (GRCh38)
Location 1:15114303-15114325
Sequence CTCCCTGCTCAGGGAGGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 1, 2: 2, 3: 47, 4: 409}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902244885_902244890 -4 Left 902244885 1:15114303-15114325 CCTCAACCTCCCTGAGCAGGGAG 0: 1
1: 1
2: 2
3: 47
4: 409
Right 902244890 1:15114322-15114344 GGAGTATTATTACTAATAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 99
902244885_902244891 8 Left 902244885 1:15114303-15114325 CCTCAACCTCCCTGAGCAGGGAG 0: 1
1: 1
2: 2
3: 47
4: 409
Right 902244891 1:15114334-15114356 CTAATAGGAGGAGCACACAGAGG 0: 1
1: 0
2: 0
3: 10
4: 113
902244885_902244889 -7 Left 902244885 1:15114303-15114325 CCTCAACCTCCCTGAGCAGGGAG 0: 1
1: 1
2: 2
3: 47
4: 409
Right 902244889 1:15114319-15114341 CAGGGAGTATTATTACTAATAGG 0: 1
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902244885 Original CRISPR CTCCCTGCTCAGGGAGGTTG AGG (reversed) Intronic
900363144 1:2299579-2299601 CTCCTTGCTCTGGGGGGTTGAGG + Intronic
900703000 1:4059455-4059477 GTCCATGCTCAGGGAGCCTGGGG + Intergenic
901064562 1:6488756-6488778 CTCCCTCCCCAGGGAGTTGGGGG - Intronic
901067412 1:6500823-6500845 CTCCCTGCGACGGGAGGTGGGGG - Intronic
901632475 1:10654682-10654704 TTCCCTGCTCAGGGAAGCTTTGG + Intronic
901910094 1:12450005-12450027 ATCCCTGCTACGGGAGGCTGAGG + Intronic
901945363 1:12698180-12698202 CTCAGTGCTTTGGGAGGTTGAGG - Intergenic
902244885 1:15114303-15114325 CTCCCTGCTCAGGGAGGTTGAGG - Intronic
902530726 1:17089166-17089188 CTCCCTCCCAAGGGAGGATGAGG - Intronic
903027796 1:20442018-20442040 TTCCTTGCTCAGGCAGATTGTGG + Intergenic
903063817 1:20687384-20687406 CTACCTGCACAGGGACCTTGGGG + Exonic
903557907 1:24206600-24206622 CTTCCTGCTCAGGGAAGGTAGGG - Intergenic
903697164 1:25216331-25216353 CTCCCTGCTCATGAAGGTGTTGG - Intergenic
904127533 1:28252134-28252156 CCCGCTACTCAGGGAGGCTGAGG - Intergenic
904447893 1:30589264-30589286 CTCCCTGCTCGGGGCGGCAGAGG - Intergenic
904687182 1:32269017-32269039 CCACCTGCTTAGGGAGGCTGAGG + Intronic
906396384 1:45469621-45469643 CACCCTGTTGAGGGAAGTTGGGG - Intronic
906729484 1:48069044-48069066 CTTCCTGCTCAGGGAAACTGAGG + Intergenic
907022122 1:51078156-51078178 CTCAGTGCTCTGGGAGGCTGAGG - Intergenic
907977760 1:59448733-59448755 GACCCTGCTGTGGGAGGTTGTGG + Intronic
908011521 1:59783006-59783028 CTCACTGCTTTGGGAGGCTGAGG - Intergenic
908731341 1:67229543-67229565 CTCTCCCCTCTGGGAGGTTGGGG + Intronic
909600786 1:77459005-77459027 CTCACTGCACAGGGAGTTGGTGG + Intronic
912846934 1:113082990-113083012 CTCAAAGCCCAGGGAGGTTGAGG - Intronic
912964702 1:114227525-114227547 CTACCCTCTCAGGGTGGTTGTGG + Intergenic
915310825 1:155005096-155005118 GTGCCTGCCCAGGGAGGGTGCGG + Intronic
915346417 1:155199637-155199659 CTAGCCACTCAGGGAGGTTGAGG + Intronic
917386048 1:174475653-174475675 ATCCCAGCTCTGGGAGGCTGAGG + Intronic
920308049 1:205031446-205031468 TCCCCTGGCCAGGGAGGTTGGGG - Intergenic
920434024 1:205936643-205936665 CTCCCAGCTCTGGGAGGTAGAGG - Intronic
920441335 1:205982792-205982814 CTTCCTTCCCAGGGAGATTGTGG - Intronic
922620758 1:226986614-226986636 CTCCCTGCACAGGAAGATGGGGG + Exonic
923020922 1:230163217-230163239 CTCACTGCACATGAAGGTTGGGG - Intronic
923090247 1:230735214-230735236 TTCCATGCTCTGGGAGGTAGTGG - Intergenic
923143720 1:231183346-231183368 CTCAGTGCTTTGGGAGGTTGAGG + Intronic
923341090 1:233007788-233007810 CCAACTGCTCAGGGAGGCTGAGG - Intronic
923499413 1:234551850-234551872 CCAGCTGCTCAGGGAGGCTGAGG - Intergenic
923821825 1:237451942-237451964 CTCCCAGGTCACGGTGGTTGTGG + Intronic
924457596 1:244230965-244230987 TTCCCTCCTCAGGGAGGAAGAGG - Intergenic
1062922165 10:1288712-1288734 CTGCCTGCTCCAGGAGTTTGGGG - Intronic
1062982570 10:1737383-1737405 CTCCCTGGTCAGGGAGGGCGGGG + Exonic
1063100322 10:2944738-2944760 CTTCCTTCTAAGGGAGGGTGGGG + Intergenic
1063713955 10:8508991-8509013 CTCTCTTCTCAGGGAGTATGAGG - Intergenic
1063966501 10:11350265-11350287 CTAGCTACTCTGGGAGGTTGAGG - Intergenic
1064589208 10:16871290-16871312 ATCCCAGCACAGGGAGGCTGAGG - Intronic
1065126814 10:22581859-22581881 ATCCCAGCACTGGGAGGTTGAGG + Intronic
1065663621 10:28034516-28034538 CTCCCTGCTCAGGGACCTAGTGG - Intergenic
1069001955 10:63276711-63276733 ATCCCAGCACTGGGAGGTTGAGG - Intronic
1069475070 10:68724667-68724689 CTAGCTATTCAGGGAGGTTGAGG + Intronic
1070472787 10:76800719-76800741 CTGGCTGCCCAGGGAGGCTGAGG - Intergenic
1070504654 10:77102524-77102546 AGCACTGCTCAGGCAGGTTGGGG + Intronic
1070607887 10:77912084-77912106 CTAGCTACTCAGGGAGGCTGAGG + Intronic
1071345120 10:84685067-84685089 CTCCCTGCTCAGGGGGGAAGTGG - Intergenic
1071568419 10:86683475-86683497 CTGCCTGCTCAGGGAAGTGAGGG + Intronic
1071876648 10:89850364-89850386 GTCTCTGCTCAGGGTGGTAGTGG + Intergenic
1073374485 10:103021235-103021257 CTCCTTCGTCAGGGAGGCTGTGG - Intronic
1074202075 10:111246428-111246450 TCCGCTGCTCAGGGATGTTGGGG + Intergenic
1074853134 10:117454607-117454629 CTCCCTGCTCAGGGAGGCAGGGG + Intergenic
1075738176 10:124676910-124676932 AGGCCTGCTCAGGGAGGTTCGGG + Intronic
1075791013 10:125084510-125084532 CTCCCTTCCCAGAGAGGATGGGG - Intronic
1076138686 10:128062959-128062981 CTCCCTTCTCAGGCTTGTTGGGG - Intronic
1076403796 10:130199627-130199649 CTCCCTTCTAAGTGAAGTTGAGG - Intergenic
1076816405 10:132917126-132917148 CTCTCTGCTCAGGGAGCCGGAGG - Intronic
1077032552 11:476055-476077 CTCCCTGCTCAGGGCCTCTGTGG - Intronic
1077216127 11:1395876-1395898 CTCCCTGCTCGGGCAGATGGTGG - Intronic
1077337304 11:2011132-2011154 CTCCGTGCTCAGGGAGCTTCTGG - Intergenic
1077481632 11:2817578-2817600 GTCCCTGGCCAGGGAGGTGGAGG + Intronic
1077514697 11:2994465-2994487 CCCCCTGCTCCTGGATGTTGGGG + Intergenic
1077665388 11:4103736-4103758 ATCCCAGCTGAGGGAGGCTGAGG - Intronic
1077689654 11:4329873-4329895 CTCCCCACTCAGGGTGGCTGTGG + Intergenic
1078188692 11:9074091-9074113 CTCCCTGCTCTGGGTGGGTAGGG - Intronic
1078375234 11:10787775-10787797 CTCACTGCTTTGGGAGGCTGAGG - Intergenic
1078731946 11:13982985-13983007 CTCCCTGCCCTAGGAGGTAGAGG + Intronic
1079101288 11:17543902-17543924 CCCCCAGCTCAGGGCTGTTGAGG - Intronic
1080805538 11:35649712-35649734 CTAGCTACTCAGGGAGGCTGAGG + Intergenic
1080907923 11:36565358-36565380 CAACCTGCTCAGGGGGGTTGGGG + Intronic
1081664871 11:44910899-44910921 ATGGCTGCTCTGGGAGGTTGGGG - Intronic
1081735429 11:45400189-45400211 CTCACTCCTCAAGGAGGATGAGG + Intergenic
1081892711 11:46557553-46557575 ATCCCTGCCCTGGGAGGTTGAGG + Intronic
1082702711 11:56453080-56453102 CTCCATTCTCAAGGAGGCTGTGG - Intergenic
1083587236 11:63869219-63869241 CTCCCTGCCCAGGGTGGGGGTGG - Intronic
1083671390 11:64301789-64301811 CTCCCAGCTCGGGGTGGTGGGGG - Intronic
1083693463 11:64426293-64426315 ATCCCAGCTGAGGGAGGCTGAGG - Intergenic
1083747305 11:64743382-64743404 CTCCCTGGTATGGGAGGTGGGGG + Intronic
1083892067 11:65600432-65600454 TTCCAGGCTCAGAGAGGTTGAGG + Intronic
1084705713 11:70814979-70815001 GTCCCTGCTCTGGGAGTGTGTGG - Intronic
1085415231 11:76315276-76315298 CTCCCTGCCCAGGGAGGTGTGGG - Intergenic
1085636520 11:78163466-78163488 CTCTCTGCTCAGGAATGGTGGGG + Intergenic
1085637095 11:78167336-78167358 CTCTCTGCTCAGGAATGGTGGGG + Intergenic
1085689369 11:78652934-78652956 CTCCCTCCTCTGGGAGGGTTGGG + Exonic
1088474721 11:110223235-110223257 CCAGCTGCTCAGGGAGGCTGAGG + Intronic
1088779913 11:113123949-113123971 TTGCCTGCTCAGGGTGGTTGGGG + Intronic
1089287589 11:117417569-117417591 CTCCCGGCTCGGGCAGGATGGGG + Intergenic
1089443335 11:118533322-118533344 CTCCTTGCCCAGGGTGGCTGGGG - Intronic
1202820288 11_KI270721v1_random:66314-66336 CTCCGTGCTCAGGGAGCTTCTGG - Intergenic
1091781371 12:3216406-3216428 CTCGCTGGTCAGAGTGGTTGGGG + Intronic
1092836633 12:12495659-12495681 CTCTCTGTTCAGTGAGGCTGAGG + Intronic
1093863857 12:24200991-24201013 CTCCCTGACCAGGGAGGTGGAGG - Intergenic
1095867023 12:46983490-46983512 ATCCCTGCACAGGAAGGGTGGGG - Intergenic
1095951881 12:47786062-47786084 CTCAAGGCTCAGGGAGGTTAAGG + Intronic
1096148100 12:49293189-49293211 CTCCCTGCTCCTGGAGGGTGGGG + Intergenic
1096238088 12:49943301-49943323 CTCCCTGCTCAGAGGAGCTGCGG - Intergenic
1096647311 12:53045888-53045910 CTCACTGCTAAAGGACGTTGGGG + Intergenic
1096769257 12:53923686-53923708 CTCCCTGCACAGATAGGGTGTGG + Intergenic
1096805794 12:54140481-54140503 TTCCCTTCCCAGGGAGGTTTAGG - Intergenic
1096912970 12:55002613-55002635 CTCATTGCTCAGAGTGGTTGGGG - Intergenic
1098102693 12:67035304-67035326 CACCCTGCTGAGGGGGGCTGAGG - Intergenic
1098371775 12:69767803-69767825 ATCTCTGCACAGGAAGGTTGGGG + Intronic
1098823197 12:75259426-75259448 CTGACTGCTCAGGGAAGTGGTGG + Intergenic
1102173984 12:110862602-110862624 CTCCCTGTTAAGGGAAGCTGTGG - Intronic
1102526132 12:113513690-113513712 CTCTGTCCTCAGGGAGGTTTAGG - Intergenic
1103983482 12:124751786-124751808 CTCAGTGCTTTGGGAGGTTGAGG - Intergenic
1103989017 12:124785967-124785989 ATCCCTGCTCAGGGGGATTGAGG - Intronic
1104014353 12:124952359-124952381 CTCCCTGCCCGGGTAGCTTGGGG - Intronic
1107385530 13:39904505-39904527 CTCCATGCTCTGGGTGTTTGAGG + Intergenic
1110305105 13:73977294-73977316 ATCCCAGCTCTGGGAGGCTGAGG - Intronic
1111905017 13:94245306-94245328 CTCAGTGCTTTGGGAGGTTGAGG + Intronic
1112431031 13:99350405-99350427 CTCCCTAATCACAGAGGTTGGGG - Intronic
1112996819 13:105584642-105584664 ACCCCTGCTTAGGGAGGCTGAGG + Intergenic
1113225136 13:108151520-108151542 CTCCATGCTTTGGGAGGCTGAGG + Intergenic
1113282998 13:108811322-108811344 CTCCCTGGTCAGAGGGGTAGGGG - Intronic
1113593028 13:111513981-111514003 CGCCCTGCCTAGGGAGGATGTGG - Intergenic
1115561742 14:34588881-34588903 CTCCCTCCTTTGGGAGGCTGAGG + Intronic
1116657027 14:47665867-47665889 CGCGCTCCTCAGGGAGGCTGAGG - Intronic
1117551650 14:56843112-56843134 GTCCCAGCTGAGGGAGGCTGAGG - Intergenic
1118500933 14:66362022-66362044 CTCCCTGCTCTGGCAGCCTGTGG + Intergenic
1118834758 14:69469659-69469681 CTCCGTGCTTTGGGAGGGTGAGG - Intergenic
1118990433 14:70792614-70792636 CACCCTGGTCAGGGATGATGTGG - Intronic
1119313306 14:73669231-73669253 CTAGCTACTCAGGGAGGCTGAGG - Intronic
1119650749 14:76381194-76381216 GTCCCTGCGCGGGGAGGTTGTGG + Intronic
1120037554 14:79715348-79715370 CTCTCTGCTCAGGGAGTTTTGGG - Intronic
1120764000 14:88311824-88311846 GTCCCTTGTCAGGGTGGTTGGGG + Intronic
1121006703 14:90495418-90495440 GTCCCTGCTCAGGGTGAGTGAGG - Intergenic
1121210387 14:92203973-92203995 CTCCCTGTTGGGGGAGGTGGGGG + Intergenic
1121323760 14:93007855-93007877 CTTCCTCCTCAGAGAGCTTGGGG + Intronic
1121429194 14:93874799-93874821 CTCCCTGGTCAGTGAGGTGCAGG + Intergenic
1122037034 14:98956431-98956453 CTCCCTGCTCCGGGTGCATGTGG - Intergenic
1122181427 14:99957719-99957741 CTCAGTGCTTAGGGAGGCTGAGG - Intergenic
1123022923 14:105410688-105410710 CCCCCTGGTGAGGGAGGTGGAGG + Intronic
1123109003 14:105856585-105856607 CTCCCTGCTCAGAATGGCTGAGG + Intergenic
1123492440 15:20792822-20792844 CACTGTGCCCAGGGAGGTTGAGG - Intergenic
1123548942 15:21361914-21361936 CACTGTGCCCAGGGAGGTTGAGG - Intergenic
1123660415 15:22559907-22559929 CACGCTGCTCATGAAGGTTGTGG + Intergenic
1123986587 15:25651704-25651726 ATCCCAGCTGAGGGAGGCTGAGG - Intergenic
1124612356 15:31216679-31216701 CACCCTGCTCCTGGAGGTTCTGG - Intergenic
1125618028 15:41033447-41033469 CTCTCTACTCAAGGAGGCTGAGG - Intronic
1126031572 15:44504616-44504638 ATCCCTGCACTGGGAGGCTGAGG + Intronic
1127455593 15:59153597-59153619 CTCCCTGGTCCGGGACCTTGAGG + Exonic
1128138344 15:65281027-65281049 CTCGCTGCTTAGTGTGGTTGAGG - Intronic
1128619645 15:69137905-69137927 CTCTCCCCTCATGGAGGTTGGGG - Intergenic
1129014029 15:72450104-72450126 ATCCCTGCTACGGGAGGCTGAGG - Intergenic
1129098156 15:73231617-73231639 CTAGCTGCTCAGGGAGGCTGAGG + Intronic
1129699415 15:77759025-77759047 CTCCTTACTCAGGGAGGGTGGGG - Intronic
1130384684 15:83400847-83400869 CTGCCTCCTCAGGGAAGATGAGG - Intergenic
1130526245 15:84709279-84709301 CCAGCTGCTCAGGGAGGCTGAGG - Intronic
1130746547 15:86659956-86659978 TTCCCTGCTCATGGACTTTGGGG + Intronic
1130823143 15:87516251-87516273 CTTCCTTCTCAGGGAGGAAGAGG - Intergenic
1130867591 15:87945679-87945701 CTCCCTGTTCTGGGAGAATGAGG + Intronic
1131171803 15:90184517-90184539 CTCCAGGCTCAGAGAGGTTAAGG + Intronic
1131992071 15:98102310-98102332 CTGGCTACTCAGGGAGGCTGAGG - Intergenic
1132602810 16:781534-781556 CACCCCTCTCAGGGAGGGTGAGG + Intronic
1132854131 16:2037257-2037279 CTGCCTCCTCAGGGAGCTGGCGG + Intronic
1132955372 16:2589571-2589593 CTAGCTGCTTGGGGAGGTTGAGG + Intronic
1133021422 16:2968623-2968645 GTCCCTGCTCAGGGTGGACGGGG + Intronic
1133045767 16:3087518-3087540 CTCCTTCCTCAGGAAGGCTGGGG - Intergenic
1133283525 16:4680236-4680258 CTCCCTGCCCAGGGAGTTTGTGG + Intronic
1134283753 16:12841830-12841852 ATCCCAGCTCAGGGAGGCTGAGG - Intergenic
1134821241 16:17249078-17249100 CCCCGTCCTCAGGGAGCTTGTGG - Intronic
1134839139 16:17387400-17387422 TTCCCTGCTGAGGGAGGTGGGGG - Intronic
1134998155 16:18755358-18755380 GTCTGAGCTCAGGGAGGTTGAGG - Intergenic
1135983132 16:27164153-27164175 CTTGCTACTCAGGGAGGCTGAGG - Intergenic
1141664102 16:85457067-85457089 CTGCCTGCTCGGGGTGGCTGTGG + Intergenic
1141677011 16:85523400-85523422 CTCCATGCTCAGGAAGGTGCTGG + Intergenic
1142000110 16:87659469-87659491 ATCCCAGCACTGGGAGGTTGAGG + Intronic
1142523242 17:519590-519612 CCACCTGCACAGGGAGGATGGGG - Intronic
1142594611 17:1023382-1023404 CTGCCTGCACAGGGAGGCAGTGG - Intronic
1142649559 17:1339071-1339093 CTCAGTGCTCAGAGAGGCTGAGG + Intergenic
1142766969 17:2070338-2070360 CTCCCTGAGTAGGGAGGTGGAGG + Intronic
1142861571 17:2765325-2765347 CTCCCGGCTCAGGTAAGATGGGG - Intergenic
1143098230 17:4489895-4489917 GTCCCAGCTCTGGGAGGCTGAGG + Intergenic
1143756737 17:9072943-9072965 CTCCCTGCTACAGGAGGGTGGGG - Intronic
1144143029 17:12368548-12368570 CCACCTACTCAGGGAGGCTGAGG - Intergenic
1144682438 17:17204844-17204866 CTCCCTGCTCTGGGTGGTGTGGG - Intronic
1146479700 17:33195170-33195192 GCCTGTGCTCAGGGAGGTTGGGG - Intronic
1146863295 17:36323526-36323548 CTCCCTGCCCAGGGTGGTCCTGG - Intronic
1146880589 17:36439845-36439867 CTCCCCGCCCAGGGTGGTCGTGG + Intergenic
1147066155 17:37924114-37924136 CTCCCTGCCCAGGGTGGTCCTGG - Intergenic
1147093625 17:38127609-38127631 CTCCCTGCCCAGGGTGGTCCTGG - Intergenic
1147212306 17:38878802-38878824 CTGCCTGGTGAGGGAGGCTGTGG + Intronic
1147702072 17:42402593-42402615 CCCTCTGCCGAGGGAGGTTGGGG - Exonic
1148046020 17:44745263-44745285 TTCTCTGCTCAGGGAGGCTTAGG - Intronic
1148164751 17:45475545-45475567 CGCCCTGCTCCGGGATGCTGAGG - Exonic
1148272099 17:46269414-46269436 ATCCCAGCTGAGGGAGGCTGAGG + Intergenic
1148820019 17:50354862-50354884 CTACCTGCACCGGGAGGTGGTGG + Exonic
1149300947 17:55304297-55304319 CTCCCGGCCCAGGGAGGAGGAGG + Intronic
1149471570 17:56920405-56920427 CTGGCTACTCAGGAAGGTTGAGG - Intergenic
1149848161 17:60019397-60019419 CTCCCTGCCCAGGGTGGTCCTGG + Intergenic
1150086513 17:62275979-62276001 CTCCCTGCCCAGGGTGGTCCTGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150395970 17:64822212-64822234 CGCCCTGCTCCGGGATGCTGAGG - Intergenic
1150722475 17:67625408-67625430 CTCCCGGCTCTTGGAGGTGGAGG - Intronic
1151529840 17:74697192-74697214 CTCCGCACTTAGGGAGGTTGAGG - Intronic
1151750149 17:76032537-76032559 CTCCCTGCTGAGGCAGATGGTGG + Intergenic
1151784702 17:76269837-76269859 CTCCCTGCCCAGGGAAGGTGCGG + Intronic
1151908023 17:77061913-77061935 CCCCCTGCTCAGGGTGGCTCTGG + Intergenic
1152558816 17:81067777-81067799 CTCCCTGCTCTGGCCGGCTGAGG - Intronic
1152609779 17:81309868-81309890 GGCCCTGCTCCGGGGGGTTGGGG + Intergenic
1153355839 18:4134323-4134345 CTCCCTGGGGCGGGAGGTTGGGG + Intronic
1155740405 18:29281883-29281905 TTCCCTGCTCAGGGAGGCTCTGG - Intergenic
1157147697 18:45181370-45181392 CTCCCTGCTCAGGGTGGCAGAGG + Intergenic
1157295319 18:46437960-46437982 CTCCAGGCTCAGGGAGCTTTGGG - Intronic
1157314423 18:46576009-46576031 CTGCCTGCAGAGGGATGTTGAGG - Intronic
1157830147 18:50850163-50850185 ATCCCAGCTGAGGGAGGCTGAGG + Intergenic
1158475262 18:57774086-57774108 CTCCCTGGTCCTGGAGCTTGGGG + Intronic
1159533768 18:69688770-69688792 GTCCTTGCTTTGGGAGGTTGAGG - Intronic
1160008378 18:75085474-75085496 CTGCCTGGCCATGGAGGTTGGGG + Intergenic
1160441880 18:78899392-78899414 CTCCAGGCTCAGGGAGATGGGGG - Intergenic
1160945334 19:1640099-1640121 CCACCTGCGCAGGGAGGCTGAGG - Intronic
1161065920 19:2237165-2237187 CTCACTGCTCAGGGAGGCCTTGG + Intronic
1161068611 19:2249836-2249858 CACCCTGGGCAGGGAGGCTGTGG + Intronic
1161951340 19:7469707-7469729 GTCCTTCCGCAGGGAGGTTGGGG + Intronic
1162344711 19:10112468-10112490 CTCCCTCCTTCGGGAGGATGGGG - Intronic
1162966533 19:14158863-14158885 CTCACAGCTCAGAGAGGATGGGG - Intronic
1163104382 19:15115119-15115141 TCCCCTCCTCAGGGAGGTTGTGG + Exonic
1164520441 19:28975122-28975144 CTGCCTGCTCAGGGAGGTCTTGG - Intergenic
1165054246 19:33163882-33163904 CTCAGTACTCTGGGAGGTTGAGG - Intronic
1165675181 19:37716672-37716694 CTCTCTGGGCAGGGAGGTTTGGG + Intronic
1166070212 19:40382795-40382817 CTCACTGCTTTGGGAGGTCGAGG + Intronic
1166703197 19:44893910-44893932 CTCCCTGCTCACGGTGGCCGAGG - Intronic
1166983414 19:46645395-46645417 CCGGCTGCTCAGGGGGGTTGAGG + Intergenic
1167769741 19:51507693-51507715 CTCCCGGTGCACGGAGGTTGAGG + Intergenic
1167772391 19:51529537-51529559 CTCCCTGCACTGGCAGCTTGGGG - Intronic
1167772587 19:51530507-51530529 ATCCCTCCTCAGGGATGTTGAGG - Intronic
1168188320 19:54716478-54716500 CTCACTTCTCAGAGTGGTTGTGG - Intergenic
925015514 2:521469-521491 CTCCTTTCTTAGGGAGGTAGGGG - Intergenic
925918551 2:8624188-8624210 CTCCGTGCCCAGGGAGGGAGTGG - Intergenic
927151574 2:20199229-20199251 CTCTGCTCTCAGGGAGGTTGTGG - Intergenic
927934665 2:27069643-27069665 CTCCCTGGTCCGGGGGGTAGGGG - Exonic
928377506 2:30787678-30787700 CTTGCTGCTCAGGGAAGCTGTGG - Intronic
928551850 2:32380474-32380496 ATCCCAGCTGAGGGAGGCTGAGG + Intronic
929514262 2:42592144-42592166 GTCCCAGCTAAGGGAGGCTGAGG + Intronic
931780478 2:65575230-65575252 CTCCCTGAAAAGGGAAGTTGGGG - Intergenic
932355119 2:71061980-71062002 ATCCCTACTCAGGGGGGCTGAGG + Intergenic
932463653 2:71899122-71899144 CTGCCTGCTCAGGGGAGGTGAGG + Intergenic
933994526 2:87658211-87658233 CTCCCTGTGCAGGTAGGGTGTGG - Intergenic
934658142 2:96127687-96127709 CCACCTACTCAGGGAGGCTGAGG - Intronic
936043039 2:109164296-109164318 CTAGCTACTCAGGGAGGCTGAGG - Intronic
936299332 2:111292702-111292724 CTCCCTGCGCAGGTAGGGTGTGG + Intergenic
937566238 2:123292636-123292658 CTAGCTACTCAGGGAGGCTGAGG - Intergenic
937958221 2:127435381-127435403 CTCCCAGCTTCTGGAGGTTGCGG - Intergenic
938079443 2:128361853-128361875 CTCCCTGCTCAAGGAAGCTGGGG - Intergenic
938241803 2:129748061-129748083 ATCTCTGCTCAGGAAGGGTGGGG - Intergenic
938734842 2:134176455-134176477 CTAGCTACTCAGGGAGGCTGAGG + Intronic
938819133 2:134936636-134936658 CCACCTTCTCAGGGAGGCTGAGG + Intronic
938860654 2:135364632-135364654 CTAGCTACTCAGGGGGGTTGAGG + Intronic
939599447 2:144170655-144170677 CTACTTGCTCAAGGAGGTTTGGG - Intronic
940307492 2:152242034-152242056 CTCTCTGCCCAGGGATGTTAGGG + Intergenic
940446644 2:153785301-153785323 CCCACTGCCCAGGGTGGTTGGGG - Intergenic
942443931 2:176065876-176065898 CCAGCTGCTCAGGGAGGCTGAGG + Intergenic
942554228 2:177155180-177155202 CTCAGTGCTTAGGGAGGCTGAGG - Intergenic
945230527 2:207584517-207584539 CTGACTACTCAGGGAGGCTGAGG - Intronic
946411649 2:219518136-219518158 CTCCCTGCTCAGAGCTGTGGAGG + Intronic
946522282 2:220479427-220479449 GTCCCAGCTGAGGGAGGCTGAGG + Intergenic
948059141 2:235030821-235030843 CCACCTGCTCAGGAAGGTTTTGG + Intronic
948412214 2:237772716-237772738 CTCTCAGCTCTGGGAGGTTGTGG + Intronic
1170874269 20:20235644-20235666 CTCCCTGCGGAGGGAGGATTAGG + Intronic
1172123342 20:32611171-32611193 CCCCCTGCTGAGCAAGGTTGGGG - Intergenic
1172188045 20:33043790-33043812 CTCTCTGCTCTGGGAGGTGGGGG + Intronic
1172228225 20:33319590-33319612 CTCTCAGCTCAGGGAGGTGCTGG + Intergenic
1172242652 20:33423529-33423551 CTTCCTCCTCAGGGAAGCTGAGG + Intronic
1172706680 20:36887300-36887322 CTCCGGGCTCAGGGATCTTGGGG - Intronic
1172963927 20:38819392-38819414 CTGGCTGCTTAGGGAGGCTGAGG + Intronic
1173615458 20:44400538-44400560 CTGCCTGCTCCGGGAGGGGGTGG + Intronic
1173838198 20:46139312-46139334 CTCAGTGCTCAGGGTGGTGGGGG - Intergenic
1173985933 20:47261421-47261443 CTAGCTACTCAGGGAGGGTGAGG + Intronic
1174867555 20:54152043-54152065 CAACCTGCTCAGGGAGGTGAGGG + Intergenic
1175411953 20:58776311-58776333 CTGCCTGCTCGGGGTGGGTGGGG + Intergenic
1175834939 20:61987486-61987508 CTCCCTGGTGACGGAGGATGCGG - Intronic
1175897891 20:62347462-62347484 CTTCTGGCTCAGGGAGGTTTTGG - Intronic
1176121971 20:63458099-63458121 CTGCGAGCCCAGGGAGGTTGCGG - Intronic
1176126646 20:63478501-63478523 TTGCCTGCTCAGGGATGTCGGGG - Intergenic
1178617207 21:34144742-34144764 CTCCCTGCCCAGGCTGGTGGTGG + Intergenic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1178803646 21:35820174-35820196 CTACCTGCTCAGTAAGTTTGAGG + Intronic
1178909756 21:36664997-36665019 CTCCCTCCTTAGGGAGCTTAAGG - Intergenic
1179107192 21:38412483-38412505 CTCCCTACTTAGGGAGGCTGTGG + Intronic
1179501499 21:41812149-41812171 CTCCCTACTCTGGGAGGCTCTGG - Intronic
1179982771 21:44905241-44905263 CGCCCTGCTCTGGGAGCCTGTGG + Intronic
1181036457 22:20171958-20171980 GGCCCTGCTCAGAGAGGCTGTGG - Intergenic
1181441968 22:22941425-22941447 CTCCCTGAGGAGGGAGCTTGGGG - Intergenic
1181483950 22:23218927-23218949 GGCCCTGCTCAGGGAGGAAGCGG + Intronic
1181670239 22:24422500-24422522 CTCCTTGTTCAGGGAAGTAGGGG + Intronic
1182165712 22:28170916-28170938 CTCTCTGCACAGAGAGGCTGGGG - Intronic
1182351421 22:29702176-29702198 CTGCCTGCTCAGGGAGGAAGGGG + Intergenic
1182698274 22:32210914-32210936 GTTCCTGCTCAGGGAGGCAGTGG - Intergenic
1182836957 22:33350043-33350065 TTCCCTGCCCAAGGAGGTAGAGG + Intronic
1183472351 22:38016415-38016437 GTCCCTTCTCTGGGAGGTGGCGG - Intronic
1184819128 22:46895487-46895509 ATCCCAGCCCAGGGAGGCTGAGG - Intronic
950829351 3:15859373-15859395 CTACCTGGTCACGGAGTTTGAGG + Exonic
951546302 3:23829550-23829572 CCCCGTGCTTTGGGAGGTTGAGG - Intronic
953027378 3:39152996-39153018 CTCCCCCCTCGGGGAGGCTGCGG - Intronic
953038815 3:39236963-39236985 CTCCCAGCTCAGGAGTGTTGAGG + Intergenic
953392248 3:42540485-42540507 CTCTCTGCACAGGGATGGTGGGG - Intergenic
953607387 3:44420675-44420697 CTCCTTGATCAGGCTGGTTGAGG - Intergenic
953778234 3:45841851-45841873 TCCCCTTCTCAGGGAGGCTGAGG + Intronic
953891759 3:46756326-46756348 AGCCTGGCTCAGGGAGGTTGAGG - Exonic
954106381 3:48411877-48411899 CCGCCTGCTCAGAGAGGATGTGG - Exonic
955348449 3:58177815-58177837 CTCCCCTCTCGGGGAAGTTGTGG + Intergenic
958539671 3:95454612-95454634 CTCCCAGCTCTGAGAGGCTGAGG + Intergenic
958836390 3:99149313-99149335 CTCACTGTTCAGGGTGGCTGGGG - Intergenic
958885606 3:99723309-99723331 CTATCGGCTCAGGGTGGTTGAGG + Intronic
959369216 3:105502699-105502721 TTCCCTGCACAGGGAGGCAGTGG - Intronic
959911217 3:111765743-111765765 CTCCCTTCTCAGGGAACTTCTGG - Intronic
960577510 3:119242731-119242753 CTGCCTGGTCCGGGAGGTGGGGG + Intergenic
960709273 3:120511235-120511257 CTTCCTGCTGACAGAGGTTGGGG - Intergenic
962234139 3:133693366-133693388 CTCCCTGTTCAGTTATGTTGAGG + Intergenic
962258043 3:133885560-133885582 CTACCTGCTCAGGTTGGATGTGG - Intronic
965142896 3:164862428-164862450 CTCCCTGTTGAGTGAGGGTGTGG + Intergenic
966932956 3:184687557-184687579 TTCCCTGCCCTGGGAGGGTGTGG + Intergenic
968284330 3:197499242-197499264 CGCCCTGCACAGTGAGGTCGTGG - Intergenic
968502475 4:957332-957354 CTCCCTCCACAGGGAGGCTGTGG - Intronic
973073495 4:45894788-45894810 CTCCCTGTTCAGGGGGTCTGTGG - Intergenic
976555202 4:86443034-86443056 GTTTCTGCTCAGGGAAGTTGTGG - Intronic
978534349 4:109745306-109745328 GTCCCAGCTCCTGGAGGTTGAGG - Intronic
981083333 4:140657147-140657169 CTCCTTGCTCAGCGATGATGTGG - Exonic
981351725 4:143737632-143737654 CTGGCTGCTCAGGGTGCTTGGGG + Intergenic
984616839 4:181907696-181907718 CTCCCTCCTCTGAGAGCTTGTGG - Intergenic
984684765 4:182654895-182654917 CTTTCTCCTTAGGGAGGTTGAGG + Intronic
985317836 4:188677231-188677253 TTCCATGCTCATGGAGGTTAAGG + Intergenic
985599395 5:818606-818628 CGCCCTGCTATGGGAGGCTGAGG + Intronic
985647509 5:1091934-1091956 TTCCCGGCTCGGGGAGCTTGTGG - Intronic
985717776 5:1472229-1472251 CTCCCTGTTCAGAGAGCTGGGGG + Intronic
986425429 5:7626736-7626758 CTCCCTGGGAAGGGAGTTTGAGG - Intronic
988485887 5:31667796-31667818 GGCCCTGCTCAGGAAGGTAGAGG + Intronic
988998754 5:36739826-36739848 CTCCCTCCTCTGGGAGCCTGCGG - Intergenic
989205503 5:38805434-38805456 CTCCCAGCTCAGGGAGGGTCTGG + Intergenic
990289218 5:54331542-54331564 CTCCCTCCTAAGGGAAGTTGGGG + Intergenic
992878458 5:81081297-81081319 CTCCCTGGTCACAGAGGCTGTGG + Intronic
994025151 5:95073441-95073463 CTCCATACTCAGTAAGGTTGAGG - Intronic
994923075 5:106077418-106077440 CTCTCTACTGTGGGAGGTTGAGG + Intergenic
995176892 5:109188297-109188319 CTCCCTCCTTTGGGAGGCTGAGG + Exonic
995885855 5:116893522-116893544 CTCCATGTTCAGTGATGTTGAGG + Intergenic
997654045 5:135542400-135542422 CTCACTGCTGAGGAAGGGTGGGG - Intergenic
998871753 5:146559645-146559667 GTCCCAGCTTCGGGAGGTTGAGG - Intergenic
999144957 5:149386270-149386292 CACCTGGCTCAGGGAGCTTGGGG + Intronic
999743377 5:154573886-154573908 CCCCAGCCTCAGGGAGGTTGAGG + Intergenic
999872254 5:155765026-155765048 CTCAGTGCTTTGGGAGGTTGAGG + Intergenic
1001194619 5:169660861-169660883 CTCCCTTCTGAGTGAGGATGAGG + Intronic
1001475958 5:172050995-172051017 CCAGCTGCTCAGGAAGGTTGAGG + Intronic
1001557929 5:172648883-172648905 CTCCCTGCCCAGGCAGGTCAGGG + Intronic
1002560475 5:180078507-180078529 CAGCCTGCTCCGTGAGGTTGGGG - Intergenic
1002845196 6:939209-939231 CTCCAAGCACAGGGAGGTGGTGG + Intergenic
1003512124 6:6790391-6790413 CTCCCTGATGAGAGAGGTTCAGG + Intergenic
1006973822 6:38077177-38077199 CTCTCTGCCCAGGGAGGCTTAGG + Intronic
1007180085 6:39923463-39923485 CTCACTGGTCAGGGAGGTACAGG - Intronic
1008231378 6:48988233-48988255 CTAGCTACTCAGGGAGGCTGAGG - Intergenic
1009590421 6:65662632-65662654 ATCCATGCTCAGGGTGGATGTGG + Intronic
1011601363 6:89063284-89063306 CCAGCTACTCAGGGAGGTTGAGG - Intergenic
1011954987 6:93015640-93015662 ATCCCTGCTCAGGAAGGGTGGGG - Intergenic
1013652682 6:112211963-112211985 GTCAGTGGTCAGGGAGGTTGTGG + Intronic
1015115331 6:129642544-129642566 CTCAGTGCTTTGGGAGGTTGAGG - Intronic
1015306580 6:131715586-131715608 ATCCCTGCACAGGAAGGATGGGG - Intronic
1015485308 6:133763378-133763400 CTCCTTGCTGTGGGAGGGTGGGG + Intergenic
1016291208 6:142530228-142530250 CTCCCTGCTCAAGGAGAGAGAGG - Intergenic
1017208667 6:151831388-151831410 CTCACTGCTCTGGAAGGCTGCGG - Intronic
1018024029 6:159790004-159790026 GTCCCTGCTCGGGGAGCGTGAGG + Intronic
1018046631 6:159970960-159970982 CTCCCAGTTAAGGGAGGCTGAGG + Intronic
1018067774 6:160135652-160135674 CTGCATGCTCAGGCAGGGTGAGG + Intronic
1018072109 6:160173981-160174003 CTCCCTGCTCAGGGAGGGTGAGG + Intronic
1018705295 6:166459968-166459990 CTCCCTGCCCTGGGACTTTGGGG + Intronic
1018778364 6:167039933-167039955 ATCCCAGCTCAGTGATGTTGCGG + Exonic
1018798744 6:167206907-167206929 CTCCCTGATCAGCCAGGCTGGGG + Intergenic
1018834762 6:167474562-167474584 ATCCCTGCAGAGTGAGGTTGAGG + Intergenic
1022019937 7:26388893-26388915 CTCCCTTCCCTGGGAGGCTGAGG + Intergenic
1023266606 7:38412572-38412594 CAACCTGCTCTGTGAGGTTGGGG + Intronic
1023813721 7:43932102-43932124 CCAGCTACTCAGGGAGGTTGAGG - Intronic
1023940438 7:44765738-44765760 CTCCCATCTCAGGGACGTGGCGG + Intronic
1026031037 7:66794404-66794426 CCCAGTGCTCTGGGAGGTTGAGG - Intronic
1026372922 7:69719601-69719623 CTGCCTGCTATGGGAAGTTGAGG + Intronic
1026880657 7:73904877-73904899 CTCCGGCCTCAGCGAGGTTGGGG - Intergenic
1026891706 7:73986255-73986277 ATCCCAGCTCAGGGAGGGTGGGG + Intergenic
1026943706 7:74303180-74303202 TGCCCTGGTCAGGGAGGATGTGG + Intronic
1027121077 7:75520865-75520887 ATCCCAGCTGAGGGAGGCTGAGG + Intergenic
1027592671 7:80135220-80135242 CGCCGTCCTCACGGAGGTTGCGG - Exonic
1029446401 7:100615208-100615230 GACCCTGCCCAGGGAGGGTGGGG - Exonic
1031665327 7:124476379-124476401 CTCCCCACTCAGGGTGGCTGTGG + Intergenic
1032023237 7:128421647-128421669 CTCGGTCCTCAGGGTGGTTGTGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032217461 7:129968819-129968841 CTCACTCCTAGGGGAGGTTGAGG - Intergenic
1033325120 7:140371289-140371311 ATCCCAGCTGAGGGAGGCTGAGG - Intronic
1033652925 7:143355693-143355715 ATCCCTGCTCCGGGAGCCTGAGG - Exonic
1033730969 7:144178914-144178936 ATCCCTGCACAGGAAGGATGGGG + Intergenic
1034532244 7:151703044-151703066 CTCCCTGGGCAGGCAGGTTAGGG - Intronic
1035755322 8:2026730-2026752 CTCCCTGCTCCGGGGGCTGGGGG + Intergenic
1036416107 8:8550181-8550203 CTCCCACTTCAGGGAGGATGTGG + Intergenic
1037589231 8:20299315-20299337 CTCCCTGGTAAGGAAGGTTCTGG + Intronic
1037634868 8:20692501-20692523 TGCTCTGCTCAGGGAGGTTCTGG - Intergenic
1037849206 8:22312514-22312536 CTCACTGCTTTGGGAGGTTGAGG - Intronic
1038293624 8:26271434-26271456 ATCCCAGCACTGGGAGGTTGAGG - Intergenic
1038488547 8:27953290-27953312 CTTCCTGCCCACGGAGGATGCGG + Intronic
1038515932 8:28187746-28187768 CTTCCTGCGGAGGGAGCTTGCGG + Intronic
1038654341 8:29435586-29435608 CTCCTGGCTCTTGGAGGTTGGGG - Intergenic
1039456726 8:37712150-37712172 CTCCCTGCTGAGTGGGCTTGAGG - Intergenic
1040512620 8:48108447-48108469 CTCCCAAGTCAGGGAGGCTGTGG - Intergenic
1041600240 8:59708663-59708685 CTCCTCTCTAAGGGAGGTTGTGG - Intergenic
1042081803 8:65061779-65061801 CACTCTGGCCAGGGAGGTTGGGG - Intergenic
1042415610 8:68514295-68514317 CTCAGTGCTCAGGCTGGTTGAGG + Intronic
1042829953 8:73016000-73016022 ATCCCAGCTCTGGGAGGCTGAGG + Intronic
1043015063 8:74928786-74928808 TTGCCTGAGCAGGGAGGTTGAGG - Intergenic
1045189835 8:99871727-99871749 CTAGCTGGCCAGGGAGGTTGAGG + Intronic
1046816760 8:118592973-118592995 TTCTCTTCTCAGGGAGGGTGGGG + Intronic
1046962554 8:120125958-120125980 CTCCCGGCGCAGAGAGGTGGAGG - Intronic
1047169688 8:122479847-122479869 CTTCCTTCTCAGGGAGGAAGAGG - Intergenic
1047193055 8:122696020-122696042 GTCACTGCTCGGGGAGGCTGAGG + Intergenic
1047334239 8:123920646-123920668 CTCCCTACTCAGGGATTTTATGG + Intronic
1047482962 8:125302072-125302094 ATCCCAGCTCTGGGAGGCTGAGG - Intronic
1048223853 8:132566424-132566446 CTTCCTGCTCTGCGGGGTTGGGG + Intergenic
1049574500 8:143384079-143384101 ACCCCGGCTCAGGCAGGTTGGGG - Exonic
1049644705 8:143730841-143730863 CTCCTTTCTCTGGGAGGCTGAGG + Intronic
1049654848 8:143792934-143792956 CTCCCTGCTGCGCGTGGTTGGGG - Intronic
1050263521 9:3866219-3866241 CTCTGTGCTCAGGGAGACTGGGG + Intronic
1050599904 9:7239942-7239964 AACACTGCTCAGGCAGGTTGAGG - Intergenic
1050844152 9:10192889-10192911 CTCCCTGCTTAGGAAGCTTTAGG - Intronic
1052953912 9:34237649-34237671 CACCAAGCTCAGGGAGGTCGAGG - Intronic
1053592974 9:39533134-39533156 CTCCCTGCTCTGAGATGTTGGGG - Intergenic
1053850710 9:42287842-42287864 CTCCCTGCTGTGAGATGTTGGGG - Intergenic
1054573332 9:66832143-66832165 CTCCCTGCTCTGAGATGTTGGGG + Intergenic
1055563781 9:77548187-77548209 CTCCCAGCTCCTGGTGGTTGTGG + Intronic
1057294909 9:93829312-93829334 TTCCCTGCTCTGGGAAGTTGAGG + Intergenic
1057851007 9:98566729-98566751 CCAGCTGCTCAGGGAGGCTGAGG + Intronic
1058091270 9:100808449-100808471 CTAGCTACTCAGGGAGGCTGAGG + Intergenic
1059173983 9:112152515-112152537 CTAGCTACTCAGGGAGGTTGGGG - Intronic
1059328905 9:113522849-113522871 CCACCTTCTCGGGGAGGTTGTGG + Intronic
1060052378 9:120386602-120386624 CTCCCTCTTCTGGGAGGTGGAGG - Intergenic
1060299040 9:122363278-122363300 ATCCCAGCTCAGGGAGGCTGAGG - Intergenic
1062395577 9:136351326-136351348 CTCCAGGCCCAGGGAGGCTGGGG - Intronic
1062536950 9:137025277-137025299 CCCCCAGCTCAGGGAGGAGGAGG + Intronic
1062560855 9:137141293-137141315 CTCCCTGCCTTGGGAGGCTGGGG + Intronic
1062590138 9:137270801-137270823 ATCCCAGCTGAGGGAGGCTGAGG + Intronic
1185462251 X:338768-338790 CTCCCTGCTCAGGGTGAGTGCGG - Exonic
1185731176 X:2463198-2463220 CTCCCTACTCAGAGAGGCTGTGG + Intronic
1186407101 X:9313728-9313750 CACACTGCTCAGAGAGGTGGTGG + Intergenic
1187230262 X:17415024-17415046 TGCCCTGCCCCGGGAGGTTGTGG + Intronic
1187656499 X:21481069-21481091 TTTCCTTCTTAGGGAGGTTGTGG + Intronic
1189377353 X:40475999-40476021 CTCCCTGCTCAGAGAGGCCAGGG - Intergenic
1190689469 X:52901387-52901409 ATCCCTGCTTCGGGAGGCTGAGG - Intronic
1190696514 X:52954405-52954427 ATCCCTGCTTCGGGAGGCTGAGG + Intronic
1192227383 X:69238572-69238594 CTCCCTGGGAAGGGAGGCTGTGG + Intergenic
1194327948 X:92543660-92543682 ATCCCAGCTGAGGGAGGCTGAGG + Intronic
1195857305 X:109345132-109345154 CTCACTTCTCAGGGAGGTTAGGG + Intergenic
1196613795 X:117743755-117743777 CTCCCAGTTCAGGGAGCTTGGGG + Intergenic
1197232157 X:124016714-124016736 CTCAGTACTCTGGGAGGTTGAGG + Intronic
1197390801 X:125861371-125861393 GTCTCTGCTCAGGAAGGTTAGGG - Intergenic
1198571933 X:137966689-137966711 CTCCCAGATCTGGGAGGATGTGG - Intergenic
1198824782 X:140688077-140688099 CCCTGTCCTCAGGGAGGTTGTGG + Intergenic
1199722105 X:150549442-150549464 CTGAGAGCTCAGGGAGGTTGGGG + Intergenic
1199830548 X:151545380-151545402 CCAGCTGCTCAGGGAGGCTGAGG - Intergenic
1200636661 Y:5662871-5662893 ATCCCAGCTGAGGGAGGCTGAGG + Intronic
1201010418 Y:9545460-9545482 CTCCTTGATCAGGCAGGTGGAGG - Intergenic
1201579608 Y:15496673-15496695 CTCTCGGATCATGGAGGTTGGGG + Intergenic